The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053371	Proteus cibarius strain G32 chromosome, complete genome	4006606	50595	114641	4006606	head,plate,tRNA,portal,tail,holin,capsid,lysis,protease,integrase,terminase	Salmonella_phage(31.71%)	74	68081:68129	97699:97747
WP_036933349.1|50595_51099_-|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
WP_159363673.1|51102_52113_-	GDP-mannose 4,6-dehydratase	NA	A0A2K9L4U8	Tupanvirus	32.2	1.4e-39
WP_159363674.1|52139_53306_-	nucleotide sugar dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	57.4	5.0e-118
WP_159363675.1|53366_53768_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_159363676.1|53764_54976_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_171455248.1|54975_56106_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	48.6	8.8e-104
WP_159363677.1|56105_57206_-	NAD-dependent epimerase/dehydratase family protein	NA	NA	NA	NA	NA
WP_159363678.1|57218_58226_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	33.8	2.0e-38
WP_159363679.1|58227_59304_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_159363680.1|59320_60370_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_159363681.1|60353_61430_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_159363682.1|61426_62353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171455249.1|62358_63597_-	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_171455250.1|63571_64756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069366855.1|65130_66522_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	26.7	2.8e-19
WP_023583423.1|66534_67233_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	31.1	1.1e-06
WP_075673003.1|67444_67996_+	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
68081:68129	attL	GACACCATCCCTGTCTTTTGCAGCCCCTCTGGAGAGGGGCTTTTTTTTG	NA	NA	NA	NA
WP_064505896.1|68278_69259_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	62.9	5.7e-115
WP_116672651.1|69325_69619_-	helix-turn-helix transcriptional regulator	NA	Q1JS37	Enterobacteria_phage	59.8	2.5e-26
WP_049220107.1|69748_70021_+	hypothetical protein	NA	Q1JS36	Enterobacteria_phage	56.7	1.6e-22
WP_036908539.1|70022_70211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363685.1|70207_70357_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363686.1|70365_70761_+	DUF5347 family protein	NA	NA	NA	NA	NA
WP_006536692.1|70778_71036_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_109397523.1|71028_71250_+	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	52.1	2.6e-12
WP_159363687.1|71251_72079_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	47.4	1.3e-59
WP_109397520.1|72078_72402_+	DUF5405 family protein	NA	NA	NA	NA	NA
WP_159363688.1|72401_74780_+	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	47.6	7.2e-164
WP_159363689.1|74986_75670_+	hypothetical protein	NA	A0A2H4JGK4	uncultured_Caudovirales_phage	28.1	2.9e-17
WP_159363690.1|75671_75854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363691.1|76771_77800_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	69.3	1.0e-135
WP_134736419.1|77799_79554_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	73.0	4.4e-259
WP_159363692.1|79726_80536_+|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	50.9	7.3e-68
WP_159363693.1|80553_81696_+|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	66.8	1.7e-123
WP_109849549.1|81695_82367_+	hypothetical protein	NA	F1BUQ7	Erwinia_phage	46.2	7.2e-45
WP_109397510.1|82441_82897_+|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	45.9	8.4e-29
WP_109397509.1|82896_83103_+|tail	tail protein X	tail	S4TTA0	Salmonella_phage	54.4	9.0e-15
WP_109397508.1|83122_83437_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_171455251.1|83423_83861_+	M15 family metallopeptidase	NA	A0A193GZ39	Escherichia_phage	56.5	1.0e-39
WP_159363695.1|83857_84361_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_159363696.1|84335_84776_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	47.1	3.5e-32
WP_159363697.1|84762_85398_+	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	35.8	2.0e-28
WP_159363698.1|85463_86090_+|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	60.3	4.5e-57
WP_159363699.1|86086_86425_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	50.0	6.4e-26
WP_159363700.1|86426_87335_+|plate	baseplate J/gp47 family protein	plate	A0A218M4K5	Erwinia_phage	66.6	2.1e-108
WP_159363701.1|87327_87939_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	68.9	1.4e-76
WP_159363702.1|89583_89937_+|tail	tail fiber assembly protein	tail	A0A218M4J2	Erwinia_phage	43.7	2.8e-08
WP_159363703.1|90029_91202_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A1S6KZY7	Salmonella_phage	70.6	1.2e-164
WP_109397496.1|91205_91721_+|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	56.7	8.5e-54
WP_159363704.1|91740_92088_+|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	55.7	1.3e-18
WP_075204427.1|92048_92222_+|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	50.9	1.6e-09
