The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038444	Aeromonas media strain T5-8 chromosome, complete genome	4791767	684550	694526	4791767	tRNA	uncultured_Mediterranean_phage(25.0%)	10	NA	NA
WP_042648740.1|684550_685312_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.4	3.3e-70
WP_005332743.1|685316_685934_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.4	2.4e-34
WP_041205044.1|685930_686512_+	DedA family protein	NA	NA	NA	NA	NA
WP_041205045.1|686521_687586_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0A7NU10	Lactobacillus_phage	36.2	4.9e-11
WP_005331913.1|687632_688616_+	RNA polymerase sigma factor RpoS	NA	F4YCU2	Synechococcus_phage	33.7	4.9e-34
WP_005331910.1|688703_689717_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.6	3.1e-108
WP_005309452.1|689896_690112_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_005331908.1|690127_690571_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	48.6	2.0e-27
WP_005331907.1|690659_692447_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	41.4	4.0e-74
WP_081805626.1|692660_694526_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	32.6	1.1e-34
>prophage 2
NZ_CP038444	Aeromonas media strain T5-8 chromosome, complete genome	4791767	745498	802508	4791767	tRNA,integrase,transposase	uncultured_Caudovirales_phage(20.0%)	50	741130:741146	799019:799035
741130:741146	attL	CAGGCCATCCTCGGCCA	NA	NA	NA	NA
WP_041206812.1|745498_746401_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_005329052.1|746513_746963_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_005327571.1|747088_747826_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_005327573.1|747822_748368_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_042650421.1|748604_751052_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	27.8	2.9e-27
WP_005327576.1|751316_753638_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_042650422.1|753680_754091_+	VOC family protein	NA	NA	NA	NA	NA
WP_041205253.1|754176_755514_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_042649474.1|755613_755934_-	ligand-binding protein SH3	NA	NA	NA	NA	NA
WP_042649475.1|755921_756314_-	multidrug transporter	NA	NA	NA	NA	NA
WP_042649476.1|756472_757354_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042649477.1|757417_757933_-	DUF2937 family protein	NA	NA	NA	NA	NA
WP_042649478.1|758142_758859_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_042649479.1|759105_760026_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_042649483.1|760064_760889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042649480.1|761099_762386_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_042649481.1|762608_764003_+	H(+)/Cl(-) exchange transporter ClcA	NA	NA	NA	NA	NA
WP_042649482.1|764090_764783_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025328177.1|764872_765223_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	49.5	6.7e-26
WP_042649676.1|771287_771920_+	LysE family translocator	NA	NA	NA	NA	NA
WP_158196703.1|772166_773384_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	49.9	1.6e-103
WP_158196705.1|774439_774844_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_158196706.1|774926_775976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158196707.1|776362_776575_+	AlpA family phage regulatory protein	NA	A0A1V0E8E5	Vibrio_phage	35.9	2.3e-05
WP_158196708.1|776997_777972_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_024945142.1|778118_778463_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J5G9	uncultured_Caudovirales_phage	34.3	1.5e-06
WP_158196709.1|778744_779098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042034774.1|779109_779262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158196710.1|779273_779948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158196711.1|780035_780599_+	lecithin retinol acyltransferase family protein	NA	NA	NA	NA	NA
WP_171269439.1|780634_781060_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_158196713.1|781070_781499_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158196714.1|781866_782364_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_158196715.1|782360_782552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158198333.1|782666_782915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158196716.1|783031_783541_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158196717.1|783537_783753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158196718.1|783749_784112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029303521.1|784191_784734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158196719.1|784735_785077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158196720.1|785109_785406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158196721.1|785495_785810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042054148.1|785884_786220_+	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_158196722.1|786418_787848_-|transposase	IS66-like element ISAeme23 family transposase	transposase	NA	NA	NA	NA
WP_171268589.1|788567_790532_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	35.6	3.6e-20
WP_158196725.1|790769_791931_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	49.7	4.1e-80
WP_171268590.1|792103_794572_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.1	2.4e-13
WP_171268591.1|794694_799965_+	PAS domain S-box protein	NA	A0A1V0SGX0	Hokovirus	31.1	2.1e-62
799019:799035	attR	TGGCCGAGGATGGCCTG	NA	NA	NA	NA
WP_158196728.1|799996_800746_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	36.9	7.3e-14
WP_158196729.1|800999_802508_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP038444	Aeromonas media strain T5-8 chromosome, complete genome	4791767	1188379	1256338	4791767	tRNA,transposase,protease	Vibrio_phage(13.33%)	57	NA	NA
WP_012564931.1|1188379_1189327_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_171268664.1|1189354_1190404_+	type IV pilus assembly protein PilM	NA	NA	NA	NA	NA
WP_005329944.1|1190391_1190961_+	PilN domain-containing protein	NA	NA	NA	NA	NA
WP_171269444.1|1191560_1192088_+	pilus assembly protein PilP	NA	NA	NA	NA	NA
WP_171268665.1|1192104_1194330_+	type IV pilus secretin PilQ family protein	NA	R9TEZ5	Vibrio_phage	21.9	4.4e-14
WP_005329951.1|1194521_1195040_+	shikimate kinase AroK	NA	NA	NA	NA	NA
WP_171268666.1|1195056_1196139_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_171268667.1|1196128_1197673_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_042649565.1|1197743_1198616_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.3	4.2e-69
