The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053585	Salmonella enterica strain 2011K-1440 chromosome, complete genome	4888815	674685	683252	4888815	tRNA	Enterobacteria_phage(66.67%)	9	NA	NA
WP_046094572.1|674685_676719_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	2.8e-55
WP_000703140.1|676959_677418_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	74.5	8.9e-55
WP_000950419.1|677569_678040_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	90.4	8.0e-75
WP_000598637.1|678086_678806_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_046094571.1|678802_680488_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	90.4	8.4e-276
WP_058115173.1|680710_681442_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	87.9	4.5e-101
WP_001261696.1|681501_681609_+	protein YohO	NA	NA	NA	NA	NA
WP_079819865.1|681589_682321_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569171.1|682304_683252_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	2.9e-23
>prophage 2
NZ_CP053585	Salmonella enterica strain 2011K-1440 chromosome, complete genome	4888815	1146529	1255432	4888815	terminase,tail,tRNA,portal,plate,head,holin,protease,integrase,capsid	Salmonella_phage(39.68%)	103	1151365:1151383	1249016:1249034
WP_046094671.1|1146529_1147267_-|tRNA	tRNA(1)(Val) (adenine(37)-N(6))-methyltransferase TrmN	tRNA	NA	NA	NA	NA
WP_023179695.1|1147396_1148731_+	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	1.6e-43
WP_000627811.1|1148845_1149229_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_023179696.1|1149547_1150237_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.5	2.1e-55
WP_000997357.1|1150351_1151389_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
1151365:1151383	attL	TTTTGTTTTTTAATTCATC	NA	NA	NA	NA
WP_001098732.1|1151592_1152012_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	40.6	1.2e-16
WP_023179697.1|1152084_1152783_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_023179698.1|1152819_1155480_+	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000949283.1|1155594_1156950_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001264472.1|1156994_1157318_+	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000807813.1|1157314_1158616_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	2.6e-43
WP_000985656.1|1158719_1159175_-	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	1.7e-34
WP_001235089.1|1164997_1167571_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.4	9.9e-127
WP_079797865.1|1167700_1168432_-	polyphenol oxidase	NA	NA	NA	NA	NA
WP_000079130.1|1168428_1169409_-	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000197658.1|1169540_1170278_+	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000178449.1|1170549_1170888_+	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_102025861.1|1170991_1171039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000200077.1|1171138_1172299_+	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_171804075.1|1172259_1173168_-	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_023180626.1|1173225_1174347_-	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001168062.1|1174356_1175427_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
WP_001212370.1|1175867_1176386_+	YfiR family protein	NA	NA	NA	NA	NA
WP_023180625.1|1176378_1177599_+	diguanylate cyclase DgcN	NA	A0A2K8I9Y5	Pseudomonas_phage	37.0	1.7e-07
WP_000065257.1|1177754_1178102_-	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000469804.1|1178142_1178910_-|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_001804459.1|1178954_1179503_-	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000256453.1|1179521_1179770_-	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000460057.1|1180111_1181473_-	signal recognition particle protein	NA	NA	NA	NA	NA
