The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053553	Diaphorobacter sp. JS3050 chromosome, complete genome	3983118	688384	748895	3983118	plate,protease,capsid,integrase,portal,holin,tail,transposase	Acidithiobacillus_phage(79.63%)	69	713654:713670	754912:754928
WP_172205837.1|688384_689263_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	65.5	4.2e-101
WP_172205839.1|689269_689917_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	65.1	2.1e-73
WP_172209132.1|689934_690789_+	hypothetical protein	NA	A0A0S2SYC0	Pseudomonas_phage	45.4	6.2e-25
WP_172205841.1|690789_691353_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	58.6	1.1e-54
WP_172205843.1|691352_692090_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	65.6	3.6e-90
WP_172205845.1|692086_692566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172205847.1|692558_694868_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	73.6	0.0e+00
WP_172205850.1|695013_695481_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	88.4	1.1e-76
WP_172205852.1|695477_695846_+	hypothetical protein	NA	K4I3Y0	Acidithiobacillus_phage	73.4	2.8e-27
WP_172205854.1|695842_696436_+	hypothetical protein	NA	K4HZA2	Acidithiobacillus_phage	65.5	9.5e-57
WP_020685836.1|696634_697342_+	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_172205856.1|697469_697673_+	hypothetical protein	NA	K4I1D9	Acidithiobacillus_phage	82.1	7.0e-20
WP_172205858.1|697659_698238_+	hypothetical protein	NA	K4HZY5	Acidithiobacillus_phage	80.0	1.8e-76
WP_172205860.1|698426_698972_+	hypothetical protein	NA	K4ICN8	Acidithiobacillus_phage	86.2	1.7e-73
WP_172205862.1|698968_700393_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	70.0	1.9e-188
WP_172205864.1|700373_701669_+	site-specific DNA-methyltransferase	NA	K4HZA5	Acidithiobacillus_phage	80.4	1.4e-198
WP_172205866.1|701665_701902_+	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	89.7	6.7e-30
WP_172205868.1|701877_702084_-	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	83.8	4.3e-25
WP_172205870.1|702094_702463_-	hypothetical protein	NA	K4ICP1	Acidithiobacillus_phage	88.3	1.2e-57
WP_172205871.1|702565_702832_-	hypothetical protein	NA	K4HZA7	Acidithiobacillus_phage	48.8	8.9e-15
WP_172205872.1|702922_703405_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172205873.1|703472_703679_-	hypothetical protein	NA	K4I1E7	Acidithiobacillus_phage	79.4	4.2e-20
WP_172205874.1|703675_704284_-	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	86.1	3.8e-85
WP_172205875.1|704311_704563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172205876.1|704669_704891_-	stable inheritance protein KleA	NA	NA	NA	NA	NA
WP_172205877.1|706897_707110_+	hypothetical protein	NA	K4HZB1	Acidithiobacillus_phage	74.3	7.8e-22
WP_172209134.1|707160_708570_+|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	87.3	3.5e-235
WP_172205878.1|708579_709908_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	62.4	1.1e-129
WP_172205879.1|710319_711348_+|capsid	major capsid protein	capsid	K4I3Z3	Acidithiobacillus_phage	81.3	3.7e-165
WP_172205880.1|711366_711732_+	hypothetical protein	NA	K4HZB3	Acidithiobacillus_phage	54.8	7.9e-22
WP_172205881.1|711703_712258_+	hypothetical protein	NA	K4I1F4	Acidithiobacillus_phage	65.5	2.7e-61
WP_172205882.1|712254_712731_+|plate	phage baseplate assembly protein V	plate	K4HZZ9	Acidithiobacillus_phage	69.6	1.7e-61
WP_172205883.1|712742_713027_+	PAAR domain-containing protein	NA	K4ICQ1	Acidithiobacillus_phage	67.7	3.6e-30
WP_172205884.1|713033_713369_+	GPW/gp25 family protein	NA	K4I3Z7	Acidithiobacillus_phage	67.0	7.5e-35
WP_172205885.1|713369_714077_+|plate	baseplate J/gp47 family protein	plate	K4HZB7	Acidithiobacillus_phage	70.6	1.5e-80
713654:713670	attL	GATGGAAGAGGCCGACG	NA	NA	NA	NA
WP_078465000.1|714241_715207_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	29.0	5.4e-17
WP_172205886.1|715203_715395_+	hypothetical protein	NA	K4HZB7	Acidithiobacillus_phage	55.6	1.3e-12
WP_172205887.1|715422_716997_+|tail	phage tail protein	tail	K4I1F8	Acidithiobacillus_phage	67.4	6.2e-188
