The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053228	Blautia producta strain SCSK chromosome, complete genome	5498201	289029	331675	5498201	tail,portal,tRNA,protease,terminase,integrase,capsid	uncultured_Caudovirales_phage(16.67%)	46	281382:281399	322554:322571
281382:281399	attL	CCAGGTAGTAAATCTGAT	NA	NA	NA	NA
WP_065542694.1|289029_290436_+|tRNA	cysteine--tRNA ligase	tRNA	A0A0U2SJ70	Niemeyer_virus	30.4	2.0e-44
WP_065542693.1|290420_290870_+	ribonuclease III	NA	NA	NA	NA	NA
WP_065542692.1|290844_291594_+	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_065542691.1|291597_292182_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_171285137.1|292428_294150_+	histidine kinase	NA	NA	NA	NA	NA
WP_171285138.1|294142_295573_+	response regulator	NA	NA	NA	NA	NA
WP_065542688.1|295803_297417_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_065542687.1|297531_298455_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_171285139.1|298472_299390_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_065542685.1|299411_301406_+	family 31 glucosidase	NA	NA	NA	NA	NA
WP_171285140.1|301770_303084_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_065542683.1|303132_304107_+	D-2-hydroxyacid dehydrogenase	NA	M1HTA3	Paramecium_bursaria_Chlorella_virus	23.9	4.2e-09
WP_171285141.1|304610_305957_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_171285142.1|306153_306759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285143.1|306809_307241_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1C8E988	Bacillus_phage	30.4	9.1e-09
WP_171285144.1|307250_307832_-	helix-turn-helix domain-containing protein	NA	A0A0B5CYL9	Listeria_phage	26.3	2.2e-10
WP_171285145.1|307984_308206_+	helix-turn-helix transcriptional regulator	NA	A0A059T7X5	Listeria_phage	45.2	5.3e-05
WP_171287228.1|308459_309068_+	phage antirepressor KilAC domain-containing protein	NA	A0A2I7SC24	Paenibacillus_phage	63.6	1.1e-31
WP_171285146.1|309081_310005_+	ORF6N domain-containing protein	NA	A0A2H4J8K8	uncultured_Caudovirales_phage	52.8	3.3e-48
WP_171285147.1|310135_310486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285148.1|310482_311334_+	hypothetical protein	NA	A0A2H4J8K8	uncultured_Caudovirales_phage	53.1	7.8e-28
WP_171285149.1|311352_312480_+	hypothetical protein	NA	A0A288WG62	Bacillus_phage	37.8	1.1e-16
WP_171285150.1|312483_312714_+	excisionase family DNA-binding protein	NA	NA	NA	NA	NA
WP_171285151.1|312904_313453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285152.1|313667_313820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285153.1|313812_314178_+	hypothetical protein	NA	A0A1W6JQD5	Staphylococcus_phage	42.3	4.4e-20
WP_171285154.1|314202_316710_+	bifunctional DNA primase/polymerase	NA	A0A068F3J2	Mycobacterium_phage	32.8	1.2e-12
WP_171285155.1|317048_317300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285156.1|317289_317709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285157.1|318339_318621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285158.1|318621_318945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_148393993.1|319071_319431_+	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	40.3	2.3e-13
WP_171287229.1|319423_321106_+|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	65.3	7.2e-219
WP_171285159.1|321171_321369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285160.1|321414_322671_+|portal	phage portal protein	portal	A0A1L2BY94	Clostridium_phage	64.1	1.0e-140
322554:322571	attR	CCAGGTAGTAAATCTGAT	NA	NA	NA	NA
WP_171285161.1|322663_323350_+|protease	Clp protease ClpP	protease	R9TLM7	Paenibacillus_phage	41.5	1.4e-40
WP_171285162.1|323328_324600_+|capsid	phage major capsid protein	capsid	A0A1L2BY91	Clostridium_phage	52.2	9.3e-94
WP_171285163.1|324611_324752_+	Rho termination factor N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_171285164.1|324744_325050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285165.1|325024_325333_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285166.1|325337_325742_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_171285167.1|325738_326080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285168.1|326084_326633_+|tail	major tail protein	tail	A0A2H4JGI1	uncultured_Caudovirales_phage	31.4	1.7e-07
WP_171285169.1|326660_327104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285170.1|327320_327503_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285171.1|327568_331675_+|tail	phage tail tape measure protein	tail	A0A1D3SNL5	Enterococcus_phage	33.0	3.9e-40
>prophage 2
NZ_CP053228	Blautia producta strain SCSK chromosome, complete genome	5498201	1284468	1371648	5498201	tail,portal,holin,tRNA,protease,terminase,transposase,capsid	Clostridium_phage(10.71%)	94	NA	NA