WP_001664422.1|1181638_1182430_+	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_127624524.1|1182449_1183736_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_023180624.1|1183796_1184390_-	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001059148.1|1184513_1185392_+	NAD(+) kinase	NA	NA	NA	NA	NA
WP_000880970.1|1185477_1187139_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001203442.1|1187287_1187626_+	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001112980.1|1187791_1188082_-	RnfH family protein	NA	NA	NA	NA	NA
WP_000242604.1|1188071_1188548_-	type II toxin-antitoxin system RatA family toxin	NA	NA	NA	NA	NA
WP_001518569.1|1188697_1189180_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
WP_171804076.1|1189798_1201273_+	biofilm-associated protein BapA	NA	NA	NA	NA	NA
WP_046093957.1|1201337_1202747_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_079819533.1|1202743_1204924_+	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.5	5.8e-19
WP_072157448.1|1204931_1206095_+	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_001072751.1|1206696_1207617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000143151.1|1207943_1208513_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	84.7	6.5e-87
WP_171804077.1|1208502_1209327_-	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	93.1	6.6e-149
WP_171804078.1|1209323_1210499_-|tail	tail fiber protein	tail	Q8HAB4	Salmonella_phage	93.1	1.1e-48
WP_171804079.1|1210485_1211073_-	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	98.5	2.4e-113
WP_000785578.1|1211075_1212155_-|plate	baseplate J/gp47 family protein	plate	A0A192Y6E4	Salmonella_phage	100.0	2.9e-205
WP_080078793.1|1212147_1212561_-	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	99.3	4.1e-75
WP_171804080.1|1212565_1213099_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	98.9	2.7e-95
WP_001066630.1|1213098_1214157_-|plate	baseplate protein	plate	A0A192Y7L7	Salmonella_phage	100.0	1.3e-202
WP_080212006.1|1214153_1215494_-	DNA circularization N-terminal domain-containing protein	NA	A0A192Y5U9	Salmonella_phage	99.3	2.2e-250
WP_171804081.1|1215527_1217456_-|tail	phage tail tape measure protein	tail	A0A192Y6D8	Salmonella_phage	98.9	0.0e+00
WP_000588852.1|1217540_1217867_-|tail	phage tail assembly protein	tail	Q8HAC3	Salmonella_phage	99.1	2.3e-52
WP_000515952.1|1217863_1218220_-|tail	phage tail tube protein	tail	A0A192Y8K0	Salmonella_phage	100.0	2.6e-62
WP_171804082.1|1218219_1219716_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A192Y7L1	Salmonella_phage	99.4	8.8e-277
WP_000497739.1|1219705_1219870_-	DUF2635 domain-containing protein	NA	Q8HAC6	Salmonella_phage	100.0	1.0e-24
WP_000779215.1|1219873_1220434_-	hypothetical protein	NA	A0A192Y5U4	Salmonella_phage	99.5	3.0e-105
WP_001822325.1|1220430_1220943_-	hypothetical protein	NA	Q8HAC8	Salmonella_phage	99.4	1.0e-91
WP_000776846.1|1220914_1221319_-|head	phage head closure protein	head	A0A192Y6C2	Salmonella_phage	98.5	2.7e-71
WP_171804083.1|1221315_1221639_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	72.9	8.8e-41
WP_171804084.1|1221718_1222948_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	90.9	1.8e-206
WP_000003793.1|1222957_1223560_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	91.5	2.0e-99
WP_171804689.1|1223552_1224647_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	82.7	1.5e-180
WP_000838395.1|1224763_1224922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171804085.1|1224918_1226649_-|terminase	terminase large subunit	terminase	Q8W631	Enterobacteria_phage	58.9	1.9e-198
WP_079810074.1|1226648_1227086_-|terminase	phage terminase small subunit P27 family	terminase	A0A1J0GV10	Halomonas_phage	62.8	4.6e-32
WP_171804086.1|1227231_1227582_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	94.0	2.6e-62
WP_171804087.1|1227628_1228135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079810071.1|1228291_1228726_-	DUF2570 domain-containing protein	NA	U5P0U9	Shigella_phage	84.5	2.4e-49