WP_041205203.1|1198822_1199494_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_171268668.1|1199483_1200149_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_041205201.1|1200166_1201171_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005329964.1|1201294_1201510_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171268669.1|1201879_1202461_+	aminodeoxychorismate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	63.0	9.2e-73
WP_171268670.1|1202739_1203957_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	27.3	2.7e-26
WP_025326162.1|1204032_1205052_+	arginine N-succinyltransferase	NA	NA	NA	NA	NA
WP_171268671.1|1205117_1206587_+	succinylglutamate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_171268672.1|1206736_1207534_+	DUF1338 domain-containing protein	NA	NA	NA	NA	NA
WP_171268673.1|1207625_1208222_-	beta-phosphoglucomutase family hydrolase	NA	A0A1D8KPI1	Synechococcus_phage	26.7	2.5e-09
WP_171268674.1|1208344_1209757_+	MFS transporter	NA	NA	NA	NA	NA
WP_171268675.1|1209860_1210247_-	DUF1622 domain-containing protein	NA	NA	NA	NA	NA
WP_171268676.1|1210308_1211229_-	alpha/beta hydrolase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	34.5	9.6e-24
WP_171268677.1|1211316_1211649_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_171268678.1|1211931_1213764_+	SLC13 family permease	NA	NA	NA	NA	NA
WP_171268679.1|1215102_1216194_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_005330168.1|1216428_1217025_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_171268680.1|1217221_1219210_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_042652671.1|1219305_1220253_-	ribose-phosphate pyrophosphokinase	NA	A0A2K9L8D8	Tupanvirus	37.7	7.8e-45
WP_171269445.1|1220478_1221366_-	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_162520188.1|1221365_1221944_-	outer membrane lipoprotein LolB	NA	NA	NA	NA	NA
WP_171268681.1|1222069_1223329_+|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_171268682.1|1223380_1224469_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	38.5	2.5e-07
WP_171268683.1|1224468_1225302_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_043133018.1|1225344_1225728_+	SirB2 family protein	NA	NA	NA	NA	NA
WP_042649337.1|1225739_1226540_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_171268684.1|1226577_1227432_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.2	3.0e-48
WP_041205731.1|1228117_1229386_-|transposase	IS4-like element ISAeme3 family transposase	transposase	NA	NA	NA	NA
WP_005330139.1|1230514_1230895_-	autonomous glycyl radical cofactor GrcA	NA	A0A219YAN3	Aeromonas_phage	59.5	2.8e-30
WP_171268685.1|1231486_1232173_+	uracil-DNA glycosylase	NA	A0A0A7D9F8	Equid_alphaherpesvirus	49.3	4.3e-53
WP_041205240.1|1232357_1232906_+	hemerythrin domain-containing protein	NA	NA	NA	NA	NA
WP_025326190.1|1233002_1233182_-	DUF3545 family protein	NA	NA	NA	NA	NA
WP_041206846.1|1233375_1234326_-	transaldolase	NA	A0A127KNC6	Cyanophage	30.7	2.7e-13
WP_041205244.1|1235070_1236510_+	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_041205051.1|1237862_1239200_+|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_171268686.1|1239618_1240791_+	MFS transporter	NA	NA	NA	NA	NA
WP_171269446.1|1240809_1241823_+	HTH-type transcriptional regulator YidZ	NA	NA	NA	NA	NA
WP_025326196.1|1241850_1242273_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_171268687.1|1242593_1243148_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_163136244.1|1243343_1244294_-	glutathione synthase	NA	NA	NA	NA	NA
WP_171268688.1|1244345_1245077_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_171268689.1|1245146_1245845_-	endonuclease	NA	NA	NA	NA	NA
WP_171268690.1|1245918_1246458_-|protease	SprT family zinc-dependent metalloprotease	protease	A0A060AI19	Cronobacter_phage	28.0	5.9e-05
WP_025326202.1|1246526_1247678_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	62.6	4.7e-129
WP_171268691.1|1248019_1250011_+	transketolase	NA	NA	NA	NA	NA
WP_171269447.1|1250510_1250786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005327996.1|1251971_1253390_+|transposase	IS66-like element ISUnCu16 family transposase	transposase	NA	NA	NA	NA
WP_010676219.1|1255240_1256338_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP038444	Aeromonas media strain T5-8 chromosome, complete genome	4791767	1460359	1485433	4791767	transposase	Helicobacter_phage(40.0%)	26	NA	NA
WP_041205574.1|1460359_1460785_-|transposase	IS200/IS605-like element ISAeme8 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	46.9	4.9e-23
WP_041207020.1|1460842_1461982_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	68.4	6.1e-145
WP_005326910.1|1462045_1463692_-	response regulator	NA	NA	NA	NA	NA
WP_041205380.1|1463969_1464395_+	Hsp20/alpha crystallin family protein	NA	A0A1B2LRT2	Wolbachia_phage	40.0	3.9e-12
WP_041205253.1|1464436_1465774_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_171268789.1|1465879_1466914_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_041205381.1|1467215_1467656_+	azurin	NA	NA	NA	NA	NA
WP_041205382.1|1467847_1468051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005326904.1|1468064_1468625_-	HutD family protein	NA	NA	NA	NA	NA
WP_005326903.1|1468889_1469858_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_005326902.1|1469960_1470290_+	DUF3634 family protein	NA	NA	NA	NA	NA
WP_005326901.1|1470393_1471302_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005326900.1|1471422_1471866_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_081805657.1|1472366_1473440_+	cytochrome o ubiquinol oxidase subunit II	NA	NA	NA	NA	NA
WP_041205386.1|1473443_1475420_+	cytochrome o ubiquinol oxidase subunit I	NA	NA	NA	NA	NA
WP_005327189.1|1475424_1476036_+	cytochrome o ubiquinol oxidase subunit III	NA	NA	NA	NA	NA
WP_005327195.1|1476035_1476365_+	cytochrome o ubiquinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_005327197.1|1476378_1477269_+	protoheme IX farnesyltransferase	NA	NA	NA	NA	NA
WP_043133721.1|1477549_1478911_+	MFS transporter	NA	NA	NA	NA	NA
WP_043133720.1|1478968_1479337_+	DUF1428 domain-containing protein	NA	NA	NA	NA	NA
WP_041205051.1|1479471_1480809_-|transposase	IS4-like element ISAeme15 family transposase	transposase	NA	NA	NA	NA
WP_171269454.1|1480932_1482036_-	YdcF family protein	NA	NA	NA	NA	NA
WP_005332127.1|1482185_1483079_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_081805658.1|1483179_1483668_+	DMT family transporter	NA	NA	NA	NA	NA
WP_041205449.1|1483744_1484149_-|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	1.1e-29
WP_021141234.1|1484206_1485433_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
>prophage 5
NZ_CP038444	Aeromonas media strain T5-8 chromosome, complete genome	4791767	1490717	1535686	4791767	transposase	Escherichia_phage(20.0%)	37	NA	NA
WP_171268790.1|1490717_1491731_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	5.4e-185