WP_171285519.1|1284468_1284771_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_084043482.1|1284749_1285316_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065541922.1|1285275_1286130_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_157766917.1|1287074_1287407_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171285520.1|1288359_1288806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285521.1|1289169_1289976_+	recombinase zinc beta ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_171285522.1|1289968_1291651_+	recombinase family protein	NA	M9Q2G2	Clostridium_phage	24.0	1.1e-14
WP_171285523.1|1291640_1291952_+	recombinase family protein	NA	NA	NA	NA	NA
WP_171285524.1|1291876_1292683_+	recombinase zinc beta ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_171285525.1|1292760_1293252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084043480.1|1293273_1294023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065541917.1|1294027_1294582_+	DUF4314 domain-containing protein	NA	NA	NA	NA	NA
WP_171285526.1|1295033_1296413_-	recombinase family protein	NA	B6SBW6	Clostridium_virus	35.2	6.2e-67
WP_171285527.1|1296586_1297090_-	SHOCT domain-containing protein	NA	A0A1S5S992	Streptococcus_phage	36.6	1.0e-11
WP_171285528.1|1297161_1297524_-	helix-turn-helix transcriptional regulator	NA	A0A2K9V426	Faecalibacterium_phage	41.3	3.9e-13
WP_171285529.1|1297680_1297920_+	hypothetical protein	NA	A0A2K9V3Z0	Faecalibacterium_phage	48.5	3.9e-09
WP_171285530.1|1298012_1298282_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285531.1|1298554_1298770_+	aspartate ammonia-lyase	NA	A0A0S2GLC6	Bacillus_phage	40.8	2.3e-05
WP_171285532.1|1298762_1299062_-	lactate permease	NA	NA	NA	NA	NA
WP_171285533.1|1299140_1299413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285534.1|1299658_1299874_+	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_171285535.1|1299890_1300043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285536.1|1300023_1300266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285537.1|1300369_1300561_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285538.1|1300544_1300799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285539.1|1300923_1301181_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285540.1|1301170_1301338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285541.1|1301709_1301931_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285542.1|1301913_1302456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285543.1|1302592_1302736_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285544.1|1302759_1302945_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285545.1|1302941_1303169_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285546.1|1303209_1303386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285547.1|1303378_1303594_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285548.1|1303765_1304479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285549.1|1304480_1304912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285550.1|1305012_1306233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285551.1|1306222_1306573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285552.1|1306569_1307064_+	hypothetical protein	NA	H7BVC3	unidentified_phage	42.4	2.9e-19
WP_171285553.1|1307050_1307224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285554.1|1307347_1307560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285555.1|1307486_1307861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285556.1|1307854_1308070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285557.1|1308056_1308245_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285558.1|1308251_1308524_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285559.1|1308520_1309021_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171285560.1|1309256_1309598_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_171285561.1|1309599_1309896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285562.1|1309892_1310099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285563.1|1310192_1310510_+|terminase	P27 family phage terminase small subunit	terminase	A0A1B1P762	Bacillus_phage	34.3	4.1e-06
WP_171287254.1|1310496_1312185_+|terminase	terminase	terminase	A0A1B1P766	Bacillus_phage	36.5	5.0e-95
WP_171285564.1|1312205_1313405_+|portal	phage portal protein	portal	E2ELI3	Clostridium_phage	37.5	8.6e-65
WP_171285565.1|1313388_1314177_+|protease	Clp protease ClpP	protease	A0A0K2CZ28	Paenibacillus_phage	37.4	1.9e-28
WP_171285566.1|1314189_1315650_+|capsid	phage major capsid protein	capsid	E2ELI5	Clostridium_phage	45.4	6.1e-81
WP_171285567.1|1315654_1315954_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285568.1|1315937_1316363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285569.1|1316349_1316724_+	HK97 gp10 family phage protein	NA	A0A2H4JAN0	uncultured_Caudovirales_phage	39.6	8.2e-14
WP_171285570.1|1316720_1317047_+	hypothetical protein	NA	Q9AZY0	Lactococcus_phage	35.2	1.1e-06
WP_171285571.1|1317050_1317659_+|tail	phage tail protein	tail	Q9AZX9	Lactococcus_phage	42.3	2.6e-33