WP_159363705.1|92214_95076_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	42.6	3.9e-124
WP_036907694.1|95075_95540_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	61.4	3.3e-41
WP_159363706.1|95539_96637_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	54.3	1.1e-111
WP_159363707.1|96689_96908_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	68.8	1.1e-18
WP_159363708.1|96954_97158_-	hypothetical protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	6.6e-10
WP_081353461.1|97342_97576_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363709.1|97774_98560_-	glycosyltransferase family 25 protein	NA	A0A1V0SBR2	Catovirus	31.0	1.3e-05
97699:97747	attR	GACACCATCCCTGTCTTTTGCAGCCCCTCTGGAGAGGGGCTTTTTTTTG	NA	NA	NA	NA
WP_159363710.1|98630_99785_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_109419649.1|99998_100754_-	3-oxoacyl-ACP reductase FabG	NA	NA	NA	NA	NA
WP_075673000.1|101287_102265_+	6-phosphofructokinase	NA	NA	NA	NA	NA
WP_159242284.1|102528_103530_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_069366847.1|103635_104406_-	triose-phosphate isomerase	NA	NA	NA	NA	NA
WP_075672998.1|104512_105148_-	DUF1454 family protein	NA	NA	NA	NA	NA
WP_075672997.1|105245_105677_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_075672996.1|105742_106489_-	ferredoxin--NADP(+) reductase	NA	NA	NA	NA	NA
WP_075672995.1|106827_108012_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.7	5.8e-13
WP_075672994.1|108113_109646_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_099659466.1|109688_110504_-	aquaporin	NA	M1HBN0	Acanthocystis_turfacea_Chlorella_virus	29.1	1.7e-16
WP_036933299.1|110798_111041_+	cell division protein ZapB	NA	NA	NA	NA	NA
WP_075672992.1|111135_111639_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_075672991.1|111748_112666_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_075672990.1|112763_114098_-	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	27.3	1.1e-41
WP_006534149.1|114110_114641_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
>prophage 2
NZ_CP053371	Proteus cibarius strain G32 chromosome, complete genome	4006606	1070392	1081232	4006606		Mycobacterium_phage(22.22%)	12	NA	NA
WP_075671546.1|1070392_1071592_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	36.6	2.4e-27
WP_075671548.1|1072215_1073184_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	72.8	7.5e-136
WP_159363844.1|1073208_1075335_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	50.4	1.6e-202
WP_159363845.1|1075340_1075760_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	37.4	1.8e-09
WP_075671554.1|1075771_1075996_-	glutaredoxin family protein	NA	V5UN81	Mycobacterium_phage	45.7	7.8e-12
WP_075671556.1|1076279_1076753_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	A0A167R6J9	Powai_lake_megavirus	35.8	5.0e-16
WP_023581133.1|1076950_1077160_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	4.5e-22
WP_023581134.1|1077297_1077672_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.0	2.5e-23
WP_075671558.1|1077685_1078651_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_075671560.1|1078751_1079396_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_036912266.1|1079556_1079820_-	YbeD family protein	NA	NA	NA	NA	NA
WP_075671562.1|1080020_1081232_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	48.1	2.3e-102
>prophage 3
NZ_CP053371	Proteus cibarius strain G32 chromosome, complete genome	4006606	1117086	1154369	4006606	integrase,head,plate,holin,terminase	Proteus_phage(23.68%)	56	1117003:1117021	1157958:1157976
1117003:1117021	attL	CTTATTGGATTATAGTGGG	NA	NA	NA	NA
WP_159363848.1|1117086_1118088_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	43.4	1.4e-68
WP_159363849.1|1118044_1118290_-	excisionase	NA	NA	NA	NA	NA
WP_159363850.1|1118722_1119268_-	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	60.3	1.1e-56
WP_036935799.1|1119428_1119689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363851.1|1119678_1119948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036970032.1|1120140_1120443_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334496.1|1120481_1120664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363852.1|1120731_1121145_-	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	67.4	8.9e-46
WP_159363853.1|1121134_1121833_-	YqaJ viral recombinase family protein	NA	A0A2L1IV73	Escherichia_phage	57.0	2.6e-74
WP_159363854.1|1121829_1122756_-	recombinase RecT	NA	F1C5B8	Cronobacter_phage	66.2	2.0e-109
WP_087802156.1|1122752_1122974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363855.1|1122970_1123234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171455270.1|1123241_1123397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080047887.1|1123450_1123804_-	hypothetical protein	NA	A0A249XWT3	Proteus_phage	50.9	3.9e-18
WP_159363856.1|1124118_1124394_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363857.1|1124555_1125059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363858.1|1125082_1125355_-	hypothetical protein	NA	A0A1P8DTK1	Proteus_phage	98.9	5.7e-41