WP_043133450.1|1492061_1492868_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_005323481.1|1492864_1494058_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_081934677.1|1494112_1495537_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	41.3	8.1e-38
WP_043133454.1|1495596_1496610_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	38.7	4.4e-54
WP_005323478.1|1496619_1497219_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	36.8	1.2e-27
WP_005323477.1|1497211_1498849_-	anthranilate synthase component 1	NA	NA	NA	NA	NA
WP_005323476.1|1499270_1500152_+	PHP domain-containing protein	NA	NA	NA	NA	NA
WP_005323475.1|1500281_1500902_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_171268791.1|1500894_1501776_+	segregation/condensation protein A	NA	NA	NA	NA	NA
WP_005323473.1|1501811_1502384_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	36.3	8.1e-21
WP_005323472.1|1502494_1503418_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_005323471.1|1503673_1504537_+	acyl-CoA thioesterase II	NA	NA	NA	NA	NA
WP_042649757.1|1504611_1505790_-	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_005323469.1|1505907_1506567_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_005323466.1|1506666_1507308_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041206082.1|1507460_1508654_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_041206081.1|1508671_1511821_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_041206080.1|1511813_1513229_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_041205574.1|1513792_1514218_-|transposase	IS200/IS605-like element ISAeme8 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	46.9	4.9e-23
WP_041206863.1|1514275_1515415_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	68.7	7.2e-146
WP_041206078.1|1516065_1517607_+|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	2.5e-125
WP_041206077.1|1517621_1518377_+	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	51.5	2.6e-59
WP_005328262.1|1519149_1519302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041206074.1|1519867_1520182_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_005328266.1|1520187_1520523_-	addiction module protein	NA	A0A141GEX6	Brucella_phage	46.4	2.0e-11
WP_171268792.1|1520748_1521306_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	35.1	6.0e-21
WP_005325174.1|1522450_1522753_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_041205730.1|1522752_1523118_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_103857963.1|1523166_1524780_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.0	1.3e-39
WP_171268793.1|1524929_1526543_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171268794.1|1526539_1529047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171268795.1|1529476_1530037_-	ribonuclease HI	NA	A0A2H4PRM3	Proteus_phage	37.4	1.3e-20
WP_171268796.1|1530218_1531514_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	45.7	4.1e-12
WP_171268797.1|1532024_1532426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171268798.1|1532490_1534398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171268799.1|1534669_1535686_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	92.0	7.8e-168
>prophage 6
NZ_CP038444	Aeromonas media strain T5-8 chromosome, complete genome	4791767	1579239	1631478	4791767	transposase	Escherichia_phage(25.0%)	45	NA	NA
WP_099369027.1|1579239_1580256_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	4.9e-186
WP_005342491.1|1580382_1581333_+|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
WP_171268825.1|1581363_1581576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171269456.1|1581666_1583190_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_171268826.1|1583203_1584586_+	Coenzyme F420 hydrogenase/dehydrogenase, beta subunit C-terminal domain	NA	NA	NA	NA	NA
WP_171268827.1|1584588_1585716_+	polysaccharide pyruvyl transferase family protein	NA	NA	NA	NA	NA
WP_171268828.1|1585708_1586707_+	glycosyltransferase family 2 protein	NA	A0A1V0SAH6	Catovirus	27.0	1.2e-06
WP_088813959.1|1587435_1588997_-|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
WP_001310555.1|1589582_1590599_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_171269457.1|1590998_1591274_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171268829.1|1591267_1592323_+	EpsG family protein	NA	NA	NA	NA	NA
WP_171268830.1|1592324_1593428_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_171268831.1|1593473_1594574_+	glycosyltransferase	NA	NA	NA	NA	NA
WP_171268832.1|1594591_1595629_+	polysaccharide biosynthesis protein	NA	A0A1V0SJP4	Klosneuvirus	33.7	4.2e-36
WP_171268833.1|1595631_1596513_+	SDR family oxidoreductase	NA	A0A2L2DJC0	Acanthamoeba_polyphaga_mimivirus	31.3	6.6e-30
WP_171268834.1|1596500_1597634_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	51.6	5.4e-109
WP_171268835.1|1597630_1598839_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_171268836.1|1599342_1600464_+	polysaccharide export protein	NA	NA	NA	NA	NA
WP_171268837.1|1600529_1600958_+	protein tyrosine phosphatase	NA	NA	NA	NA	NA
WP_171268838.1|1601020_1603198_+	polysaccharide biosynthesis tyrosine autokinase	NA	NA	NA	NA	NA
WP_001310555.1|1603318_1604335_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.7	9.8e-187
WP_171268839.1|1604872_1605544_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_171268840.1|1605591_1606296_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_171268841.1|1606292_1608377_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_171268842.1|1608462_1610181_+	O-antigen ligase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004576012.1|1610226_1611645_-|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_171269458.1|1611913_1612348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171268843.1|1612522_1613176_+	DUF480 domain-containing protein	NA	NA	NA	NA	NA
WP_171268844.1|1613381_1617218_+	DEAD/DEAH box helicase	NA	A0A160DHD3	Gordonia_phage	29.0	5.8e-46
WP_171268845.1|1617313_1618207_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_005331430.1|1618729_1618939_+	DUF1127 domain-containing protein	NA	NA	NA	NA	NA
WP_041206057.1|1619211_1620228_+	succinylglutamate desuccinylase	NA	NA	NA	NA	NA
WP_171268846.1|1620489_1621587_+	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	NA	NA	NA	NA
WP_005331436.1|1621655_1622642_+	alpha-ketoacid dehydrogenase subunit beta	NA	A0A0K0KW14	Prochlorococcus_phage	28.8	1.8e-07
WP_171268847.1|1622736_1623837_+	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_005320244.1|1624051_1624252_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	59.4	3.0e-15
WP_041206056.1|1624347_1624644_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025327553.1|1624630_1624879_-	TIGR02647 family protein	NA	NA	NA	NA	NA