WP_171285572.1|1317688_1318078_+	hypothetical protein	NA	A0A2H4JAG8	uncultured_Caudovirales_phage	33.9	3.7e-09
WP_171285573.1|1318254_1321701_+|tail	phage tail tape measure protein	tail	A0A1G5SB90	Enterococcus_phage	35.1	8.2e-60
WP_171285574.1|1321700_1322453_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_171285575.1|1322453_1325573_+|tail	phage tail protein	tail	H7BV46	unidentified_phage	37.9	6.1e-155
WP_171285576.1|1325588_1325930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285577.1|1325898_1326096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285578.1|1326099_1328406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285579.1|1328474_1328831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285027.1|1328823_1329012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171287255.1|1329102_1329507_+|holin	phage holin family protein	holin	F0PIJ6	Enterococcus_phage	56.0	5.3e-35
WP_171285580.1|1329561_1330593_+	peptidoglycan-binding protein	NA	A0A2K9V3I9	Faecalibacterium_phage	32.5	1.8e-18
WP_171285581.1|1330657_1331311_+	Rha family transcriptional regulator	NA	A0A2K5B268	Erysipelothrix_phage	37.4	7.1e-21
WP_171285582.1|1331681_1331909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285583.1|1332383_1334978_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_065541914.1|1335068_1336283_-	FprA family A-type flavoprotein	NA	NA	NA	NA	NA
WP_065541913.1|1336812_1337460_+	chloramphenicol acetyltransferase	NA	G3CFL0	Escherichia_phage	30.1	2.0e-20
WP_065541911.1|1338062_1338626_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_171285584.1|1338698_1340348_+	FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	37.9	6.3e-50
WP_171285585.1|1340499_1342251_+	GGDEF and EAL domain-containing protein	NA	NA	NA	NA	NA
WP_171285586.1|1342333_1343611_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_171285587.1|1343607_1346952_+	response regulator	NA	A0A1V0SGX0	Hokovirus	25.7	1.5e-42
WP_065541906.1|1347375_1350546_+	response regulator	NA	A0A1V0SGX0	Hokovirus	29.5	4.3e-47
WP_171285588.1|1350577_1351987_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_065541904.1|1352047_1353010_-	FAD binding domain-containing protein	NA	NA	NA	NA	NA
WP_065541903.1|1353021_1355268_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_065541902.1|1355254_1355746_-	(2Fe-2S)-binding protein	NA	A0A0P0IVM8	Acinetobacter_phage	39.5	9.4e-18
WP_171285589.1|1355923_1358110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285590.1|1358186_1359716_+	aromatic amino acid lyase	NA	NA	NA	NA	NA
WP_171285591.1|1359759_1361529_-	oleate hydratase	NA	NA	NA	NA	NA
WP_171285592.1|1361668_1362235_-	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_065541897.1|1362260_1363532_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_171285593.1|1363541_1364639_-	prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_065541895.1|1364974_1367065_+	elongation factor G	NA	A0A2K9L6L3	Tupanvirus	22.2	1.2e-10
WP_065541894.1|1367205_1368798_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171285594.1|1369233_1371648_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	52.8	3.3e-241
>prophage 3
NZ_CP053228	Blautia producta strain SCSK chromosome, complete genome	5498201	2044264	2082491	5498201	tail,portal,holin,terminase,integrase,head,coat	Clostridium_phage(40.0%)	49	2042039:2042066	2082509:2082536
2042039:2042066	attL	TGGAGCATACGGGATTCGAACCCGTGAC	NA	NA	NA	NA
WP_171285175.1|2044264_2044567_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_065544571.1|2044579_2044840_-	hypothetical protein	NA	A0A0S2MYE7	Enterococcus_phage	62.8	6.9e-28
WP_084043381.1|2044845_2045079_-	hypothetical protein	NA	A0A2K9V3F1	Faecalibacterium_phage	45.8	2.7e-07
WP_171285024.1|2045148_2045388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285174.1|2045401_2047861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285173.1|2047832_2048132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285831.1|2048190_2051541_-|tail	phage tail protein	tail	H7BV46	unidentified_phage	30.0	3.1e-80
WP_171285832.1|2051554_2052274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285833.1|2052455_2052845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285834.1|2052892_2057662_-|tail	phage tail tape measure protein	tail	A0A0U4IIN6	Exiguobacterium_phage	34.2	1.3e-39
WP_171285835.1|2057793_2058249_-	esterase	NA	D9ZNE4	Clostridium_phage	43.2	4.6e-19
WP_171285836.1|2058258_2058828_-	hypothetical protein	NA	A0A0A8WJ49	Clostridium_phage	30.2	3.2e-17
WP_171285837.1|2058841_2059195_-	hypothetical protein	NA	A0A0A8WEH0	Clostridium_phage	33.0	2.7e-11
WP_171285838.1|2059191_2059533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285839.1|2059532_2059880_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_171285840.1|2059884_2060139_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285841.1|2060152_2061160_-|coat	coat protein	coat	D2J006	Enterococcus_phage	38.5	5.7e-54