WP_159363859.1|1125893_1126301_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364197.1|1126327_1127005_-	helix-turn-helix domain-containing protein	NA	K7P850	Enterobacteria_phage	55.9	1.6e-55
WP_109391285.1|1127083_1127311_+	DNA-binding protein	NA	G9L677	Escherichia_phage	68.0	2.9e-22
WP_109391284.1|1127441_1127783_+	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	91.9	2.7e-48
WP_129037626.1|1128038_1128875_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	56.8	2.1e-78
WP_159364198.1|1128878_1130246_+	replicative DNA helicase	NA	A0A0P0ZC27	Stx2-converting_phage	63.8	2.5e-161
WP_159363860.1|1130242_1130509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363861.1|1130975_1131419_+	recombination protein NinB	NA	A0A1P8DTD8	Proteus_phage	94.6	6.4e-34
WP_159363862.1|1131415_1132078_+	metallophosphoesterase	NA	A0A2D1GLI5	Escherichia_phage	60.9	2.8e-73
WP_159363863.1|1132074_1132218_+	hypothetical protein	NA	A0A1P8DTE6	Proteus_phage	89.4	8.7e-17
WP_159363864.1|1132189_1132783_+	recombination protein NinG	NA	A0A1P8DTE0	Proteus_phage	98.5	2.2e-101
WP_159363865.1|1132772_1132964_+	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	96.8	1.7e-28
WP_171455271.1|1133095_1133599_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	38.8	1.1e-24
WP_159363867.1|1133887_1134205_+|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	61.9	5.6e-32
WP_159363868.1|1134197_1134590_+	M15 family metallopeptidase	NA	A0A1P8DTE2	Proteus_phage	98.9	5.1e-51
WP_159363869.1|1134586_1134964_+	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	31.7	3.1e-05
WP_072065063.1|1135129_1135423_+	hypothetical protein	NA	A0A2R4ALD8	Vibrio_phage	57.6	8.6e-19
WP_159363870.1|1135852_1136872_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	34.4	7.1e-36
WP_159363871.1|1137070_1138471_+|terminase	phage terminase large subunit	terminase	A0A2K9V3I6	Faecalibacterium_phage	40.7	5.1e-85
WP_159363872.1|1138472_1139972_+	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	45.3	4.5e-103
WP_159364199.1|1140009_1140723_+|head	phage head morphogenesis protein	head	Q6IWU3	Burkholderia_phage	40.5	4.1e-38
WP_103004838.1|1140719_1141982_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	53.1	2.7e-45
WP_171455272.1|1141981_1142479_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109397954.1|1142478_1143546_+	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	38.9	1.3e-51
WP_159363873.1|1143615_1143957_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	36.4	4.7e-08
WP_099660761.1|1143959_1144391_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	31.7	5.7e-11
WP_159363874.1|1144390_1144849_+	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	38.6	8.5e-13
WP_159363875.1|1144848_1145220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363876.1|1145206_1145722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363877.1|1145730_1147218_+	DUF3383 family protein	NA	A0A088C3U1	Shewanella_sp._phage	37.7	2.5e-82
WP_159363878.1|1147228_1147681_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.8	1.2e-22
WP_159363879.1|1147720_1148179_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	3.0e-26
WP_159363880.1|1148264_1150526_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	31.3	5.8e-22
WP_159363881.1|1150527_1151058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363882.1|1151054_1151372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363883.1|1151340_1152153_+	hypothetical protein	NA	A1Z005	Burkholderia_virus	26.0	1.8e-10
WP_159363884.1|1152155_1152848_+	hypothetical protein	NA	A1Z003	Burkholderia_virus	39.4	1.6e-34
WP_159363885.1|1152844_1153189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109397942.1|1153181_1154369_+|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	38.2	1.4e-72
1157958:1157976	attR	CTTATTGGATTATAGTGGG	NA	NA	NA	NA
>prophage 4
NZ_CP053371	Proteus cibarius strain G32 chromosome, complete genome	4006606	1650800	1664364	4006606	tRNA	Tupanvirus(55.56%)	13	NA	NA
WP_099659660.1|1650800_1652729_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.2	3.9e-128
WP_036937410.1|1652732_1653272_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	34.4	3.7e-15
WP_004263702.1|1653366_1653564_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_006537111.1|1653606_1653963_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_120655563.1|1654071_1654119_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_023582383.1|1654294_1655278_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	37.7	4.9e-34
WP_075673356.1|1655292_1657680_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	27.4	3.5e-09
WP_023582381.1|1657684_1657981_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	4.2e-13
WP_099659661.1|1658360_1659371_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_075673354.1|1659372_1660122_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L090	Tupanvirus	28.1	7.1e-09
WP_099659662.1|1660255_1661401_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	28.8	3.5e-39