WP_041206055.1|1625127_1625685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005331447.1|1625779_1626172_+	DUF2750 domain-containing protein	NA	NA	NA	NA	NA
WP_171269459.1|1626258_1628064_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005331452.1|1628201_1629095_-	EamA family transporter	NA	NA	NA	NA	NA
WP_005331455.1|1629309_1629498_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171268848.1|1629789_1630194_-|transposase	IS200/IS605-like element ISAs26 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	54.8	8.8e-30
WP_021141234.1|1630251_1631478_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	O80301	Enterobacteria_phage	78.6	7.7e-154
>prophage 7
NZ_CP038444	Aeromonas media strain T5-8 chromosome, complete genome	4791767	1727645	1790413	4791767	tRNA,integrase,transposase	Catovirus(16.67%)	57	1724676:1724695	1795770:1795789
1724676:1724695	attL	CGCGCCGAGGAGATCCTGGC	NA	NA	NA	NA
WP_005342491.1|1727645_1728596_+|transposase	IS1595-like element ISKpn3 family transposase	transposase	NA	NA	NA	NA
WP_171268864.1|1728830_1730036_+|integrase	site-specific integrase	integrase	Q19US1	Mannheimia_phage	34.6	6.5e-12
WP_034523852.1|1730183_1730540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025201450.1|1730532_1730835_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_042648291.1|1730971_1731607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005325880.1|1731667_1732228_+	DUF2787 family protein	NA	NA	NA	NA	NA
WP_171268865.1|1732759_1733767_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	24.2	2.0e-06
WP_171268866.1|1734283_1734433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171268867.1|1734673_1735297_+	glutathione S-transferase	NA	NA	NA	NA	NA
WP_025327423.1|1735503_1735752_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_171268868.1|1735871_1736600_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_171268869.1|1736596_1737310_-	DUF4269 domain-containing protein	NA	NA	NA	NA	NA
WP_025327420.1|1737299_1737797_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_171268870.1|1738000_1739377_+|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	25.4	4.6e-46
WP_088813959.1|1739879_1741440_+|transposase	IS3-like element ISAs20 family transposase	transposase	NA	NA	NA	NA
WP_171268871.1|1741690_1742068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099368881.1|1742066_1743083_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
WP_171268872.1|1743191_1743620_-	protein kinase	NA	NA	NA	NA	NA
WP_010674210.1|1743902_1745516_+|transposase	IS1634-like element ISAs25 family transposase	transposase	NA	NA	NA	NA
WP_171268873.1|1746898_1747939_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	38.3	1.1e-12
WP_171268874.1|1748052_1748340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041204490.1|1748603_1748858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171269461.1|1749236_1749947_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_025327412.1|1750174_1750672_-	GDYXXLXY domain-containing protein	NA	NA	NA	NA	NA
WP_171268875.1|1750778_1751786_-	DUF4401 domain-containing protein	NA	NA	NA	NA	NA
WP_171268876.1|1751879_1752818_-	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_106886435.1|1754352_1754910_-	TMEM165/GDT1 family protein	NA	NA	NA	NA	NA
WP_163149208.1|1755166_1755496_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_171268877.1|1755616_1755844_+	ferrous iron transport protein A	NA	NA	NA	NA	NA
WP_171268878.1|1755840_1758111_+	Fe(2+) transporter permease subunit FeoB	NA	NA	NA	NA	NA
WP_163153777.1|1758154_1758397_+	LuxR family transcriptional regulator	NA	NA	NA	NA	NA
WP_111912664.1|1758500_1759772_-	glucose-1-phosphate adenylyltransferase	NA	NA	NA	NA	NA
WP_139751448.1|1760070_1761210_-	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_010675200.1|1761265_1761622_-	DMT family protein	NA	NA	NA	NA	NA
WP_171268879.1|1761734_1762484_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_111912660.1|1762570_1763578_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_171268880.1|1763564_1764350_+	ATP-binding cassette domain-containing protein	NA	A0A1V0SE00	Indivirus	27.8	3.0e-10
WP_139745172.1|1764726_1765794_-	3-deoxy-7-phosphoheptulonate synthase	NA	S4W5F1	Pandoravirus	49.3	4.6e-86
WP_171269462.1|1765991_1766315_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_042648947.1|1766413_1767646_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	49.1	3.1e-110
WP_005328069.1|1767899_1768553_-	ribose-5-phosphate isomerase RpiA	NA	NA	NA	NA	NA
WP_005328071.1|1768724_1769321_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_005328073.1|1769555_1770902_-	Na+/H+ antiporter NhaC family protein	NA	NA	NA	NA	NA
WP_041206990.1|1771223_1772036_+	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_041205988.1|1772704_1773841_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	33.3	1.6e-49
WP_005328082.1|1773857_1777082_+	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_041205987.1|1777605_1779264_+	2-isopropylmalate synthase	NA	NA	NA	NA	NA
WP_005328087.1|1779321_1780410_-	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_171269463.1|1780696_1781803_+	DUF1615 domain-containing protein	NA	NA	NA	NA	NA
WP_042648946.1|1781862_1782756_-	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	29.3	1.3e-20
WP_042648945.1|1782797_1783763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042648944.1|1784110_1784761_+	DedA family protein	NA	NA	NA	NA	NA
WP_005328097.1|1785028_1786324_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	31.7	9.3e-49
WP_171268881.1|1786405_1787044_+	DUF2913 family protein	NA	NA	NA	NA	NA
WP_042648942.1|1787365_1788406_+	peptidase M35	NA	NA	NA	NA	NA
WP_042648941.1|1788448_1788883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012564931.1|1789465_1790413_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
1795770:1795789	attR	GCCAGGATCTCCTCGGCGCG	NA	NA	NA	NA
>prophage 8
NZ_CP038444	Aeromonas media strain T5-8 chromosome, complete genome	4791767	2007289	2056867	4791767	integrase,transposase	Pseudomonas_phage(20.0%)	52	2004731:2004761	2024899:2024929
2004731:2004761	attL	ATTTGGCGGTGAGGGAGGGATTCGAACCCTC	NA	NA	NA	NA
WP_171268907.1|2007289_2008321_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_139039454.1|2008340_2008508_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	56.8	5.6e-07
WP_005346574.1|2008780_2009038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171268908.1|2009938_2010379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171268909.1|2010997_2011990_-	AAA family ATPase	NA	A0A2P1CFH0	Microbacterium_phage	23.8	4.8e-05
WP_171268910.1|2012146_2013856_-	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_109113091.1|2013846_2014545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_059112249.1|2014827_2015964_-|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	31.7	6.1e-20