WP_171804088.1|1228709_1229186_-	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	95.6	3.3e-84
WP_023219695.1|1229189_1229525_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	95.5	7.7e-56
WP_171804089.1|1229821_1231153_+	NTPase	NA	R9TRQ8	Vibrio_phage	29.0	3.2e-20
WP_010989045.1|1231181_1231550_-	antitermination protein Q	NA	A5LH77	Enterobacteria_phage	81.7	7.4e-52
WP_171804090.1|1231564_1232554_-	DUF968 domain-containing protein	NA	A0A1C9IHZ5	Salmonella_phage	98.2	3.4e-192
WP_023233162.1|1232561_1233422_-	KilA-N domain-containing protein	NA	A0A192Y6F8	Salmonella_phage	99.3	9.2e-162
WP_171804091.1|1233438_1233828_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A192Y8N5	Salmonella_phage	86.8	1.2e-60
WP_171804092.1|1233824_1234478_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	88.9	5.4e-114
WP_171804093.1|1234477_1234960_-	PerC family transcriptional regulator	NA	Q8HA95	Salmonella_phage	97.5	1.1e-84
WP_171804094.1|1234961_1235906_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	86.3	9.3e-131
WP_000620702.1|1235902_1236127_-	hypothetical protein	NA	A0A1C9II64	Salmonella_phage	100.0	3.3e-39
WP_171804095.1|1236123_1237281_-	Rha family transcriptional regulator	NA	Q8HA97	Salmonella_phage	98.2	1.7e-214
WP_000509731.1|1237277_1237832_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	100.0	6.9e-102
WP_001191666.1|1237860_1238085_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	100.0	1.9e-34
WP_171804096.1|1238182_1238875_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	97.0	2.6e-122
WP_171804097.1|1239175_1239451_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	3.7e-48
WP_171804098.1|1240127_1240652_+	5'-deoxynucleotidase	NA	A5LH62	Enterobacteria_phage	96.5	6.6e-94
WP_171804099.1|1240759_1241626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171804100.1|1241667_1241874_+	excisionase	NA	I6PBM8	Cronobacter_phage	68.8	6.9e-23
WP_023262054.1|1241834_1243001_+|integrase	site-specific integrase	integrase	I6PDJ1	Cronobacter_phage	66.7	1.3e-145
WP_171804690.1|1243058_1244792_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_023262056.1|1244871_1245753_+	DNA adenine methylase	NA	A0A0C5AMX6	Cyanophage	22.5	2.7e-07
WP_171804101.1|1246061_1247273_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	49.9	4.9e-108
WP_046093961.1|1247637_1248432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077918899.1|1248442_1249093_+	hypothetical protein	NA	NA	NA	NA	NA
1249016:1249034	attR	GATGAATTAAAAAACAAAA	NA	NA	NA	NA
WP_171804102.1|1249625_1250192_-	phage polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	63.8	2.0e-56
WP_000984210.1|1250208_1250454_-	ogr/Delta-like zinc finger family protein	NA	Q7M294	Enterobacteria_phage	76.5	1.4e-30
WP_171804103.1|1250450_1251188_-	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	65.3	5.3e-81
WP_171804104.1|1251728_1251995_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	70.1	1.7e-29
WP_015701354.1|1251991_1252543_+	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	70.4	1.1e-30
WP_111762988.1|1252539_1252767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070794176.1|1252763_1253084_+	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_111762987.1|1253098_1255432_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	84.4	0.0e+00
>prophage 3
NZ_CP053585	Salmonella enterica strain 2011K-1440 chromosome, complete genome	4888815	2698373	2819797	4888815	tRNA,transposase,plate,tail	Burkholderia_phage(26.67%)	102	NA	NA
WP_171804306.1|2698373_2699474_-|tRNA	tRNA (uridine(54)-C5)-methyltransferase TrmA	tRNA	NA	NA	NA	NA
WP_171804307.1|2699846_2701691_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.7	2.2e-11
WP_000201802.1|2701635_2702487_+	glutamate racemase	NA	NA	NA	NA	NA