WP_171285842.1|2061174_2061762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285843.1|2062319_2062502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285844.1|2062504_2064076_-	hypothetical protein	NA	A0A0A7RU06	Clostridium_phage	39.8	1.0e-65
WP_171285845.1|2064076_2065543_-|portal	phage portal protein	portal	A0A0A8WIB1	Clostridium_phage	38.3	2.7e-84
WP_171287272.1|2065544_2066696_-|terminase	PBSX family phage terminase large subunit	terminase	A0A0H3U2R6	Staphylococcus_phage	52.8	2.9e-118
WP_171285846.1|2066746_2067208_-	helix-turn-helix domain-containing protein	NA	A0A090DCM3	Clostridium_phage	64.4	5.1e-42
WP_171285847.1|2067743_2068172_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_171285848.1|2068178_2068391_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285849.1|2068451_2068715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285850.1|2068844_2069054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285851.1|2069203_2070031_-	DNA adenine methylase	NA	A0A2H4JFS7	uncultured_Caudovirales_phage	77.5	2.5e-111
WP_171285852.1|2070027_2071065_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A193GZ89	Enterobacter_phage	39.2	3.7e-56
WP_171285853.1|2071240_2071903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285854.1|2071886_2072768_-	DUF4373 domain-containing protein	NA	A0A0P0HRQ2	Lactobacillus_phage	32.2	3.4e-18
WP_171285855.1|2072776_2073214_-	RusA family crossover junction endodeoxyribonuclease	NA	J9QE82	Clostridium_phage	38.6	1.8e-20
WP_171285856.1|2073264_2073999_-	hypothetical protein	NA	A0A2K9V2V2	Faecalibacterium_phage	50.8	4.0e-65
WP_171285857.1|2074017_2074482_-	hypothetical protein	NA	A0A2K9V2X8	Faecalibacterium_phage	39.5	1.1e-15
WP_171285858.1|2074563_2075538_-	recombinase RecT	NA	A0A0A7RW37	Clostridium_phage	34.4	2.1e-37
WP_171285859.1|2075540_2076407_-	DUF1351 domain-containing protein	NA	NA	NA	NA	NA
WP_171285860.1|2076419_2077079_-	YqaJ viral recombinase family protein	NA	A0A0P0IJW5	Lactobacillus_phage	35.6	3.0e-19
WP_018596801.1|2077075_2077270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285861.1|2077318_2077507_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285862.1|2077527_2077836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285863.1|2077832_2077982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285864.1|2077995_2078235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285865.1|2078414_2078624_+	hypothetical protein	NA	A0A1B0Y3M6	Lactobacillus_phage	66.2	2.7e-19
WP_171285866.1|2078744_2078990_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_171285867.1|2079062_2079281_-	XRE family transcriptional regulator	NA	Q8SBM9	Clostridium_phage	50.0	1.1e-10
WP_171285868.1|2079454_2079805_+	helix-turn-helix transcriptional regulator	NA	Q8SBN0	Clostridium_phage	57.0	2.1e-19
WP_171285869.1|2080068_2080266_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_171285870.1|2080344_2081187_+	hypothetical protein	NA	A0A0U4JX08	Bacillus_phage	53.6	5.7e-31
WP_171285871.1|2081405_2082491_+|integrase	site-specific integrase	integrase	A0A2H4J8J9	uncultured_Caudovirales_phage	46.7	9.8e-84
2082509:2082536	attR	TGGAGCATACGGGATTCGAACCCGTGAC	NA	NA	NA	NA
>prophage 4
NZ_CP053228	Blautia producta strain SCSK chromosome, complete genome	5498201	2488579	2549938	5498201	tail,portal,holin,tRNA,protease,terminase,head,capsid	Erysipelothrix_phage(33.33%)	60	NA	NA
WP_065540972.1|2488579_2489515_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
WP_065540971.1|2489511_2489991_-	peptide deformylase	NA	E3SLL2	Synechococcus_phage	39.8	1.0e-16
WP_171286009.1|2492260_2493724_-	UDP-N-acetylmuramoyl-L-alanyl-D-glutamate--2, 6-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_065540968.1|2494253_2495183_-	carbamate kinase	NA	NA	NA	NA	NA
WP_089280590.1|2495463_2495931_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_065540967.1|2495927_2496713_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_065540966.1|2496767_2498309_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171286010.1|2498515_2500495_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_065540964.1|2500605_2501478_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_065540963.1|2501696_2504894_-	carbamoyl-phosphate synthase large subunit	NA	NA	NA	NA	NA
WP_065540962.1|2504893_2505967_-	carbamoyl phosphate synthase small subunit	NA	R4TGJ8	Halovirus	35.6	3.4e-52
WP_171286011.1|2506695_2508318_-	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	47.2	6.3e-127
WP_171286012.1|2508296_2509649_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	39.5	5.5e-68
WP_171286013.1|2509710_2509914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286014.1|2509864_2510263_-	sigma-70 region 4 domain-containing protein	NA	D0R0C4	Streptococcus_phage	45.2	7.6e-26
WP_171286015.1|2510312_2511923_-	N-acetylmuramoyl-L-alanine amidase	NA	H7BVK7	unidentified_phage	38.3	7.7e-61
WP_171286016.1|2511965_2512373_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	58.5	4.1e-35