WP_075673352.1|1661401_1662382_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	A8CG95	Salmonella_phage	34.7	1.1e-38
WP_075673351.1|1662381_1664364_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	27.2	1.1e-21
>prophage 5
NZ_CP053371	Proteus cibarius strain G32 chromosome, complete genome	4006606	2320664	2377810	4006606	integrase,head,plate,tRNA,portal,tail,capsid,holin,terminase	Cronobacter_phage(58.33%)	62	2346200:2346215	2386048:2386063
WP_075674055.1|2320664_2322044_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	81.9	3.0e-178
WP_075674056.1|2322340_2323234_+	lipid kinase YegS	NA	NA	NA	NA	NA
WP_006533078.1|2323283_2324333_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_075674057.1|2324396_2325194_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_099660599.1|2326026_2326662_+	lipid IV(A) palmitoyltransferase PagP	NA	NA	NA	NA	NA
WP_075674059.1|2326775_2328158_-	amino acid permease	NA	NA	NA	NA	NA
WP_006533085.1|2328823_2329210_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_075674060.1|2329337_2330144_+	sugar-phosphatase	NA	NA	NA	NA	NA
WP_159241983.1|2330446_2331793_+	branched-chain amino acid transport system II carrier protein	NA	NA	NA	NA	NA
WP_075674062.1|2331903_2332743_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1W6DX33	Sphingobium_phage	30.9	3.8e-11
WP_075674063.1|2332842_2334315_-	alanine:cation symporter family protein	NA	NA	NA	NA	NA
WP_075674064.1|2335658_2335892_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	65.6	1.7e-14
WP_075674065.1|2335994_2336384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_069367593.1|2336480_2336663_-	YoaH family protein	NA	NA	NA	NA	NA
WP_159364084.1|2336775_2338161_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	37.4	1.0e-37
WP_075674067.1|2338147_2338711_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_075674068.1|2338895_2340257_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_006533102.1|2340949_2341537_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_109418890.1|2341619_2342435_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_023581865.1|2342582_2342996_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_075674135.1|2343231_2343678_+	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	32.0	3.2e-09
WP_075674136.1|2343933_2344518_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	32.9	8.6e-10
WP_075674137.1|2344591_2345410_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_075674138.1|2345618_2346056_-	universal stress protein	NA	A0A1W6JNV4	Morganella_phage	47.9	8.9e-28
2346200:2346215	attL	AAAATAAATATAAGCT	NA	NA	NA	NA
WP_075674139.1|2346349_2347762_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_171455311.1|2348879_2350526_-	hypothetical protein	NA	F1BUJ7	Cronobacter_phage	52.7	1.8e-145
WP_159364086.1|2350529_2351114_-	hypothetical protein	NA	F1BUJ9	Cronobacter_phage	51.1	1.9e-41
WP_159364087.1|2351085_2351808_-	hypothetical protein	NA	F1BUK1	Cronobacter_phage	31.5	1.4e-33
WP_159364088.1|2351810_2353748_-|tail	phage tail protein	tail	F1BUK3	Cronobacter_phage	59.2	3.7e-110
WP_159364089.1|2353751_2354309_-	hypothetical protein	NA	F1BUK5	Cronobacter_phage	64.1	2.8e-66
WP_159364090.1|2354301_2355486_-|plate	baseplate J/gp47 family protein	plate	F1BUK6	Cronobacter_phage	65.1	5.5e-149
WP_036935273.1|2355475_2355811_-	DUF2590 family protein	NA	F1BUK8	Cronobacter_phage	67.0	2.9e-31
WP_159364091.1|2355822_2358339_-|tail	phage tail tape measure protein	tail	F1BUK9	Cronobacter_phage	46.9	3.6e-129
WP_162837603.1|2358338_2358482_-	hypothetical protein	NA	A5X9I8	Aeromonas_virus	60.9	6.7e-09
WP_036935269.1|2358526_2358796_-	phage gene	NA	A5X9I7	Aeromonas_virus	49.4	9.6e-17
WP_159364092.1|2358904_2359279_-	hypothetical protein	NA	F1BUL2	Cronobacter_phage	53.2	3.3e-23
WP_159364093.1|2359278_2359611_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	70.3	4.4e-35
WP_036935263.1|2359607_2359901_-|holin	holin	holin	C7BGD7	Burkholderia_phage	52.9	1.1e-16
WP_036907273.1|2359918_2360371_-	DUF2597 family protein	NA	F1BUL4	Cronobacter_phage	62.6	1.2e-48
WP_159364094.1|2360370_2361489_-	DUF2586 family protein	NA	F1BUL5	Cronobacter_phage	64.9	6.9e-133
WP_159364095.1|2361503_2362202_-	hypothetical protein	NA	F1BUL6	Cronobacter_phage	58.9	2.9e-65
WP_060557611.1|2362198_2362687_-|tail	phage tail protein	tail	Q94MZ1	Haemophilus_virus	26.6	1.6e-06
WP_049220751.1|2362683_2363136_-|head	head completion/stabilization protein	head	F1BUL8	Cronobacter_phage	53.3	1.8e-36
WP_159364097.1|2363234_2363939_-|terminase	terminase	terminase	F1BUM0	Cronobacter_phage	53.0	2.5e-64
WP_159364098.1|2363944_2364976_-|capsid	phage major capsid protein, P2 family	capsid	F1BUM2	Cronobacter_phage	69.5	1.8e-132
WP_159364099.1|2364991_2365837_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUM4	Cronobacter_phage	44.3	2.9e-51
WP_171455312.1|2365998_2367789_+|terminase	terminase	terminase	F1BUM5	Cronobacter_phage	65.2	7.7e-227
WP_171455313.1|2367788_2368823_+|portal	phage portal protein	portal	F1BUM7	Cronobacter_phage	63.7	8.6e-130