WP_172205888.1|717058_717751_+	hypothetical protein	NA	K4I002	Acidithiobacillus_phage	90.4	5.8e-114
WP_172205889.1|717766_720928_+	DUF4815 domain-containing protein	NA	K4ICQ5	Acidithiobacillus_phage	92.1	0.0e+00
WP_172205890.1|720940_721147_+	hypothetical protein	NA	K4I3Z9	Acidithiobacillus_phage	53.7	7.1e-12
WP_172205891.1|721159_721720_+	hypothetical protein	NA	K4HZC1	Acidithiobacillus_phage	82.7	1.5e-24
WP_172205892.1|721732_722044_+	hypothetical protein	NA	K4I1G2	Acidithiobacillus_phage	57.3	1.5e-21
WP_172205894.1|722043_723390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172205896.1|723401_723857_+	hypothetical protein	NA	K4ICR0	Acidithiobacillus_phage	59.9	7.8e-35
WP_172209136.1|723883_724174_+	hypothetical protein	NA	K4I403	Acidithiobacillus_phage	82.6	6.3e-38
WP_172205898.1|724244_725279_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A193GYC3	Enterobacter_phage	55.4	5.1e-114
WP_172205901.1|725418_726477_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_172205903.1|726767_727280_+|tail	phage major tail tube protein	tail	K4I1G5	Acidithiobacillus_phage	85.9	1.2e-79
WP_172205905.1|727315_727564_+|tail	phage tail assembly protein	tail	K4I007	Acidithiobacillus_phage	86.6	1.2e-32
WP_172209138.1|728003_728969_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	29.3	7.0e-17
WP_172205907.1|729016_731713_+|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	66.7	3.0e-307
WP_172205909.1|731747_732146_+|tail	phage tail protein	tail	K4I406	Acidithiobacillus_phage	65.4	2.0e-47
WP_172205911.1|732142_732361_+|tail	tail protein X	tail	Q8H9M2	Vibrio_phage	49.2	5.1e-08
WP_172205913.1|732382_733441_+	late control protein D	NA	K4HZC6	Acidithiobacillus_phage	68.5	6.5e-133
WP_172205915.1|733451_733769_+|holin	phage holin family protein	holin	G3ENC0	Psychrobacter_phage	47.5	1.1e-16
WP_172205917.1|733765_734284_+	hypothetical protein	NA	B0ZSJ3	Halomonas_phage	34.2	2.2e-17
WP_172205919.1|734280_734709_+	hypothetical protein	NA	R4JN18	Pseudoalteromonas_phage	43.2	3.3e-19
WP_172205921.1|734805_735429_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_172205923.1|735543_736746_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	28.2	3.7e-31
WP_172205925.1|736871_737126_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_172205927.1|737170_738373_+|protease	trypsin-like serine protease	protease	NA	NA	NA	NA
WP_172205929.1|738800_740915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172205931.1|741018_741327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172205933.1|741476_742502_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_172205934.1|742700_745349_-	calcium-binding protein	NA	NA	NA	NA	NA
WP_172205936.1|745505_746666_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	33.6	1.8e-35
WP_172205938.1|746722_747457_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011803789.1|747668_748895_+|transposase	IS110-like element ISAisp4 family transposase	transposase	Q9JMN8	Wolbachia_phage	29.2	5.6e-35
754912:754928	attR	GATGGAAGAGGCCGACG	NA	NA	NA	NA
>prophage 2
NZ_CP053553	Diaphorobacter sp. JS3050 chromosome, complete genome	3983118	756053	822294	3983118	plate,capsid,head,integrase,portal,holin,tail,transposase	Acidithiobacillus_phage(81.36%)	81	794305:794321	829185:829201
WP_172205964.1|756053_756278_+	DUF2188 domain-containing protein	NA	A0A142KA22	Gordonia_phage	39.4	9.2e-05
WP_172205966.1|756619_756832_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_172205968.1|756828_757386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172205970.1|757385_758384_+	ParB N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_172205972.1|758376_758907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172205974.1|758903_759764_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	63.1	6.3e-102
WP_172205976.1|759770_760430_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	68.4	6.1e-73
WP_172209132.1|760447_761302_+	hypothetical protein	NA	A0A0S2SYC0	Pseudomonas_phage	45.4	6.2e-25