WP_171804308.1|2708473_2709502_+	UDP-N-acetylmuramate dehydrogenase	NA	NA	NA	NA	NA
WP_000655746.1|2709498_2710461_+	bifunctional biotin--[acetyl-CoA-carboxylase] ligase/biotin operon repressor BirA	NA	NA	NA	NA	NA
WP_000023068.1|2710494_2711445_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.5	7.9e-29
WP_042774188.1|2711653_2711827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000031748.1|2712403_2713588_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
WP_001275691.1|2713817_2714201_+	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001287521.1|2714202_2714748_+	transcription termination/antitermination protein NusG	NA	NA	NA	NA	NA
WP_001085926.1|2714905_2715334_+	50S ribosomal protein L11	NA	NA	NA	NA	NA
WP_001096676.1|2715337_2716042_+	50S ribosomal protein L1	NA	NA	NA	NA	NA
WP_001207203.1|2716539_2717037_+	50S ribosomal protein L10	NA	NA	NA	NA	NA
WP_000028879.1|2717103_2717469_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_023177979.1|2717786_2721815_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_023177981.1|2721891_2726115_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.9	5.0e-67
WP_171804309.1|2726431_2727577_-	2-iminoacetate synthase ThiH	NA	NA	NA	NA	NA
WP_127174942.1|2727573_2728344_-	thiazole synthase	NA	NA	NA	NA	NA
WP_001166837.1|2728345_2728546_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_171804310.1|2728526_2729285_-	HesA/MoeB/ThiF family protein	NA	NA	NA	NA	NA
WP_023177990.1|2729277_2729913_-	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_000108286.1|2729912_2731808_-	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_046094537.1|2732172_2732661_-	sigma D regulator	NA	NA	NA	NA	NA
WP_058115318.1|2732753_2733527_+	NAD(+) diphosphatase	NA	NA	NA	NA	NA
WP_000137630.1|2733567_2734632_+	uroporphyrinogen decarboxylase	NA	NA	NA	NA	NA
WP_171804311.1|2734641_2735313_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	4.7e-20
WP_079815422.1|2735354_2735945_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044509.1|2736131_2736404_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
WP_171804312.1|2736415_2737108_+	DUF1481 domain-containing protein	NA	NA	NA	NA	NA
WP_000828129.1|2737149_2737605_-	zinc resistance sensor/chaperone ZraP	NA	NA	NA	NA	NA
WP_058115317.1|2737857_2739255_+	two-component system sensor histidine kinase ZraS	NA	NA	NA	NA	NA
WP_079974370.1|2739260_2740586_+	sigma-54-dependent response regulator transcription factor ZraR	NA	NA	NA	NA	NA
WP_171804313.1|2740582_2741872_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_111761122.1|2741883_2743473_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.4	1.2e-66
WP_079806703.1|2749515_2749953_-	acetyltransferase	NA	NA	NA	NA	NA
WP_001122768.1|2750109_2751039_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_171804700.1|2751307_2752909_+	malate synthase A	NA	NA	NA	NA	NA
WP_000857887.1|2752940_2754245_+	isocitrate lyase	NA	NA	NA	NA	NA
WP_094300521.1|2754347_2756099_+	bifunctional isocitrate dehydrogenase kinase/phosphatase	NA	NA	NA	NA	NA
WP_077907418.1|2756062_2756470_-	ASCH domain-containing protein	NA	NA	NA	NA	NA
WP_000226429.1|2756480_2757305_-	glyoxylate bypass operon transcriptional repressor IclR	NA	NA	NA	NA	NA
WP_171804314.1|2757597_2761281_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.7e-26
WP_000956808.1|2761547_2763179_+	Na/Pi cotransporter family protein	NA	NA	NA	NA	NA
WP_000421774.1|2763268_2763958_-	dipeptidase PepE	NA	NA	NA	NA	NA
WP_001096722.1|2764167_2764707_+	DUF2058 domain-containing protein	NA	NA	NA	NA	NA
WP_171804315.1|2764753_2765623_+	23S rRNA pseudouridine(2604) synthase RluF	NA	NA	NA	NA	NA
WP_001207628.1|2765619_2765892_-	DUF3811 domain-containing protein	NA	NA	NA	NA	NA
WP_171804316.1|2765954_2766713_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000924641.1|2766699_2767563_-	Cof-type HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_111761117.1|2767579_2768419_-	histidine biosynthesis protein	NA	NA	NA	NA	NA