WP_171286017.1|2512577_2512958_+	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_171286018.1|2513016_2514414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286019.1|2514430_2516248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286020.1|2516263_2516626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286021.1|2516628_2519529_-|tail	phage tail tape measure protein	tail	H9A124	Staphylococcus_phage	39.3	1.6e-85
WP_171286022.1|2519714_2519984_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_171286023.1|2519976_2520246_+	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_171286024.1|2520426_2521314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286025.1|2521579_2521744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286026.1|2521740_2522118_-	hypothetical protein	NA	A0A290GJX3	Caldibacillus_phage	35.6	3.2e-10
WP_171286027.1|2522130_2522808_-|tail	phage tail protein	tail	A0A0U4JWV5	Exiguobacterium_phage	48.4	2.6e-42
WP_171286028.1|2522852_2523197_-	hypothetical protein	NA	E4ZFM8	Streptococcus_phage	44.1	1.7e-21
WP_171286029.1|2523202_2523583_-	HK97 gp10 family phage protein	NA	Q9AZY1	Lactococcus_phage	34.1	6.6e-11
WP_171286030.1|2523585_2523918_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_171286031.1|2523917_2524196_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0RXK2	Streptococcus_phage	50.0	8.4e-16
WP_171286032.1|2524257_2525460_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	72.6	4.1e-168
WP_171287285.1|2525471_2526161_-|protease	Clp protease ClpP	protease	A0A2K5B288	Erysipelothrix_phage	66.7	4.6e-71
WP_171286033.1|2526153_2527449_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	73.1	5.4e-182
WP_171286034.1|2527445_2529047_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	76.5	1.2e-244
WP_171286035.1|2529171_2529354_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286036.1|2529350_2529590_-	DUF4314 domain-containing protein	NA	NA	NA	NA	NA
WP_171286037.1|2529562_2529991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286038.1|2530085_2530457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286039.1|2530583_2531879_-	ParB N-terminal domain-containing protein	NA	A0A2I4R670	Erysipelothrix_phage	34.4	8.4e-58
WP_171286040.1|2531859_2532270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286041.1|2532337_2533249_-	phosphoadenosine phosphosulfate reductase family protein	NA	F8UBB2	Clostridium_phage	44.0	6.7e-70
WP_171286042.1|2533359_2534106_-	hypothetical protein	NA	A0A0A0YWF4	Pseudomonas_phage	33.9	1.3e-23
WP_171286043.1|2534062_2534851_-	hypothetical protein	NA	A0A0A0YWF4	Pseudomonas_phage	37.7	1.5e-25
WP_171286044.1|2534823_2535411_-	ParB N-terminal domain-containing protein	NA	Q938L7	Temperate_phage	58.1	2.7e-35
WP_171286045.1|2535439_2535982_-|terminase	P27 family phage terminase small subunit	terminase	A0A2K5B277	Erysipelothrix_phage	64.4	3.9e-65
WP_171286046.1|2536079_2536469_-	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	67.2	1.4e-45
WP_171286047.1|2536676_2537483_+	UPF0489 family protein	NA	NA	NA	NA	NA
WP_171286048.1|2537538_2537958_-	hypothetical protein	NA	A0A2K5B275	Erysipelothrix_phage	35.3	2.7e-13
WP_171286049.1|2537954_2538242_-	VRR-NUC domain-containing protein	NA	I3VYX6	Thermoanaerobacterium_phage	59.5	4.8e-22
WP_171286050.1|2538403_2540914_-	DNA primase	NA	A7J282	Streptococcus_phage	29.1	6.2e-41
WP_171286051.1|2540910_2541336_-	DUF4406 domain-containing protein	NA	A0A2K5B270	Erysipelothrix_phage	54.6	4.0e-41
WP_171287286.1|2541332_2543264_-	bifunctional 3'-5' exonuclease/DNA polymerase	NA	H8YJC3	Vibrio_phage	28.3	2.2e-41
WP_171286052.1|2543330_2544080_-	hypothetical protein	NA	I3VYY1	Thermoanaerobacterium_phage	43.9	2.4e-49
WP_171286053.1|2544100_2544517_-	hypothetical protein	NA	I3VYY4	Thermoanaerobacterium_phage	64.6	9.7e-24
WP_171287287.1|2544526_2545978_-	DEAD/DEAH box helicase	NA	I3VYY6	Thermoanaerobacterium_phage	46.9	1.7e-112
WP_171286054.1|2546000_2546204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286055.1|2546281_2546764_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_171286056.1|2547406_2549938_+	SAM-dependent DNA methyltransferase	NA	A0A1V0SLK8	Klosneuvirus	23.4	1.9e-13
>prophage 5
NZ_CP053228	Blautia producta strain SCSK chromosome, complete genome	5498201	3200537	3238839	5498201	holin,terminase,transposase,integrase,capsid	Clostridium_phage(39.13%)	55	3201065:3201111	3242034:3242080
WP_171286273.1|3200537_3200801_+|transposase	transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	57.5	2.7e-19
3201065:3201111	attL	AGTGAAGCATCGGGGATTCGAACCCCGGACAACTTGATTAAAAGTCA	NA	NA	NA	NA
WP_171286274.1|3201563_3201791_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171286275.1|3202084_3203134_-	peptidoglycan-binding protein	NA	A0A2K5B2A3	Erysipelothrix_phage	36.2	8.1e-27
WP_033143733.1|3203186_3203489_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_171286276.1|3203491_3203749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286277.1|3203763_3204744_-	collagen-like protein	NA	NA	NA	NA	NA