WP_172205987.1|761302_761869_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	61.4	2.9e-55
WP_172205989.1|761868_762417_+	HNH endonuclease	NA	Q6X9Q0	Myxococcus_phage	42.9	9.8e-24
WP_172205991.1|762403_763162_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	56.0	1.2e-75
WP_172205993.1|763158_763638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172205995.1|763630_765946_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	84.4	0.0e+00
WP_172205997.1|766083_766557_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	88.9	1.1e-76
WP_172205999.1|766589_766916_+	hypothetical protein	NA	K4I3Y0	Acidithiobacillus_phage	70.8	2.7e-21
WP_172206001.1|766912_767503_+	hypothetical protein	NA	K4HZA2	Acidithiobacillus_phage	69.5	2.7e-59
WP_172206003.1|767613_768078_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	75.8	1.5e-57
WP_172206005.1|768074_768647_+	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	71.4	5.7e-75
WP_172206007.1|768810_769014_+	hypothetical protein	NA	K4I1D9	Acidithiobacillus_phage	83.6	2.4e-20
WP_172206009.1|769000_769579_+	hypothetical protein	NA	K4HZY5	Acidithiobacillus_phage	78.4	1.7e-74
WP_172206011.1|769773_770334_+	hypothetical protein	NA	K4ICN8	Acidithiobacillus_phage	71.0	2.1e-58
WP_172206013.1|770330_771755_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	71.7	5.8e-193
WP_172206015.1|771735_773028_+	site-specific DNA-methyltransferase	NA	K4HZA5	Acidithiobacillus_phage	80.1	4.6e-197
WP_172206017.1|773024_773261_+	hypothetical protein	NA	K4I1E3	Acidithiobacillus_phage	92.3	3.2e-32
WP_172205868.1|773236_773443_-	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	83.8	4.3e-25
WP_172206019.1|773453_773822_-	hypothetical protein	NA	K4ICP1	Acidithiobacillus_phage	88.3	1.5e-57
WP_172206021.1|773925_774192_-	hypothetical protein	NA	K4HZA7	Acidithiobacillus_phage	50.0	4.0e-15
WP_172206023.1|774264_775029_-	hypothetical protein	NA	K4I1E7	Acidithiobacillus_phage	77.5	2.1e-08
WP_172206025.1|775025_775634_-	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	86.6	1.3e-85
WP_172206027.1|775661_775913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172206029.1|777924_778137_+	hypothetical protein	NA	K4HZB1	Acidithiobacillus_phage	74.3	1.3e-21
WP_172209140.1|778175_779603_+|portal	phage portal protein	portal	K4I1F2	Acidithiobacillus_phage	88.1	1.5e-233
WP_172206031.1|779612_780941_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	60.6	2.4e-124
WP_172206033.1|780937_781330_+|head	head decoration protein	head	K4ICP8	Acidithiobacillus_phage	71.7	3.8e-38
WP_172205879.1|781353_782382_+|capsid	major capsid protein	capsid	K4I3Z3	Acidithiobacillus_phage	81.3	3.7e-165
WP_172206035.1|782400_782754_+	hypothetical protein	NA	K4HZB3	Acidithiobacillus_phage	55.1	5.3e-23
WP_172206037.1|782725_783274_+	hypothetical protein	NA	K4I1F4	Acidithiobacillus_phage	67.2	5.9e-61
WP_172206039.1|783287_783764_+|plate	phage baseplate assembly protein V	plate	K4HZZ9	Acidithiobacillus_phage	69.6	1.5e-60
WP_172206041.1|783776_784061_+	PAAR domain-containing protein	NA	K4ICQ1	Acidithiobacillus_phage	64.6	7.5e-28
WP_172206043.1|784067_784403_+	GPW/gp25 family protein	NA	K4I3Z7	Acidithiobacillus_phage	66.1	2.9e-34
WP_172206045.1|784403_785246_+|plate	baseplate J/gp47 family protein	plate	K4HZB7	Acidithiobacillus_phage	69.4	1.9e-103
WP_172206047.1|785273_786848_+|tail	phage tail protein	tail	K4I1F8	Acidithiobacillus_phage	68.3	1.2e-191
WP_172206049.1|786883_787576_+	hypothetical protein	NA	K4I002	Acidithiobacillus_phage	89.6	6.2e-116
WP_172206051.1|787588_790750_+	DUF4815 domain-containing protein	NA	K4ICQ5	Acidithiobacillus_phage	92.7	0.0e+00
WP_172206053.1|790762_790969_+	hypothetical protein	NA	K4I3Z9	Acidithiobacillus_phage	52.4	1.2e-11
WP_172206056.1|790981_791542_+	hypothetical protein	NA	K4HZC1	Acidithiobacillus_phage	80.0	5.0e-23
WP_172206058.1|791554_791866_+	hypothetical protein	NA	K4I1G2	Acidithiobacillus_phage	59.2	1.2e-21
WP_172206060.1|791865_793278_+	hypothetical protein	NA	K4I004	Acidithiobacillus_phage	96.4	1.6e-264