WP_041211597.1|2017155_2017857_-	DsbA family oxidoreductase	NA	NA	NA	NA	NA
WP_041211542.1|2017951_2019061_-	alkene reductase	NA	NA	NA	NA	NA
WP_050498234.1|2019379_2019736_+	thiol reductase thioredoxin	NA	NA	NA	NA	NA
WP_041211543.1|2019900_2020695_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_081097825.1|2020723_2021059_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_171268911.1|2021154_2021709_+	OsmC family protein	NA	NA	NA	NA	NA
WP_059112251.1|2021809_2022376_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_050498235.1|2023542_2024490_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_041205604.1|2025166_2025784_-	TPM domain-containing protein	NA	NA	NA	NA	NA
2024899:2024929	attR	ATTTGGCGGTGAGGGAGGGATTCGAACCCTC	NA	NA	NA	NA
WP_171268912.1|2025806_2026541_-	TPM domain-containing protein	NA	NA	NA	NA	NA
WP_171268913.1|2026537_2027143_-	LemA family protein	NA	A0A1X9IGG1	Lactococcus_phage	33.7	6.3e-16
WP_171268914.1|2027185_2027929_-	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_171268915.1|2028093_2028636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081805676.1|2028847_2029126_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_171268916.1|2029202_2030102_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_042650278.1|2030272_2030680_+	transcriptional regulator	NA	A0A1C6ZDG7	Pseudomonas_phage	45.7	7.3e-08
WP_171268917.1|2030752_2031460_+	short-chain dehydrogenase	NA	NA	NA	NA	NA
WP_042650284.1|2031546_2032563_+	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_042650276.1|2032630_2033062_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_042650275.1|2033168_2034185_-	response regulator	NA	NA	NA	NA	NA
WP_005327789.1|2034231_2035176_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_041206904.1|2035253_2035955_-	DUF2982 domain-containing protein	NA	NA	NA	NA	NA
WP_171269468.1|2036123_2038064_+	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	33.7	2.2e-17
WP_042650274.1|2038217_2039780_+	AbgT family transporter	NA	NA	NA	NA	NA
WP_042650273.1|2039847_2040573_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_042650272.1|2040732_2041497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042650271.1|2041490_2042045_+	VOC family protein	NA	NA	NA	NA	NA
WP_043133480.1|2042057_2043278_-	MFS transporter	NA	NA	NA	NA	NA
WP_171268918.1|2043371_2044298_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005327814.1|2044369_2044963_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	47.1	1.7e-42
WP_042649706.1|2045225_2045918_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_005327816.1|2046011_2047682_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_005299934.1|2047774_2048059_+	integration host factor subunit beta	NA	A0A0H3UZA0	Geobacillus_virus	38.9	2.6e-12
WP_005327818.1|2048215_2048500_+	DUF1049 domain-containing protein	NA	NA	NA	NA	NA
WP_042649707.1|2048509_2049676_+	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_171268919.1|2049827_2050526_+	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_171269469.1|2050637_2051195_-	rhombosortase	NA	NA	NA	NA	NA
WP_171268920.1|2051181_2051826_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_171268921.1|2051797_2052544_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.1	1.0e-84
WP_171268922.1|2052605_2053277_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A172PZV7	Pseudomonas_phage	29.4	8.3e-17
WP_005327834.1|2053278_2053509_+	DUF3820 family protein	NA	NA	NA	NA	NA
WP_171268923.1|2053505_2054069_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_021141311.1|2054551_2055688_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_021141311.1|2055730_2056867_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP038444	Aeromonas media strain T5-8 chromosome, complete genome	4791767	2062662	2117185	4791767	integrase,transposase	Stx2-converting_phage(25.0%)	34	2086889:2086948	2119066:2119156
WP_052816468.1|2062662_2063646_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_080990079.1|2064346_2065555_+|integrase	site-specific integrase	integrase	A0A2H4JGM5	uncultured_Caudovirales_phage	32.1	2.9e-36
WP_052816466.1|2065692_2066655_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_171268928.1|2067663_2068680_+	AAA family ATPase	NA	A0A2P1CFH0	Microbacterium_phage	23.0	3.8e-05
WP_012564931.1|2073029_2073977_-|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_171268929.1|2074144_2074372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005327996.1|2076106_2077525_+|transposase	IS66-like element ISUnCu16 family transposase	transposase	NA	NA	NA	NA
WP_171268930.1|2078669_2079830_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_158657377.1|2080197_2080989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103261334.1|2081230_2081662_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_103261335.1|2082220_2083243_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171268931.1|2084044_2086219_-	catalase/peroxidase HPI	NA	NA	NA	NA	NA
2086889:2086948	attL	AATAATGGGGTGGCTGATGGGGCTCGAACCCACGACAACCGGAATCACAATCCGGGACTC	NA	NA	NA	NA
WP_021140688.1|2087332_2088643_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_005329233.1|2088642_2088897_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_010674978.1|2089398_2089647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171269470.1|2090139_2091354_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	48.9	6.7e-49
WP_171268932.1|2091419_2091653_-	plasmid stabilization protein	NA	NA	NA	NA	NA
WP_024941318.1|2091731_2093090_-	Fic family protein	NA	NA	NA	NA	NA
WP_021140686.1|2093293_2093746_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_021140685.1|2094077_2094656_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042060619.1|2096065_2096467_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	39.4	4.8e-12
WP_042060615.1|2096463_2096811_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	89.6	1.6e-56
WP_042060621.1|2096841_2098392_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	80.6	5.4e-245
WP_171268933.1|2099469_2102778_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_010674971.1|2103268_2103469_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JGT9	uncultured_Caudovirales_phage	36.9	1.5e-06
WP_021140683.1|2103600_2103810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010674969.1|2103825_2105070_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	29.1	4.9e-39
WP_104453295.1|2105191_2105944_+	HDOD domain-containing protein	NA	NA	NA	NA	NA
WP_010674967.1|2106068_2106350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171268934.1|2106413_2107331_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_171268935.1|2107432_2107579_+	DUF4258 domain-containing protein	NA	NA	NA	NA	NA