WP_171286278.1|3204759_3205398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286279.1|3205553_3205955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286280.1|3206358_3206811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286281.1|3206856_3207855_-|integrase	tyrosine-type recombinase/integrase	integrase	W8EHC2	Mycobacterium_phage	25.5	1.2e-08
WP_171287300.1|3207947_3208178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171287301.1|3208184_3208412_-	hypothetical protein	NA	A0A249XNP1	Brevibacterium_phage	47.5	2.2e-06
WP_171286282.1|3209643_3210651_-	C40 family peptidase	NA	Q9FZW2	Bacillus_phage	43.1	1.4e-39
WP_171286283.1|3210666_3212649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148391757.1|3212653_3213010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286284.1|3213010_3215728_-	hypothetical protein	NA	A0A2H4J4V9	uncultured_Caudovirales_phage	46.1	8.1e-95
WP_171286285.1|3215728_3216052_-	hypothetical protein	NA	M9Q2I4	Clostridium_phage	45.9	3.1e-17
WP_171286286.1|3216068_3216365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286287.1|3216364_3216811_-	hypothetical protein	NA	M9Q1I1	Clostridium_phage	45.1	9.1e-28
WP_171286288.1|3216819_3217212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171287302.1|3217214_3217595_-	hypothetical protein	NA	M9Q249	Clostridium_phage	39.4	3.7e-14
WP_171286289.1|3217594_3217930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286290.1|3217935_3218319_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286291.1|3218320_3218596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286292.1|3218605_3219490_-|capsid	capsid protein	capsid	M9Q2F4	Clostridium_phage	63.8	8.5e-102
WP_171287303.1|3219509_3220133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286293.1|3220412_3220550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286294.1|3220597_3222280_-|capsid	minor capsid protein	capsid	M9Q2F2	Clostridium_phage	39.5	1.9e-65
WP_171286295.1|3222375_3223977_-|capsid	capsid protein	capsid	M9Q246	Clostridium_phage	45.3	6.2e-119
WP_171286296.1|3224249_3224450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286297.1|3224446_3225811_-|terminase	terminase	terminase	M9Q2I1	Clostridium_phage	59.5	1.6e-160
WP_171286298.1|3225810_3226251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286299.1|3226360_3226789_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_171285848.1|3226794_3227007_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285849.1|3227067_3227331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286300.1|3227460_3227670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286301.1|3227819_3228647_-	DNA adenine methylase	NA	A0A2H4JFS7	uncultured_Caudovirales_phage	77.1	7.1e-111
WP_171286302.1|3228643_3229681_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A193GZ89	Enterobacter_phage	39.2	2.8e-56
WP_171286303.1|3229856_3230519_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171285854.1|3230502_3231384_-	DUF4373 domain-containing protein	NA	A0A0P0HRQ2	Lactobacillus_phage	32.2	3.4e-18
WP_171285855.1|3231392_3231830_-	RusA family crossover junction endodeoxyribonuclease	NA	J9QE82	Clostridium_phage	38.6	1.8e-20
WP_171285856.1|3231880_3232615_-	hypothetical protein	NA	A0A2K9V2V2	Faecalibacterium_phage	50.8	4.0e-65
WP_171285857.1|3232633_3233098_-	hypothetical protein	NA	A0A2K9V2X8	Faecalibacterium_phage	39.5	1.1e-15
WP_171285858.1|3233179_3234154_-	recombinase RecT	NA	A0A0A7RW37	Clostridium_phage	34.4	2.1e-37
WP_171285859.1|3234156_3235023_-	DUF1351 domain-containing protein	NA	NA	NA	NA	NA
WP_171285860.1|3235035_3235695_-	YqaJ viral recombinase family protein	NA	A0A0P0IJW5	Lactobacillus_phage	35.6	3.0e-19
WP_171286304.1|3235691_3235886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286305.1|3236230_3236401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286306.1|3236390_3236573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_018596799.1|3236572_3236800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286307.1|3236891_3237110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171286308.1|3237278_3237524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_148394066.1|3237538_3237727_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_029468420.1|3237959_3238388_+	helix-turn-helix transcriptional regulator	NA	A8ATJ9	Listeria_phage	30.1	4.1e-09
WP_148394067.1|3238404_3238839_+	ImmA/IrrE family metallo-endopeptidase	NA	A8ATJ8	Listeria_phage	37.8	2.9e-15
3242034:3242080	attR	AGTGAAGCATCGGGGATTCGAACCCCGGACAACTTGATTAAAAGTCA	NA	NA	NA	NA
>prophage 6
NZ_CP053228	Blautia producta strain SCSK chromosome, complete genome	5498201	3953670	3971295	5498201	integrase	Streptococcus_phage(88.24%)	20	3949541:3949555	3959042:3959056
3949541:3949555	attL	TGCCATTGTATCTGC	NA	NA	NA	NA
WP_171286554.1|3953670_3955131_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	24.9	4.9e-14