WP_172206062.1|793274_793724_+	hypothetical protein	NA	K4ICR0	Acidithiobacillus_phage	81.3	3.2e-57
WP_172209142.1|793750_794041_+	hypothetical protein	NA	K4I403	Acidithiobacillus_phage	83.7	4.3e-39
WP_172206064.1|794111_795302_+|tail	phage tail sheath protein	tail	A0A193GYC3	Enterobacter_phage	57.3	4.7e-140
794305:794321	attL	GCACCTTGCCCATGGCC	NA	NA	NA	NA
WP_172206066.1|795301_795814_+|tail	phage major tail tube protein	tail	K4I1G5	Acidithiobacillus_phage	85.3	4.0e-80
WP_172206069.1|795838_796087_+|tail	phage tail assembly protein	tail	K4I007	Acidithiobacillus_phage	89.0	1.2e-32
WP_172206071.1|796347_799530_+|tail	phage tail tape measure protein	tail	K4ICR4	Acidithiobacillus_phage	81.6	0.0e+00
WP_172206073.1|799574_800474_+|tail	phage tail protein	tail	K4I406	Acidithiobacillus_phage	69.2	3.4e-90
WP_172206075.1|800470_800707_+|tail	tail protein X	tail	K4I1H0	Acidithiobacillus_phage	55.6	7.9e-15
WP_172206077.1|800719_801790_+	late control protein D	NA	K4HZC6	Acidithiobacillus_phage	70.5	4.3e-140
WP_172206078.1|801799_802129_+|holin	phage holin family protein	holin	M5A999	Nitratiruptor_phage	41.8	3.1e-17
WP_172206080.1|802125_802644_+	hypothetical protein	NA	B0ZSJ3	Halomonas_phage	35.0	1.1e-16
WP_172206082.1|802640_803069_+	hypothetical protein	NA	R4JN18	Pseudoalteromonas_phage	42.4	3.3e-19
WP_172206084.1|803219_804299_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_172206086.1|804279_804789_+	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_172206088.1|804789_805998_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A221SAN4	Ralstonia_phage	28.2	4.8e-31
WP_172206090.1|806123_806375_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_172206092.1|806683_808369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172209144.1|809130_810213_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_172206094.1|810672_811008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_103738567.1|811088_811325_+	DUF4160 domain-containing protein	NA	NA	NA	NA	NA
WP_103739147.1|811305_811575_+	DUF2442 domain-containing protein	NA	NA	NA	NA	NA
WP_172206096.1|811571_812684_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011804022.1|813143_813914_-	hypothetical protein	NA	NA	NA	NA	NA
WP_041835870.1|814163_814376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_083766722.1|814627_815935_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8CX13	Bacillus_phage	34.0	3.9e-10
WP_011804025.1|815996_816473_-	RES family NAD+ phosphorylase	NA	NA	NA	NA	NA
WP_011804026.1|816472_816925_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_011804027.1|816982_817288_+|tail	phage tail assembly protein	tail	K4I007	Acidithiobacillus_phage	85.9	6.6e-30
WP_172206098.1|817525_817978_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_011804029.1|817998_818310_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_011804030.1|818390_819905_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	46.3	2.3e-115
WP_085947529.1|820070_820754_-|integrase	site-specific integrase	integrase	A0A221SAN4	Ralstonia_phage	33.8	5.0e-17
WP_011804031.1|820902_822294_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
829185:829201	attR	GGCCATGGGCAAGGTGC	NA	NA	NA	NA
>prophage 3
NZ_CP053553	Diaphorobacter sp. JS3050 chromosome, complete genome	3983118	951810	960779	3983118		uncultured_virus(33.33%)	7	NA	NA
WP_172209154.1|951810_953286_-	glucose-6-phosphate dehydrogenase	NA	M4QQY0	Cyanophage	33.3	3.2e-61
WP_012655675.1|953481_954432_+	transaldolase	NA	A0A1D8KSY7	Synechococcus_phage	33.3	2.4e-09
WP_172206223.1|954428_956045_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_172206225.1|956075_957242_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.3	2.6e-13
WP_172206227.1|957512_959153_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	61.3	1.9e-171
WP_011804151.1|959243_959534_-	co-chaperone GroES	NA	A0A221S4A8	uncultured_virus	46.8	2.9e-19
WP_012655679.1|959744_960779_-	bifunctional nicotinamide-nucleotide adenylyltransferase/Nudix hydroxylase	NA	A0A1B0V161	Roseobacter_phage	41.5	5.3e-63