WP_036935239.1|2368819_2369128_+	ogr/Delta-like zinc finger family protein	NA	F1BUM8	Cronobacter_phage	60.4	3.7e-28
WP_060554736.1|2369129_2369312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364102.1|2369630_2371727_-	replication endonuclease	NA	F1BUS0	Erwinia_phage	50.0	2.1e-207
WP_159364103.1|2371823_2372402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159364104.1|2372469_2372727_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_159364105.1|2372803_2373151_-	DUF5347 family protein	NA	E5G6L5	Salmonella_phage	41.8	1.2e-16
WP_159364106.1|2373162_2373591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364107.1|2373754_2374264_-	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	49.7	1.3e-38
WP_159364108.1|2374296_2374527_-	regulator	NA	NA	NA	NA	NA
WP_159364109.1|2374674_2375265_+	helix-turn-helix domain-containing protein	NA	F1BUN8	Cronobacter_phage	33.1	8.6e-26
WP_171455314.1|2375277_2375766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159364110.1|2375710_2375902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159364111.1|2375903_2376794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159364112.1|2376796_2377810_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	61.9	1.3e-117
2386048:2386063	attR	AGCTTATATTTATTTT	NA	NA	NA	NA
>prophage 6
NZ_CP053371	Proteus cibarius strain G32 chromosome, complete genome	4006606	2509784	2516179	4006606	lysis,holin	Burkholderia_phage(25.0%)	9	NA	NA
WP_075674210.1|2509784_2510243_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	47.6	7.4e-25
WP_075674211.1|2510305_2510758_-	hypothetical protein	NA	B5M9T3	Pseudomonas_phage	33.8	1.1e-12
WP_075674212.1|2510768_2512256_-	DUF3383 domain-containing protein	NA	Q6IWV2	Burkholderia_phage	30.8	1.9e-58
WP_159241950.1|2512264_2512777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075674214.1|2512872_2513322_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	31.1	4.3e-09
WP_075674215.1|2513318_2513723_-	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.8	4.5e-26
WP_075674216.1|2513715_2514024_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	55.4	3.1e-27
WP_099660645.1|2514387_2515203_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	44.8	1.1e-55
WP_075674218.1|2515441_2516179_+	helix-turn-helix transcriptional regulator	NA	A0A088CBP2	Shigella_phage	46.3	1.8e-57
>prophage 7
NZ_CP053371	Proteus cibarius strain G32 chromosome, complete genome	4006606	2677844	2768757	4006606	integrase,head,tRNA,portal,tail,capsid,lysis,protease,holin,terminase	Proteus_phage(45.83%)	99	2727341:2727356	2768789:2768804
WP_075670474.1|2677844_2678573_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_023581619.1|2678697_2679501_+	inositol-1-monophosphatase	NA	NA	NA	NA	NA
WP_075670472.1|2679565_2680237_-	CerR family C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_159364165.1|2680263_2681532_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_075670468.1|2681700_2682855_-	3-phenylpropionate MFS transporter	NA	NA	NA	NA	NA
WP_075670466.1|2682947_2684201_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	52.8	3.9e-100
WP_099659375.1|2684567_2685767_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_075670462.1|2685856_2686504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075670460.1|2686782_2687121_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_075670458.1|2687136_2688753_-	NAD+ synthase	NA	A0A2L0UZF5	Agrobacterium_phage	37.6	1.6e-98
WP_075670456.1|2688826_2690164_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	33.1	6.7e-10
WP_159364215.1|2690175_2691144_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_075670452.1|2691230_2692679_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	25.5	1.3e-14
WP_159364166.1|2693370_2697261_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.2	7.7e-131
WP_075670448.1|2697525_2698998_+	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_075670446.1|2699809_2700358_+	fimbrial protein	NA	NA	NA	NA	NA
WP_075673678.1|2700536_2703023_+	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_075673677.1|2703053_2703818_+	molecular chaperone	NA	NA	NA	NA	NA
WP_109419114.1|2703843_2704914_+	fimbrial protein	NA	NA	NA	NA	NA
WP_156733764.1|2704913_2705462_+	fimbrial protein	NA	NA	NA	NA	NA
WP_075673674.1|2705465_2705996_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYZ2	Pandoravirus	36.4	8.9e-06
WP_075673673.1|2706103_2706739_-	LysE family translocator	NA	NA	NA	NA	NA
WP_075673672.1|2707217_2707478_+	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	47.7	2.7e-16
WP_075673671.1|2707519_2707900_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_075673670.1|2707899_2708631_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_075673669.1|2708700_2709441_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_023581601.1|2709450_2710359_-	GTPase Era	NA	NA	NA	NA	NA
WP_075673668.1|2710355_2711036_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	46.2	9.6e-21