WP_171286555.1|3955151_3955352_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171286556.1|3955892_3956132_-	helix-turn-helix domain-containing protein	NA	A0A1S5SEX1	Streptococcus_phage	67.1	1.4e-22
WP_171286557.1|3956128_3956548_-	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	55.5	9.1e-38
WP_171286558.1|3957146_3957503_+	helix-turn-helix domain-containing protein	NA	A0A2K5B2A6	Erysipelothrix_phage	74.4	2.3e-42
WP_171287317.1|3957591_3957768_-	conjugal transfer protein	NA	D0R0F6	Streptococcus_phage	63.5	5.9e-15
WP_171286559.1|3957796_3958555_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_171286560.1|3958679_3958952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171286561.1|3959107_3960016_-	conjugal transfer protein	NA	A0A1S5SF22	Streptococcus_phage	68.8	2.8e-108
3959042:3959056	attR	TGCCATTGTATCTGC	NA	NA	NA	NA
WP_171286562.1|3960032_3961037_-	lysozyme family protein	NA	A0A1S5SEZ8	Streptococcus_phage	79.2	4.9e-138
WP_171286563.1|3961033_3963439_-	YtxH domain-containing protein	NA	A0A1S5SF30	Streptococcus_phage	77.6	1.3e-221
WP_171286564.1|3963435_3965889_-	ATP-binding protein	NA	A0A1S5SF64	Streptococcus_phage	87.2	0.0e+00
WP_144364370.1|3965872_3966265_-	conjugal transfer protein	NA	A0A1S5SEX7	Streptococcus_phage	80.0	4.5e-55
WP_171287318.1|3966356_3966845_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	75.2	3.4e-68
WP_171287319.1|3966870_3967365_-	antirestriction protein ArdA	NA	A0A1S5SF25	Streptococcus_phage	38.7	7.5e-23
WP_002570387.1|3967496_3967718_-	hypothetical protein	NA	A0A1S5SEY0	Streptococcus_phage	90.4	1.4e-29
WP_171286565.1|3967769_3968987_-	XRE family transcriptional regulator	NA	A0A1S5SEX3	Streptococcus_phage	78.3	4.0e-187
WP_171286566.1|3969145_3970543_-	DUF87 domain-containing protein	NA	A0A1S5SFB5	Streptococcus_phage	77.7	7.1e-204
WP_171286567.1|3970581_3970959_-	YdcP family protein	NA	A0A1S5SF96	Streptococcus_phage	76.0	3.3e-47
WP_002578441.1|3970980_3971295_-	YdcP family protein	NA	A0A1S5SF38	Streptococcus_phage	91.3	1.7e-49
>prophage 7
NZ_CP053228	Blautia producta strain SCSK chromosome, complete genome	5498201	4002762	4064656	5498201	holin,tRNA,terminase,integrase,capsid	Clostridium_phage(41.67%)	60	4026878:4026924	4068077:4068123
WP_065543896.1|4002762_4004667_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_171286578.1|4004830_4006204_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis GTPase MnmE	tRNA	NA	NA	NA	NA
WP_065543894.1|4006351_4007185_-	protein jag	NA	NA	NA	NA	NA
WP_171286579.1|4007203_4008475_-	YidC/Oxa1 family membrane protein insertase	NA	NA	NA	NA	NA
WP_081960513.1|4008581_4008791_-	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_065543893.1|4008771_4009134_-	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_065543892.1|4009325_4009460_-	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_065543890.1|4011858_4012971_+	DNA polymerase III subunit beta	NA	NA	NA	NA	NA
WP_065543889.1|4013003_4013213_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_065543888.1|4013274_4014354_+	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_065543887.1|4014404_4016333_+	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.6	5.3e-141
WP_065543886.1|4016367_4018872_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	33.7	3.8e-115
WP_065543885.1|4018873_4019461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065543884.1|4019645_4020362_+	1-acyl-sn-glycerol-3-phosphate acyltransferase	NA	NA	NA	NA	NA
4026878:4026924	attL	TGACTTTTAATCAAGTTGTCCGGGGTTCGAATCCCCGATGCTTCACT	NA	NA	NA	NA
WP_171286580.1|4027067_4028171_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_171286581.1|4028654_4029707_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_171287320.1|4029756_4030122_-	ImmA/IrrE family metallo-endopeptidase	NA	A8ATJ8	Listeria_phage	35.0	2.6e-09
WP_171286582.1|4030207_4030636_-	helix-turn-helix transcriptional regulator	NA	A0A2P0ZLA1	Lactobacillus_phage	27.3	5.9e-08
WP_033143150.1|4030864_4031056_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_171286583.1|4031622_4032009_-	DUF2513 domain-containing protein	NA	A0A0P0IV09	Lactobacillus_phage	46.1	1.3e-25
WP_171286584.1|4032099_4032327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171286585.1|4032495_4032648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171286586.1|4032670_4032964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171286587.1|4032960_4033431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171287321.1|4033427_4034618_+	DUF2800 domain-containing protein	NA	H7BVP9	unidentified_phage	42.4	3.3e-77
WP_171286588.1|4034619_4035333_+	DUF2815 family protein	NA	W8CPL2	Croceibacter_phage	47.3	6.3e-31
WP_171286589.1|4035379_4037359_+	DNA polymerase	NA	H7BVQ1	unidentified_phage	55.5	3.0e-208
WP_171286590.1|4037372_4039805_+	virulence-associated protein E	NA	A0A0A7RTG3	Clostridium_phage	46.3	1.2e-214
WP_171286591.1|4040041_4040359_+	VRR-NUC domain-containing protein	NA	A0A2I6PE31	Staphylococcus_phage	40.7	1.4e-14
WP_171287322.1|4040483_4041779_+	DEAD/DEAH box helicase	NA	S5MA26	Brevibacillus_phage	52.2	3.7e-130