>prophage 4
NZ_CP053553	Diaphorobacter sp. JS3050 chromosome, complete genome	3983118	2030582	2097232	3983118	integrase,transposase	Streptococcus_phage(33.33%)	53	2030582:2030641	2097174:2098344
2030582:2030641	attL	CCTAGTGTAGTGTTGCATTCTGTTTGGAACTTAATCGGCTATTGGCGCGGATGACCTTTT	NA	NA	NA	NA
WP_087748270.1|2030582_2031668_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_172206867.1|2031989_2034383_+	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	37.0	2.0e-89
WP_172209241.1|2034421_2034679_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172209243.1|2034801_2035260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172209245.1|2035395_2036652_+	TolC family protein	NA	NA	NA	NA	NA
WP_172206868.1|2036667_2038182_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_172206869.1|2038178_2041298_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_172206870.1|2041552_2043487_-	FTR1 family protein	NA	NA	NA	NA	NA
WP_172206871.1|2043620_2044055_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_172206872.1|2044141_2046541_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	42.3	6.4e-144
WP_172206873.1|2046537_2047617_+	lipoprotein signal peptidase	NA	NA	NA	NA	NA
WP_172206874.1|2047776_2048232_-	Cd(II)/Pb(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_087748270.1|2048347_2049433_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_172206875.1|2049498_2051727_+	heavy metal translocating P-type ATPase	NA	E4ZFI9	Streptococcus_phage	38.8	1.1e-129
WP_172206876.1|2051749_2052052_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_172206877.1|2052055_2052748_+	transporter	NA	NA	NA	NA	NA
WP_172209247.1|2052786_2053977_-	heavy metal sensor histidine kinase	NA	NA	NA	NA	NA
WP_172206878.1|2054105_2054792_-	heavy metal response regulator transcription factor	NA	W8CYM9	Bacillus_phage	34.5	5.5e-32
WP_172206879.1|2054936_2055272_+	DUF4148 domain-containing protein	NA	NA	NA	NA	NA
WP_172206880.1|2056001_2057351_+	TolC family protein	NA	NA	NA	NA	NA
WP_172209249.1|2057374_2058952_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_172206881.1|2058968_2062148_+	CusA/CzcA family heavy metal efflux RND transporter	NA	NA	NA	NA	NA
WP_172206882.1|2062782_2063667_-	formate/nitrite transporter family protein	NA	NA	NA	NA	NA
WP_172206883.1|2063711_2065223_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_172209251.1|2065426_2065840_-	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_172206884.1|2066582_2066912_+	P-II family nitrogen regulator	NA	NA	NA	NA	NA
WP_172206885.1|2066952_2067207_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_172206886.1|2067287_2067884_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_172206887.1|2067944_2068856_+	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_172206888.1|2069023_2070676_+	multicopper oxidase domain-containing protein	NA	NA	NA	NA	NA
WP_172206889.1|2070683_2071076_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_172206890.1|2071178_2072075_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172206891.1|2072095_2072389_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172206892.1|2072825_2073467_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_172206893.1|2074274_2076128_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U1UNT3	Pseudomonas_phage	51.0	1.9e-103
WP_018076253.1|2076175_2076802_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003282197.1|2076907_2077207_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172206894.1|2077233_2079078_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_078465000.1|2079676_2080642_+|transposase	IS110 family transposase	transposase	Q75QL1	Wolbachia_phage	29.0	5.4e-17
WP_172206895.1|2080629_2081385_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_017462895.1|2081377_2082136_-	type IV toxin-antitoxin system AbiEi family antitoxin	NA	NA	NA	NA	NA
WP_017462896.1|2082358_2082727_+	DUF3742 family protein	NA	NA	NA	NA	NA