WP_075673667.1|2711231_2712203_-	signal peptidase I	NA	NA	NA	NA	NA
WP_075673666.1|2712217_2714014_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	41.2	2.7e-22
WP_099659371.1|2714315_2714780_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_075673664.1|2714793_2715762_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_075673663.1|2715809_2716472_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_006533574.1|2716474_2717053_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_075673662.1|2717348_2718104_-|tRNA	tRNA1(Val) (adenine(37)-N6)-methyltransferase	tRNA	NA	NA	NA	NA
WP_023581591.1|2719902_2720286_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	66.0	5.8e-31
WP_075673659.1|2720620_2721301_+	uracil-DNA glycosylase	NA	A0A076JX67	Equid_alphaherpesvirus	47.7	5.8e-58
WP_075673658.1|2721418_2722030_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_083629114.1|2722130_2723030_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_083629113.1|2723117_2724779_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_075673657.1|2724892_2725255_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_075673656.1|2725461_2725755_-	RnfH family protein	NA	NA	NA	NA	NA
WP_006533588.1|2725747_2726182_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_075673655.1|2726338_2726821_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	49.4	3.3e-31
2727341:2727356	attL	TGCACGCGAAATGCAC	NA	NA	NA	NA
WP_159363432.1|2727607_2727982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171455320.1|2730561_2734230_-	DUF1983 domain-containing protein	NA	A0A1P8DTI4	Proteus_phage	92.4	0.0e+00
WP_159364168.1|2734249_2734828_-|tail	tail assembly protein	tail	A0A1P8DTG7	Proteus_phage	99.5	2.2e-103
WP_099660124.1|2734906_2735383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364169.1|2735379_2736102_-	C40 family peptidase	NA	A0A1P8DTI6	Proteus_phage	99.1	3.3e-136
WP_171455374.1|2736107_2736860_-|tail	phage minor tail protein L	tail	A0A1P8DTI3	Proteus_phage	98.8	7.6e-144
WP_159363434.1|2736853_2737186_-|tail	phage tail protein	tail	A0A1P8DTI9	Proteus_phage	97.3	1.8e-60
WP_159363435.1|2737188_2740428_-|tail	phage tail tape measure protein	tail	A0A1P8DTH2	Proteus_phage	95.7	0.0e+00
WP_159363436.1|2740447_2740729_-	DUF4035 domain-containing protein	NA	A0A1P8DTH5	Proteus_phage	90.4	5.0e-40
WP_159363437.1|2740752_2741133_-|tail	phage tail protein	tail	A0A1P8DTJ2	Proteus_phage	98.4	2.5e-63
WP_036913331.1|2741135_2741603_-	hypothetical protein	NA	A0A1P8DTJ5	Proteus_phage	100.0	1.3e-80
WP_159363438.1|2741668_2742004_-	hypothetical protein	NA	A0A1P8DTJ3	Proteus_phage	97.3	2.6e-56
WP_171455321.1|2742000_2742441_-	HK97 gp10 family phage protein	NA	A0A1P8DTH7	Proteus_phage	98.6	9.1e-73
WP_115349556.1|2742437_2742761_-|head	phage head closure protein	head	A0A1P8DTK6	Proteus_phage	99.1	6.3e-55
WP_159363439.1|2742769_2743096_-|head,tail	phage head-tail connector protein	head,tail	A0A1P8DTJ4	Proteus_phage	99.1	2.2e-55
WP_159363440.1|2743095_2743290_-	hypothetical protein	NA	A0A1P8DTJ1	Proteus_phage	97.9	1.3e-18
WP_159363441.1|2743342_2744557_-|capsid	phage major capsid protein	capsid	A0A1P8DTJ7	Proteus_phage	98.5	5.2e-219
WP_159363442.1|2744568_2745420_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A1P8DTI2	Proteus_phage	98.9	9.5e-151
WP_159363443.1|2745424_2746756_-|portal	phage portal protein	portal	A0A1P8DTI5	Proteus_phage	98.9	5.0e-255
WP_159363444.1|2746755_2748495_-|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	90.7	0.0e+00
WP_071233560.1|2748497_2748968_-|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	81.3	1.0e-69
WP_159363445.1|2749115_2749313_-	hypothetical protein	NA	A0A1P8DTB8	Proteus_phage	96.9	1.0e-28
WP_159363446.1|2749309_2749660_-	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	94.0	2.9e-61
WP_159363447.1|2749725_2750103_-	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	59.0	2.5e-31
WP_159363448.1|2750092_2750404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364170.1|2751091_2751466_-|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	42.3	4.5e-12
WP_075673907.1|2751536_2752115_-	hypothetical protein	NA	A0A0H4IQ87	Shigella_phage	66.7	1.5e-70
WP_159363449.1|2752314_2752734_-	structural protein	NA	A0A2R3UAM8	Myoviridae_environmental_samples	45.4	4.4e-24
WP_159363450.1|2752726_2753044_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	59.0	1.1e-30
WP_115350921.1|2753283_2753532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363451.1|2753543_2753786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363452.1|2753907_2755074_-	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	A0A218MNE0	uncultured_virus	43.6	4.3e-85
WP_071425844.1|2755314_2755698_-	antitermination protein	NA	A0A088CD47	Shigella_phage	71.4	7.2e-50
WP_159363453.1|2755697_2756672_-	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	53.5	1.9e-102
WP_171455322.1|2756668_2758234_-	DEAD/DEAH box helicase family protein	NA	A0A286N2P9	Klebsiella_phage	69.1	1.4e-219
WP_020946098.1|2758494_2758743_-	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	56.0	8.9e-17