WP_171286592.1|4041779_4042034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171286593.1|4042030_4042210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171286594.1|4042215_4042647_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_171286595.1|4042751_4043192_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171286596.1|4043191_4044556_+|terminase	terminase	terminase	M9Q2I1	Clostridium_phage	58.3	1.2e-158
WP_171286597.1|4044552_4044753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171286598.1|4045043_4046642_+|capsid	capsid protein	capsid	M9Q246	Clostridium_phage	45.4	1.1e-120
WP_171286599.1|4046737_4048393_+|capsid	minor capsid protein	capsid	M9Q2F2	Clostridium_phage	37.9	2.1e-61
WP_029468435.1|4048398_4048581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171286600.1|4048847_4049483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171286601.1|4049502_4050393_+|capsid	capsid protein	capsid	M9Q2F4	Clostridium_phage	64.1	2.2e-102
WP_171286602.1|4050394_4050670_+	hypothetical protein	NA	M9Q1H8	Clostridium_phage	50.0	8.4e-08
WP_171286603.1|4050671_4051055_+	hypothetical protein	NA	M9Q2K9	Clostridium_phage	40.2	6.2e-17
WP_171286604.1|4051061_4051397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171287323.1|4051396_4051876_+	hypothetical protein	NA	M9Q249	Clostridium_phage	30.3	2.8e-11
WP_171286605.1|4051878_4052271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171286606.1|4052279_4052729_+	hypothetical protein	NA	M9Q1I1	Clostridium_phage	45.1	9.1e-28
WP_171286607.1|4052725_4053022_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171287324.1|4052996_4053362_+	hypothetical protein	NA	M9Q2I4	Clostridium_phage	44.3	1.7e-19
WP_171286608.1|4053549_4056585_+	hypothetical protein	NA	A0A2H4J4V9	uncultured_Caudovirales_phage	38.5	1.3e-85
WP_029468446.1|4056585_4056942_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171286609.1|4056946_4057180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171286610.1|4057133_4058930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171286611.1|4058945_4059953_+	C40 family peptidase	NA	B7SSN4	Bacillus_phage	52.0	6.2e-40
WP_171286612.1|4061658_4062060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171286613.1|4062213_4062852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171286614.1|4062866_4063847_+	collagen-like protein	NA	NA	NA	NA	NA
WP_171286615.1|4063859_4064087_+	hypothetical protein	NA	A0A2K9V3F1	Faecalibacterium_phage	43.1	2.0e-07
WP_171286616.1|4064092_4064356_+	hypothetical protein	NA	A0A0S2MYE7	Enterococcus_phage	63.2	4.5e-27
WP_171286617.1|4064368_4064656_+|holin	holin	holin	NA	NA	NA	NA
4068077:4068123	attR	TGACTTTTAATCAAGTTGTCCGGGGTTCGAATCCCCGATGCTTCACT	NA	NA	NA	NA
>prophage 8
NZ_CP053228	Blautia producta strain SCSK chromosome, complete genome	5498201	4413164	4421961	5498201		Bacillus_phage(50.0%)	7	NA	NA
WP_171286779.1|4413164_4414337_+	response regulator	NA	A0A2K9L4R0	Tupanvirus	36.2	3.1e-11
WP_171286780.1|4414500_4416153_+	diguanylate cyclase	NA	W8CYM9	Bacillus_phage	37.4	9.2e-09
WP_171286781.1|4416171_4416534_+	Hpt domain-containing protein	NA	NA	NA	NA	NA
WP_171286782.1|4416539_4419098_+	response regulator	NA	A0A1V0SGX0	Hokovirus	29.6	7.5e-50
WP_171286783.1|4419398_4420091_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	27.1	1.1e-19
WP_171286784.1|4420087_4421119_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.8	4.8e-24
WP_171286785.1|4421295_4421961_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.3	2.5e-34
>prophage 9
NZ_CP053228	Blautia producta strain SCSK chromosome, complete genome	5498201	5457497	5468705	5498201		Erysipelothrix_phage(55.56%)	12	NA	NA
WP_171287197.1|5457497_5457857_+	rRNA biogenesis protein rrp5	NA	A0A2K5B2A7	Erysipelothrix_phage	39.5	9.9e-09
WP_171287198.1|5458994_5459564_+	DUF2815 family protein	NA	E4ZFK3	Streptococcus_phage	77.7	1.6e-77
WP_171287199.1|5459580_5459742_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171287365.1|5459803_5461795_+	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	69.7	3.9e-272
WP_171287200.1|5461885_5462647_+	phage antirepressor KilAC domain-containing protein	NA	A0A0C5AFE7	Paenibacillus_phage	49.2	2.5e-57
WP_171287201.1|5462650_5463085_+	DUF4406 domain-containing protein	NA	A0A2K5B270	Erysipelothrix_phage	54.9	4.1e-41
WP_171287202.1|5463081_5464884_+	primase C-terminal domain-containing protein	NA	A0A1X9I6B6	Streptococcus_phage	48.3	1.8e-154
WP_171287203.1|5465015_5465297_+	VRR-NUC domain-containing protein	NA	A0A2K5B272	Erysipelothrix_phage	64.4	3.8e-24
WP_171287204.1|5465740_5466157_+	sigma-70 family RNA polymerase sigma factor	NA	A0A1S5SEW0	Streptococcus_phage	36.5	2.5e-19
WP_115625225.1|5466161_5466401_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171287205.1|5466720_5466864_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_171287206.1|5466926_5468705_+	recombinase family protein	NA	A0A2I4R675	Erysipelothrix_phage	60.8	7.5e-190