WP_017462897.1|2082755_2084288_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_003292115.1|2084303_2084657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172206896.1|2084653_2086060_-	integrating conjugative element protein	NA	NA	NA	NA	NA
WP_016851975.1|2086070_2087015_-	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_172206897.1|2087011_2087455_-	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_017462901.1|2087598_2088117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011803559.1|2089946_2091035_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_172206898.1|2092551_2093028_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003140985.1|2093218_2093713_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_172206899.1|2093908_2094652_-	thioredoxin domain-containing protein	NA	NA	NA	NA	NA
WP_087748270.1|2096146_2097232_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
2097174:2098344	attR	AAAAGGTCATCCGCGCCAATAGCCGATTAAGTTCCAAACAGAATGCAACACTACACTAGGTTCGCCGCATGTTGCGCGAACATGAGCTGGGTGTACCACTGGCGCTTGTCGGCAGCCGGATCGAACACGCACGGCAGCCAGCGCAGATAGCTGTTCAGCGGCGCCACCTCGTCCTCTTCGCGTACCGGTTGCAGGCCGGCGTTGAGCATCACGTTGACGAGCTGCAGGCCGCGCGCATCGAGCTGGGCCAAGTCGCGGCCGCGCAGGTAGAACGCCAGCGCGCCGCGGTAGAGCTTGTGCGCGCTGCCGATCAGGCCGCGCGCCTGCTGCACGTCCTGGCGGGCCTGCTCCGAGGCCAGGGTCTCACCGACGGCCTTCCTGGCGAGGTGGTTGAGGTGCGCCTCCAGCACGTCCTGGGGCGTGGCGACCAGCGTCAGGCACATCACCGTGTCCTCGGGTATCTGGTCGAACAGCGCGTTCATGGCATCGCCGCCTTTGCGCGTCTCGCCCGTCAGATGGCCCGTCACGGGTGGCGTGCGCAGGCGATCCATCACGATCACCCGATGCGGCATGCCGTCGAAGAACCACAGGCCGTTGGGCACGTCCGAACGGGGCTCGCCGAAGAACAGGCGCTGCGCGAAGTCGGTGCCGCTGGCGAGTTCGATCTCGCCCTCCTCCCGCTCTTCCGGGTAGCGGGTCAGCGCGTAGAAGCGTTCCCGGTCTTCGGCAGTGGCGCCGAGCAGGGTCGGATTCGGGTTGAACCAGCGCAGCAGCCAGGCGTGGATGTCCGCCGCGCCGAGACGCCGAGCCTTCACGCCGGCATTCGCCAGCCCGCCGGCGAGGCGGTCGCAGATCGTGGTCAGCGCCTGCTCGGGCGACTGGCCGCGCCGCGGGGCCGGGGCCGCGGACGTGCGGCGGTAGACCACCATGCGCACGCGCCGCACCTGGCCGCGCCACGGCAGGCGCGTCACCGTGGTGTCCTCGAACAGGCCGCCCGGCTTGGCGATGGCCCGCAGGTGATGGGCGAAGAAGCGCAGGTAGAAGTCGCTGAACGCGCTGCCCTGCGCACGCGGCTGCAGATAGTTCGCCAGGGAGCGCAGATAGTTGTCCCAGTCGGCCTCGTCCTGGGCGTAGAGCTGCACCACCCAGGGGTTGTCGTCCAACTCGTCAA	NA	NA	NA	NA
>prophage 5
NZ_CP053553	Diaphorobacter sp. JS3050 chromosome, complete genome	3983118	2411315	2463904	3983118	integrase,protease,transposase	Wolbachia_phage(16.67%)	36	2435834:2435893	2459830:2461156
WP_011803789.1|2411315_2412542_-|transposase	IS110-like element ISAisp4 family transposase	transposase	Q9JMN8	Wolbachia_phage	29.2	5.6e-35
WP_011804935.1|2413530_2414094_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_172207119.1|2414163_2416833_-	DUF349 domain-containing protein	NA	NA	NA	NA	NA
WP_011804932.1|2421501_2422341_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_172207121.1|2422578_2423823_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.4	5.9e-93
WP_011804930.1|2423835_2424285_+	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_172207123.1|2424361_2425462_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	43.5	3.4e-76
WP_047351400.1|2425555_2426011_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_011804927.1|2426109_2427423_+	O-acetylhomoserine aminocarboxypropyltransferase	NA	NA	NA	NA	NA
WP_011804926.1|2427422_2428244_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_172207125.1|2428588_2431327_+	cation-transporting P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	31.9	1.4e-73
WP_172207127.1|2431339_2432032_-	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_172209284.1|2432122_2433130_+	ferrochelatase	NA	NA	NA	NA	NA
WP_172207129.1|2433609_2434839_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_172207131.1|2434926_2435823_-	hypothetical protein	NA	NA	NA	NA	NA
2435834:2435893	attL	CTTTAACAGGCCGTTGAAAAAGTGGGCATCGAACGCATCAGGGACGCTGTTTTCGAAGAA	NA	NA	NA	NA
WP_011803559.1|2435989_2437078_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_087748270.1|2437244_2438330_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_011804916.1|2438376_2439906_-	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_172207133.1|2439995_2440547_-	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_011804914.1|2440680_2441640_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_047351410.1|2441787_2442474_+	response regulator	NA	NA	NA	NA	NA