WP_171268936.1|2107805_2108973_+|transposase	IS3-like element ISAeme20 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	46.4	5.6e-69
WP_171268937.1|2114640_2115588_-|transposase	IS30-like element ISAs2 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	35.7	1.8e-41
WP_099993964.1|2116168_2117185_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.4	2.2e-186
2119066:2119156	attR	AATAATGGGGTGGCTGATGGGGCTCGAACCCACGACAACCGGAATCACAATCCGGGACTCTACCAACTGAGCTACAGCCACCACTGAAATC	NA	NA	NA	NA
>prophage 10
NZ_CP038444	Aeromonas media strain T5-8 chromosome, complete genome	4791767	2232068	2248013	4791767	transposase	Bacillus_virus(50.0%)	12	NA	NA
WP_010676219.1|2232068_2233166_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_052815568.1|2234103_2234724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171268956.1|2234747_2236406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171268957.1|2236416_2237487_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_021141311.1|2237906_2239043_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_171269472.1|2239011_2240259_+	AAA family ATPase	NA	G3MAX6	Bacillus_virus	46.2	2.1e-42
WP_012564931.1|2240365_2241313_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_171268958.1|2241316_2242900_-|transposase	IS1634-like element ISAs25 family transposase	transposase	NA	NA	NA	NA
WP_171268959.1|2242993_2243161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171268960.1|2243153_2243936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_113978622.1|2246471_2246786_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_099368947.1|2246925_2248013_-|transposase	IS3-like element ISKpn10 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP038444	Aeromonas media strain T5-8 chromosome, complete genome	4791767	2445907	2457031	4791767	tRNA	Hokovirus(16.67%)	8	NA	NA
WP_042648260.1|2445907_2449834_-	transporter substrate-binding domain-containing protein	NA	A0A1V0SGX0	Hokovirus	35.6	4.1e-31
WP_005300715.1|2449888_2450185_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	35.6	3.0e-11
WP_042648227.1|2450188_2452576_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	23.6	2.4e-05
WP_042648226.1|2452588_2453572_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	38.2	5.3e-36
WP_010674800.1|2453896_2454253_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_005315535.1|2454267_2454465_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_041204270.1|2454550_2455099_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	37.2	1.8e-14
WP_042648225.1|2455102_2457031_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	38.0	9.7e-127
>prophage 12
NZ_CP038444	Aeromonas media strain T5-8 chromosome, complete genome	4791767	2888984	2937635	4791767	terminase,bacteriocin,portal	Aeromonas_phage(85.42%)	60	NA	NA
WP_171268996.1|2888984_2890385_-	hypothetical protein	NA	A0A1I9KFD9	Aeromonas_phage	89.5	3.2e-204
WP_043133153.1|2890396_2890657_-|bacteriocin	bacteriocin	bacteriocin	A0A1I9KFI4	Aeromonas_phage	81.0	1.3e-10
WP_171268997.1|2890656_2891037_-	hypothetical protein	NA	A0A1I9KFD7	Aeromonas_phage	86.5	1.7e-51
WP_171268998.1|2891045_2891678_-	hypothetical protein	NA	A0A1I9KFE8	Aeromonas_phage	78.3	2.6e-84
WP_043133149.1|2891686_2892046_-	hypothetical protein	NA	A0A1I9KFI0	Aeromonas_phage	79.1	1.0e-50
WP_171268999.1|2892045_2897430_-	DUF1983 domain-containing protein	NA	A0A1I9KGC4	Aeromonas_phage	42.4	4.0e-45
WP_171269481.1|2897429_2899037_-	hypothetical protein	NA	A0A1I9KFD2	Aeromonas_phage	92.9	1.1e-301
WP_171269000.1|2899461_2901081_-	hypothetical protein	NA	A0A1I9KFH7	Aeromonas_phage	99.3	4.3e-75
WP_171269001.1|2901090_2901768_-	hypothetical protein	NA	A0A1I9KFD0	Aeromonas_phage	96.0	6.7e-123
WP_171269002.1|2901780_2902362_-	hypothetical protein	NA	A0A1I9KFD5	Aeromonas_phage	99.0	5.7e-107
WP_171269003.1|2902363_2902801_-	hypothetical protein	NA	A0A1I9KFH0	Aeromonas_phage	90.3	6.3e-58
WP_171269004.1|2902867_2903257_-	hypothetical protein	NA	A0A1I9KGB3	Aeromonas_phage	95.3	2.2e-62
WP_171269005.1|2903324_2904542_-	DUF4043 family protein	NA	A0A1I9KFC6	Aeromonas_phage	94.6	2.1e-223
WP_171269006.1|2904613_2905540_-	hypothetical protein	NA	A0A1I9KFD1	Aeromonas_phage	89.9	3.7e-148
WP_171269007.1|2905841_2907968_-|portal	portal protein	portal	A0A1I9KFF7	Aeromonas_phage	97.3	0.0e+00
WP_171269008.1|2907967_2909665_-|terminase	terminase	terminase	A0A1I9KFB6	Aeromonas_phage	97.3	0.0e+00
WP_171269009.1|2909724_2910414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171269010.1|2910456_2911326_-|terminase	terminase	terminase	A0A1I9KFG9	Aeromonas_phage	84.5	2.0e-116
WP_171269011.1|2911326_2911512_-	hypothetical protein	NA	A0A1I9KFC1	Aeromonas_phage	63.9	3.1e-14
WP_171269012.1|2911549_2912104_-	DUF2514 domain-containing protein	NA	A0A059VF51	Pseudomonas_phage	41.6	4.2e-14
WP_171269013.1|2912103_2912595_-	lysozyme	NA	A0A0M4S5S0	Caulobacter_phage	33.3	1.0e-08
WP_041215975.1|2912591_2912804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171269014.1|2912933_2913236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171269015.1|2913235_2913430_-	DUF3283 family protein	NA	NA	NA	NA	NA
WP_042880557.1|2913553_2913976_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	50.4	3.4e-32
WP_171269016.1|2913972_2915253_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	57.8	6.0e-133
WP_171269017.1|2916546_2917245_-	hypothetical protein	NA	A0A1I9KFB9	Aeromonas_phage	91.4	1.1e-109
WP_171269018.1|2917241_2917664_-	hypothetical protein	NA	A0A1I9KG18	Aeromonas_phage	84.3	2.3e-65
WP_171269019.1|2917660_2917978_-	hypothetical protein	NA	A0A1I9KFA7	Aeromonas_phage	84.8	8.9e-46
WP_171269020.1|2917974_2918415_-	recombination protein NinB	NA	A0A1I9KFA6	Aeromonas_phage	93.8	3.1e-73
WP_111896631.1|2918411_2918705_-	hypothetical protein	NA	A0A1I9KG94	Aeromonas_phage	96.9	1.6e-49
WP_171269021.1|2918781_2919093_-	hypothetical protein	NA	A0A1I9KFB1	Aeromonas_phage	86.9	8.5e-41
WP_043163247.1|2919085_2920498_-	AAA family ATPase	NA	Q716D2	Shigella_phage	44.2	5.1e-101
WP_171269022.1|2920487_2921324_-	replication protein	NA	A0A088CPU2	Enterobacteria_phage	43.6	9.6e-39
WP_109421920.1|2921325_2921457_-	adenylate cyclase	NA	NA	NA	NA	NA
WP_171269023.1|2921449_2921605_-	hypothetical protein	NA	A0A1I9KFA1	Aeromonas_phage	78.0	1.7e-18
WP_005310218.1|2921658_2921877_-	hypothetical protein	NA	A0A1I9KFG0	Aeromonas_phage	97.2	2.1e-30
WP_171269024.1|2921880_2922270_-	hypothetical protein	NA	A0A1I9KF96	Aeromonas_phage	95.8	1.6e-57
WP_171269025.1|2922311_2923013_-	phage antirepressor KilAC domain-containing protein	NA	A0A1I9KFA9	Aeromonas_phage	97.0	6.2e-124