WP_159363454.1|2758735_2758960_-	Cro/Cl family transcriptional regulator	NA	NA	NA	NA	NA
WP_159363455.1|2759054_2759765_+	helix-turn-helix domain-containing protein	NA	A0A2R2X2B0	Escherichia_phage	64.4	8.9e-78
WP_159363456.1|2759834_2760851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363457.1|2761871_2762078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363458.1|2762080_2762278_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363459.1|2762270_2762669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363460.1|2762668_2762968_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363461.1|2762964_2763387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363462.1|2763461_2763815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159364171.1|2763798_2764008_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124743714.1|2764004_2764481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363463.1|2764492_2765290_+	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	45.6	4.3e-28
WP_159364172.1|2765363_2765711_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_159363464.1|2765710_2766244_+	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	34.3	2.2e-20
WP_159363465.1|2766475_2766727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363466.1|2766713_2767112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159363467.1|2767098_2767422_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058336070.1|2767408_2767621_+	hypothetical protein	NA	I6PBM8	Cronobacter_phage	61.8	3.1e-18
WP_159363468.1|2767575_2768757_+|integrase	tyrosine-type recombinase/integrase	integrase	I6PDJ1	Cronobacter_phage	69.9	1.8e-152
2768789:2768804	attR	TGCACGCGAAATGCAC	NA	NA	NA	NA
>prophage 8
NZ_CP053371	Proteus cibarius strain G32 chromosome, complete genome	4006606	3030283	3039355	4006606	integrase	Morganella_phage(75.0%)	12	3024503:3024524	3039386:3039407
3024503:3024524	attL	TCATGCCCCCAATTATGCCCCC	NA	NA	NA	NA
WP_159363524.1|3030283_3030742_-	osmoprotectant transporter ProQ	NA	A0A1W6JPI6	Morganella_phage	64.8	1.9e-17
WP_171455334.1|3031149_3033870_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	68.8	0.0e+00
WP_159363525.1|3033856_3034231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363526.1|3034227_3034437_-	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	75.4	1.8e-18
WP_159363527.1|3034433_3034613_-	hypothetical protein	NA	A0A1W6JPF0	Morganella_phage	62.0	1.1e-08
WP_159363528.1|3034609_3035476_-	host cell division inhibitor Icd-like protein	NA	A0A1W6JPK3	Morganella_phage	45.7	1.6e-57
WP_064497270.1|3035472_3036279_-	antA/AntB antirepressor family protein	NA	A0A0P0ZDY7	Stx2-converting_phage	45.8	6.0e-22
WP_159363529.1|3036291_3036687_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	56.9	1.6e-28
WP_159363530.1|3036686_3036887_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_159363531.1|3037108_3037564_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363532.1|3037589_3037931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159363533.1|3038143_3039355_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.0	2.6e-130
3039386:3039407	attR	TCATGCCCCCAATTATGCCCCC	NA	NA	NA	NA
>prophage 1
NZ_CP053372	Proteus cibarius strain G32 plasmid pG32-177, complete sequence	177911	4781	56506	177911	transposase,integrase	Escherichia_phage(30.43%)	55	56057:56070	59055:59068
WP_000602738.1|4781_5534_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|5955_6981_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001199192.1|7209_7986_-	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_001067855.1|8099_8804_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_063840321.1|8947_9502_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001334766.1|9632_10463_+	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_000186237.1|10600_11233_+	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001749986.1|11317_11770_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|11992_12340_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000259031.1|12333_13173_+	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000376616.1|13300_13504_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|13728_14433_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_159364223.1|15230_15731_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|15858_16698_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	A0A0B5J4J5	Pandoravirus	27.2	5.0e-11
WP_000679427.1|16691_17039_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|17261_17714_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000186237.1|17798_18431_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001334766.1|18568_19399_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|19529_20084_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|20227_20932_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001199192.1|21045_21822_+	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_000742814.1|22049_23075_+	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_000602738.1|23496_24249_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_170628443.1|26185_26545_+	phenol hydroxylase	NA	NA	NA	NA	NA