WP_172207135.1|2442646_2444050_+	sensor histidine kinase N-terminal domain-containing protein	NA	A0A1V0SGX0	Hokovirus	26.1	9.6e-07
WP_047351412.1|2444090_2444516_+	RNA-binding S4 domain-containing protein	NA	NA	NA	NA	NA
WP_011804910.1|2444640_2444943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172207137.1|2445079_2446552_-	DUF2083 domain-containing protein	NA	NA	NA	NA	NA
WP_172207139.1|2446653_2447070_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_172207141.1|2447066_2448227_+	2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_172207143.1|2448333_2451006_+	Fe/S-dependent 2-methylisocitrate dehydratase AcnD	NA	NA	NA	NA	NA
WP_172207145.1|2451019_2452222_+	2-methylaconitate cis-trans isomerase PrpF	NA	NA	NA	NA	NA
WP_172207147.1|2452405_2453266_+	isocitrate lyase/PEP mutase family protein	NA	NA	NA	NA	NA
WP_172207149.1|2453312_2454242_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172207151.1|2454339_2456709_+	5-methyltetrahydropteroyltriglutamate-- homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_172207153.1|2456785_2457244_+	CopD family protein	NA	NA	NA	NA	NA
WP_172207155.1|2457516_2458368_+|integrase	integrase family protein	integrase	A0A077KET4	Ralstonia_phage	48.2	1.1e-69
WP_011803559.1|2458644_2459733_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_172209286.1|2461840_2463904_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
2459830:2461156	attR	TTCTTCGAAAACAGCGTCCCTGATGCGTTCGATGCCCACTTTTTCAACGGCCTGTTAAAGAGAGCCGCCGGGCTTGCCCGGCAGGCCGTTGGTCGGCGGCACCTTGGCTGGTCCGCACGCTTGTGATTGTCATTCAAGCTGCAGGAGAGCCGCAATGGATTTGACCCCGATGCACAAGCGCGTCATTGCGCTGGACGTTCACCAGGCCAAGATCACGGCCTGCGCCGTTGTCGAACATGACGATGGCCGGGTAGAGGTCACCAAGCGAGACTTCGGCGCCTTCAAACGCGACCGCCGCGCCTTGGCGCAGTGGGCGCTGGAGATGGCCCTGAGGTCGTGGTGATGGAGAGCACAGGGGTGTATTGGAAAAGCCCGTTTGCGGCGCTGGAGGCGGTGGGCCTTATTGCTTGGGTGGTCAACGCGCGGCATGTCAAGGCTGTGCCCGGTCGCAAGACCGACATGGCCGATGCACAGTGGCTGGCCACGCTGGCGCGTGCGGGTTTGCTGCGCGCCTCGTTCATTCCACCGGTGCAGATGCGCCAGCTTCGCCTGGTAGCGCGCCAGCGGCAAAAGCTGGTGGGCATGTGCAGCGCCGAGAAGAACCGGCTGCACAAGGTGCTGGTGGACGCGGGCATTCGCATCAACGTGCTGGTGGCCGACATCCACGGACAGAGCGCGCGTGCCATGGTCAAAGCCCTGATCGAGGGACAGCCCATGCACGAGGTGCTGAACCACAAGGGGCGGCTGCGAGCGAGCAGGCAAGAACTGTGCGAGGCCCTGAGCACCGAGCAGTTCAGCGCAGTGCACCGCTTTGTGGCCCAGGAGATCGTGCAGCACATTGAGCAGATCGAGCAGCGCATCGCCCGCATGGACCAGTACCTGCTGCAGGGCCTGCAACCCTGGCAGCCACAGCTCAGGCTGCTGCAGACCCTGCCGGGCATCGACGAGCAGGGGCGGCCATGCTGCTGGTGGAGATTGGTGCGGACATGAGCGTGTTTGGCAGTGCAGAGCGCCTGGCCAGTTGGGTGGGCATCTGCCCAGGCAACAACGAGAGCGCGGGCAAGCGCAAAACCGGGCGCATCCGCAAGGGCAACGCCTGGGTCAGAAGGCTGCTGTGCGAGTTCGCCCAGGCTGCAGCACGAACGCGCTGCGCACTCAAGGCCAAGTTCGACGCGCTGACCATCCGAAAGGGCCACAAGAAGTCAGTGGTGGCGCTGGCCCACAAGATGCTGCGCACCATCTACGCCATGCTCAGCAACGCAAGCCACTACCAGGACAAGGAGGTCGATTACGAGGCGCTGAACGTTCAGCGCAACGCGCCGCGCTG	NA	NA	NA	NA
>prophage 6
NZ_CP053553	Diaphorobacter sp. JS3050 chromosome, complete genome	3983118	3446055	3516887	3983118	protease,tRNA,integrase,holin,transposase	Erwinia_phage(11.11%)	56	3436793:3436811	3483326:3483344
3436793:3436811	attL	CAGCGCCAGCGCAGCCAGG	NA	NA	NA	NA
WP_088888335.1|3446055_3447396_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A191ZC11	Erwinia_phage	29.0	1.3e-42
WP_015914271.1|3447491_3448037_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_172208520.1|3448130_3449939_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_172208529.1|3449992_3450484_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_103737188.1|3450861_3451971_-	GTP-binding protein	NA	NA	NA	NA	NA
WP_172208531.1|3452078_3453266_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_172208541.1|3454680_3455652_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2D1G8E2	Mycobacterium_phage	27.3	9.9e-11