WP_113736124.1|2923046_2923274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_113736123.1|2923403_2924015_+	LexA family transcriptional regulator	NA	NA	NA	NA	NA
WP_171269026.1|2924661_2924916_+	hypothetical protein	NA	A0A1I9KF98	Aeromonas_phage	83.3	3.7e-26
WP_171269027.1|2925228_2926008_+	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_171269028.1|2926082_2926274_+	hypothetical protein	NA	A0A1I9KG01	Aeromonas_phage	88.7	1.2e-21
WP_171269029.1|2926276_2926642_+	hypothetical protein	NA	A0A1I9KFC9	Aeromonas_phage	76.0	6.9e-42
WP_043129261.1|2926638_2927484_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1I9KFF5	Aeromonas_phage	96.4	1.5e-164
WP_171269030.1|2927480_2928458_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	96.9	4.0e-185
WP_171269031.1|2928506_2929595_+	hypothetical protein	NA	A0A1I9KFA0	Aeromonas_phage	92.1	8.5e-96
WP_171268555.1|2929644_2930862_+	hypothetical protein	NA	A0A1I9KG78	Aeromonas_phage	77.2	8.5e-169
WP_171269032.1|2930858_2930999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171269033.1|2930998_2931601_+	hypothetical protein	NA	H9C0R1	Aeromonas_phage	56.3	8.1e-64
WP_043129267.1|2931659_2931839_+	hypothetical protein	NA	A0A1I9KFZ1	Aeromonas_phage	88.1	4.6e-23
WP_171269034.1|2931859_2932771_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	53.0	1.4e-83
WP_171269035.1|2932767_2933112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171269036.1|2934136_2934355_+	hypothetical protein	NA	A0A1I9KF77	Aeromonas_phage	97.2	1.1e-34
WP_171269037.1|2934399_2934711_+	DUF4406 domain-containing protein	NA	A0A1I9KFD3	Aeromonas_phage	99.0	7.4e-53
WP_171269038.1|2934746_2935034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171269039.1|2935008_2935671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077096152.1|2935807_2936212_+	hypothetical protein	NA	A0A1I9KG69	Aeromonas_phage	78.7	3.4e-50
WP_171269040.1|2936381_2937635_+	DUF3596 domain-containing protein	NA	A0A1I9KF78	Aeromonas_phage	59.7	5.3e-142
>prophage 13
NZ_CP038444	Aeromonas media strain T5-8 chromosome, complete genome	4791767	3301768	3343518	4791767	integrase,transposase	Escherichia_phage(25.0%)	41	3301202:3301216	3304282:3304296
3301202:3301216	attL	TTGCCATGGCAGGAT	NA	NA	NA	NA
WP_010673972.1|3301768_3303007_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E8G8	Vibrio_phage	48.9	2.1e-114
WP_010673971.1|3303069_3303474_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_148248254.1|3303829_3304078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017783811.1|3304155_3305172_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	6.4e-186
3304282:3304296	attR	ATCCTGCCATGGCAA	NA	NA	NA	NA
WP_010674210.1|3305255_3306869_-|transposase	IS1634-like element ISAs25 family transposase	transposase	NA	NA	NA	NA
WP_171269232.1|3307714_3308731_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	6.4e-186
WP_171269233.1|3309059_3310013_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	41.9	2.4e-54
WP_171269234.1|3310109_3311111_+	YqaJ viral recombinase family protein	NA	A0A2H4JA52	uncultured_Caudovirales_phage	38.2	4.8e-45
WP_171269235.1|3311107_3312046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041212673.1|3312047_3312395_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042048597.1|3312582_3313134_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_171269236.1|3313686_3314049_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171269498.1|3314259_3314784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171269237.1|3314868_3315429_+	lecithin retinol acyltransferase family protein	NA	NA	NA	NA	NA
WP_099992304.1|3315467_3315893_+	DUF2787 domain-containing protein	NA	NA	NA	NA	NA
WP_171269238.1|3315902_3316331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171269239.1|3316305_3316614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021137991.1|3316704_3317202_+	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_021137992.1|3317198_3317390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099994739.1|3317504_3317753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021137994.1|3317920_3318430_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021137995.1|3318426_3318642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171269240.1|3318638_3319001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171269241.1|3319081_3319624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042044633.1|3319625_3319973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042044634.1|3320202_3320925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171269242.1|3321002_3321494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042044636.1|3321595_3322753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171269243.1|3322818_3324297_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042044637.1|3324315_3327384_+	virulence factor SrfB	NA	NA	NA	NA	NA
WP_171269244.1|3327380_3330068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171269245.1|3330073_3331207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156991620.1|3331305_3333177_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_042044643.1|3333176_3333887_+	ABC transporter ATP-binding protein	NA	A0A1M7XV31	Cedratvirus	25.3	4.5e-05
WP_171269499.1|3333912_3335088_+	FtsX-like permease family protein	NA	NA	NA	NA	NA
WP_084214672.1|3335113_3336622_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	NA	NA	NA	NA
WP_021141311.1|3337980_3339117_+|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_042044646.1|3340634_3340931_+	NINE protein	NA	M4ZS56	Bacillus_phage	68.2	1.4e-16
WP_103857964.1|3341188_3341491_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_041205730.1|3341490_3341856_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_103857963.1|3341904_3343518_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	31.0	1.3e-39
>prophage 14
NZ_CP038444	Aeromonas media strain T5-8 chromosome, complete genome	4791767	4101037	4134984	4791767	tRNA,integrase,transposase	Staphylococcus_prophage(16.67%)	30	4113769:4113782	4140454:4140467
WP_012564931.1|4101037_4101985_+|transposase	IS30-like element ISAeca1 family transposase	transposase	Q9MBM9	Staphylococcus_prophage	36.9	1.0e-44
WP_171269504.1|4101981_4102203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042648823.1|4102567_4103503_-	4-hydroxy-3-methylbut-2-enyl diphosphate reductase	NA	NA	NA	NA	NA
WP_042648824.1|4103502_4103955_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_042648825.1|4103951_4104455_-	signal peptidase II	NA	NA	NA	NA	NA
WP_042648826.1|4104454_4107316_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L9X8	Tupanvirus	26.4	1.7e-79
WP_042648827.1|4107315_4108290_-	bifunctional riboflavin kinase/FAD synthetase	NA	A0A1V0SD03	Indivirus	26.4	8.1e-05