WP_085940648.1|26741_27832_-|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_001043260.1|27921_28737_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|28823_29126_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|29019_29271_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344975.1|29301_30795_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|30906_31212_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|31239_32454_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|32670_33555_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|34479_35184_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_046788546.1|35268_35670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_159364222.1|35678_38630_-|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.4	0.0e+00
WP_000147567.1|38632_39193_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|39318_39669_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|39871_40885_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000050382.1|41987_42596_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001261740.1|42653_43445_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000095725.1|43706_44966_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206316.1|45058_45850_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|46019_46352_+	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_109023896.1|47253_47529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|47531_48323_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_001354008.1|48790_49036_-	GrpB family protein	NA	NA	NA	NA	NA
WP_000612791.1|49073_49937_-	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001067855.1|50167_50872_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_171455380.1|50872_52075_+	hypothetical protein	NA	Q6NE04	Leptospira_phage	36.2	2.0e-61
WP_171455381.1|52527_52881_-	QacE family quaternary ammonium compound efflux SMR transporter	NA	NA	NA	NA	NA
WP_001206316.1|53019_53811_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000777554.1|53827_54301_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	G3MBI7	Bacillus_virus	32.1	3.7e-19
WP_070342364.1|54297_55143_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_000071896.1|55528_56065_+|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
56057:56070	attL	ATAAAATAACTCAT	NA	NA	NA	NA
WP_000497519.1|56179_56506_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
WP_000497519.1|56179_56506_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
59055:59068	attR	ATGAGTTATTTTAT	NA	NA	NA	NA
>prophage 2
NZ_CP053372	Proteus cibarius strain G32 plasmid pG32-177, complete sequence	177911	127084	158035	177911	transposase,integrase	Escherichia_phage(38.46%)	21	151862:151921	166699:166761
WP_094962951.1|127084_130132_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_038999265.1|130280_130856_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.2	4.9e-26
WP_000654811.1|131285_132254_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.6	1.7e-172
WP_089617520.1|132407_133614_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	62.9	5.7e-101
WP_032306837.1|133755_134382_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.5	1.1e-79
WP_033550846.1|134384_135212_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	37.9	2.7e-17
WP_159364227.1|135250_137674_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	45.5	5.4e-199
WP_159364228.1|137756_138404_+	molecular chaperone TorD family protein	NA	A0A077SLS7	Escherichia_phage	33.8	4.1e-13
WP_032306836.1|138596_140264_+	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.0	6.0e-40
WP_171455382.1|140364_140733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159364230.1|141519_142176_-	response regulator	NA	NA	NA	NA	NA
WP_004364961.1|144207_144615_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_171455383.1|145243_146382_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	37.1	6.9e-48
WP_096864993.1|146735_146963_-	DNA partition complex ParG	NA	NA	NA	NA	NA
WP_071547962.1|147055_147679_-	AAA family ATPase	NA	A2I303	Vibrio_virus	36.2	1.0e-21
WP_023159984.1|147999_148245_+	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_071547961.1|148244_148577_+	endoribonuclease MazF	NA	A0A1S5SEX8	Streptococcus_phage	30.8	7.2e-06
WP_001067855.1|151156_151861_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
151862:151921	attL	GTGCAGCTCCATCAGCAAAAGGGGATGATAAGTTTATCACCACCGACTATTTGCAACAGT	NA	NA	NA	NA
WP_071538080.1|151885_153460_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	2.8e-87
WP_001276994.1|154262_155930_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000267723.1|155926_158035_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
166699:166761	attR	ACTGTTGCAAATAGTCGGTGGTGATAAACTTATCATCCCCTTTTGCTGATGGAGCTGCACATG	NA	NA	NA	NA