WP_011806781.1|3455751_3456444_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_088888328.1|3456440_3457319_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_015914278.1|3457513_3457711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011806784.1|3457793_3457994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172208543.1|3459728_3460529_+	RNA-binding protein	NA	NA	NA	NA	NA
WP_172208553.1|3460710_3462504_+	sterol desaturase family protein	NA	NA	NA	NA	NA
WP_011806788.1|3462508_3463579_-	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.9	2.1e-06
WP_172208555.1|3463801_3464440_+	DUF2760 domain-containing protein	NA	NA	NA	NA	NA
WP_172208557.1|3464448_3466359_+	Hsp70 family protein	NA	NA	NA	NA	NA
WP_172208559.1|3466369_3466963_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_172208561.1|3466967_3469838_+	hsp70 family protein	NA	A0A2H4UU19	Bodo_saltans_virus	28.2	2.0e-06
WP_005801445.1|3470128_3471208_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_172208563.1|3472773_3473346_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_011806796.1|3474420_3474879_+	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_011806797.1|3475054_3475831_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_172208565.1|3475857_3477267_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	30.6	3.5e-49
WP_011806799.1|3477276_3477741_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_012655522.1|3477737_3478697_-	cation transporter	NA	NA	NA	NA	NA
WP_172209374.1|3478860_3480918_+	EAL domain-containing protein	NA	A0A127AWB9	Bacillus_phage	34.2	7.7e-13
WP_012655520.1|3480979_3482461_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_172208567.1|3482533_3483793_-	MgtC/SapB family protein	NA	NA	NA	NA	NA
3483326:3483344	attR	CAGCGCCAGCGCAGCCAGG	NA	NA	NA	NA
WP_172208578.1|3483962_3484904_+	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	25.4	4.1e-14
WP_011806805.1|3484905_3485715_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_011806807.1|3487574_3488006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172208580.1|3488002_3488722_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172208582.1|3488897_3490493_-|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.2	2.1e-58
WP_172208584.1|3490605_3491454_+	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_172208586.1|3491474_3492275_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_047349375.1|3492741_3494001_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_172208588.1|3494059_3495184_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_015914283.1|3495640_3495811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011806815.1|3496054_3496972_+	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	53.0	5.9e-82
WP_172208590.1|3497177_3497948_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_172208592.1|3497947_3499165_+	cardiolipin synthase ClsB	NA	NA	NA	NA	NA
WP_172208594.1|3499173_3500226_+	UPF0104 family protein	NA	NA	NA	NA	NA
WP_172208596.1|3500328_3502110_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_135148239.1|3502638_3503571_-	electron transfer flavoprotein subunit alpha/FixB family protein	NA	NA	NA	NA	NA
WP_011806822.1|3503592_3504342_-	electron transfer flavoprotein subunit beta/FixA family protein	NA	NA	NA	NA	NA
WP_011806823.1|3504363_3505338_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_011806824.1|3505349_3506345_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_011806825.1|3506415_3507651_-	CoA transferase	NA	NA	NA	NA	NA
WP_172208598.1|3507686_3508517_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_172208600.1|3508629_3509760_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_172208602.1|3509785_3510997_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_011806829.1|3511007_3512207_-	acetyl-CoA C-acyltransferase	NA	NA	NA	NA	NA
WP_172208604.1|3512349_3514467_-	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_011806831.1|3514599_3515538_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011806832.1|3515551_3515914_-	YXWGXW repeat-containing protein	NA	NA	NA	NA	NA
WP_047350709.1|3516008_3516887_-|protease	protease HtpX	protease	NA	NA	NA	NA