WP_042648828.1|4108410_4109973_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_005308808.1|4110164_4110428_+	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_005332359.1|4110477_4110780_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_005332358.1|4110829_4111762_-	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_171269505.1|4111748_4112129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042648830.1|4112149_4113340_-	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	51.1	5.9e-90
4113769:4113782	attL	GCGCCGTCTGCTCC	NA	NA	NA	NA
WP_042648831.1|4115084_4115657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005895552.1|4115775_4115982_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_021141311.1|4117457_4118594_-|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_004576012.1|4119087_4120506_-|transposase	IS66-like element ISAs21 family transposase	transposase	NA	NA	NA	NA
WP_005303890.1|4120897_4121308_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_082030024.1|4121659_4121959_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042649219.1|4122067_4122271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171269506.1|4122382_4122835_+	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_042865961.1|4123310_4123691_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_042649073.1|4123809_4125435_-	MCR-3-related phosphoethanolamine--lipid A transferase	NA	NA	NA	NA	NA
WP_042649074.1|4125501_4127124_-	phosphoethanolamine--lipid A transferase MCR-3.6	NA	NA	NA	NA	NA
WP_033113892.1|4127329_4127764_-	EamA family transporter	NA	NA	NA	NA	NA
WP_099369027.1|4127911_4128928_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	4.9e-186
WP_042650619.1|4129347_4130181_-	thymidylate synthase	NA	E5DV96	Deep-sea_thermophilic_phage	61.0	3.2e-95
WP_021141269.1|4130177_4130660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021141270.1|4130656_4132672_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_171269299.1|4132668_4134984_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
4140454:4140467	attR	GCGCCGTCTGCTCC	NA	NA	NA	NA
>prophage 15
NZ_CP038444	Aeromonas media strain T5-8 chromosome, complete genome	4791767	4625178	4692837	4791767	tRNA,transposase,holin	Escherichia_phage(12.5%)	53	NA	NA
WP_171269406.1|4625178_4626195_-|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	98.8	1.9e-185
WP_171269407.1|4626439_4626766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163150025.1|4626904_4628776_+	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_082030096.1|4628787_4629645_+	copper resistance protein B	NA	NA	NA	NA	NA
WP_042649739.1|4629665_4630199_+	cupredoxin family protein	NA	NA	NA	NA	NA
WP_171269408.1|4631064_4632108_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_171269409.1|4634654_4636010_-	heavy metal sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	25.9	2.2e-08
WP_021140716.1|4635999_4636686_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.5	1.8e-30
WP_021140715.1|4636877_4637201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171269514.1|4637409_4638954_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_171269410.1|4638950_4642091_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_171269515.1|4642186_4643479_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_042648953.1|4644163_4644571_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_171269411.1|4644632_4644893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171269516.1|4644969_4646097_-	Fic family protein	NA	D7RWK9	Brochothrix_phage	28.8	3.2e-05
WP_005895552.1|4646498_4646705_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_163150055.1|4646823_4647432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021141311.1|4648380_4649517_-|transposase	ISAs1-like element ISAs12 family transposase	transposase	NA	NA	NA	NA
WP_171269412.1|4650357_4650822_+	dUTP diphosphatase	NA	G0YQD9	Erwinia_phage	50.0	9.1e-31
WP_005323760.1|4651206_4651803_+	nucleoid occlusion factor SlmA	NA	NA	NA	NA	NA
WP_005323762.1|4651976_4652813_+	mechanosensitive ion channel	NA	NA	NA	NA	NA
WP_005323764.1|4652943_4653132_-|holin	holin	holin	NA	NA	NA	NA
WP_171269413.1|4653550_4655200_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_005323768.1|4655351_4656833_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_005323770.1|4657056_4657950_+	HTH-type transcriptional activator IlvY	NA	NA	NA	NA	NA
WP_005323772.1|4658052_4658244_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171269414.1|4658335_4660909_+	bifunctional acetate--CoA ligase family protein/GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_171269415.1|4666621_4667146_-	menaquinone-dependent protoporphyrinogen IX dehydrogenase	NA	NA	NA	NA	NA
WP_005323940.1|4667153_4668611_-	potassium transporter	NA	NA	NA	NA	NA
WP_005323938.1|4668647_4669265_-	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	35.9	5.5e-23
WP_005323936.1|4669264_4670587_-	Xaa-Pro dipeptidase	NA	NA	NA	NA	NA
WP_005323934.1|4670783_4672721_+	acetoacetate--CoA ligase	NA	NA	NA	NA	NA
WP_171269416.1|4672925_4675073_+	fatty acid oxidation complex subunit alpha FadB	NA	NA	NA	NA	NA
WP_041206712.1|4675094_4676258_+	acetyl-CoA C-acyltransferase FadA	NA	NA	NA	NA	NA
WP_005323928.1|4676541_4677264_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_042649914.1|4677334_4678780_+	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_171269417.1|4678785_4680042_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_005323922.1|4680087_4680279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041206709.1|4680450_4680696_+	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	72.2	2.8e-07
WP_005323918.1|4680717_4681062_+	RidA family protein	NA	NA	NA	NA	NA
WP_005323916.1|4681207_4681864_-	OmpA family lipoprotein	NA	NA	NA	NA	NA
WP_005323913.1|4682029_4682272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005323912.1|4682392_4682647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139751735.1|4683046_4683262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171269418.1|4683620_4684190_-	DNA-3-methyladenine glycosylase I	NA	NA	NA	NA	NA
WP_171269419.1|4684378_4685302_+|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_171269420.1|4685311_4687381_+|tRNA	glycine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_171269421.1|4687519_4687966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152952594.1|4687962_4688406_+	hypothetical protein	NA	A0A1W6JT96	Pseudomonas_phage	32.6	7.7e-11
WP_171269422.1|4689077_4690028_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_171269423.1|4690371_4690938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171268556.1|4691169_4691322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171269424.1|4691613_4692837_-|transposase	transposase	transposase	NA	NA	NA	NA