WP_171804317.1|2768442_2770032_-	PTS sugar transporter	NA	NA	NA	NA	NA
WP_000587746.1|2770418_2771147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171804318.1|2771637_2772153_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	35.0	3.0e-27
WP_079819094.1|2772165_2773311_-|tail	phage tail protein	tail	A0A0M3ULH6	Salmonella_phage	42.4	1.4e-51
WP_023177433.1|2773313_2773946_-|tail	phage tail protein I	tail	Q6QI98	Burkholderia_phage	54.9	1.6e-22
WP_046094681.1|2773938_2775054_-|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	51.4	2.2e-99
WP_171804319.1|2775044_2775404_-	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	63.3	4.0e-34
WP_171804320.1|2775501_2776224_-|plate	phage baseplate assembly protein V	plate	A0A067ZIM2	Vibrio_phage	42.0	3.9e-12
WP_094300515.1|2776233_2777274_-	phage late control D family protein	NA	A4JWL3	Burkholderia_virus	45.6	2.3e-74
WP_023177426.1|2777261_2777471_-|tail	tail protein X	tail	A4JWL2	Burkholderia_virus	60.3	9.8e-17
WP_171804321.1|2777470_2778424_-|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	53.8	1.4e-38
WP_171804322.1|2778423_2780709_-|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	28.8	1.2e-67
WP_001185654.1|2780802_2780931_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_000192467.1|2780890_2781208_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_000907500.1|2781259_2781784_-|tail	phage major tail tube protein	tail	Q6QIA9	Burkholderia_phage	69.0	4.0e-67
WP_058114098.1|2781783_2783199_-|tail	phage tail sheath family protein	tail	A4JWK5	Burkholderia_virus	69.5	6.3e-184
WP_000875312.1|2783188_2783386_-	hypothetical protein	NA	Q6QIB1	Burkholderia_phage	52.9	5.1e-07
WP_000449431.1|2783382_2783838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000777268.1|2783997_2784312_-	hypothetical protein	NA	Q6QIC4	Burkholderia_phage	49.1	4.9e-20
WP_171804323.1|2784324_2784930_-	lytic transglycosylase domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	57.2	4.3e-57
WP_046094675.1|2784932_2785220_-	membrane protein	NA	Q6QIC8	Burkholderia_phage	48.1	2.3e-16
WP_000615248.1|2785795_2786143_+	DNA-binding protein	NA	Q6QIE8	Burkholderia_phage	51.5	4.9e-21
WP_171804324.1|2786277_2787627_-	lysine-sensitive aspartokinase 3	NA	NA	NA	NA	NA
WP_000790021.1|2788015_2789665_+	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_001541297.1|2790108_2790351_+	outer membrane protein	NA	NA	NA	NA	NA
WP_164730236.1|2790384_2791053_+	YjbF family lipoprotein	NA	NA	NA	NA	NA
WP_079819515.1|2791049_2791787_+	capsule biosynthesis GfcC family protein	NA	NA	NA	NA	NA
WP_046094307.1|2791786_2793883_+	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_000987348.1|2794024_2794435_+	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_001097247.1|2794480_2795956_-	D-xylose transporter XylE	NA	NA	NA	NA	NA
WP_001252081.1|2796299_2797190_-	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_079819512.1|2797204_2798749_-	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
WP_000695408.1|2798934_2800125_-	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_000179169.1|2800486_2801596_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
WP_023177402.1|2801683_2803042_+	maltoporin	NA	NA	NA	NA	NA
WP_000782501.1|2803205_2804123_+	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000019223.1|2804303_2804801_+	chorismate lyase	NA	NA	NA	NA	NA
WP_000455243.1|2804814_2805687_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_000017365.1|2805797_2808218_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000002902.1|2808388_2808757_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000646079.1|2808865_2809474_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_171804325.1|2809652_2810978_+	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000227093.1|2810959_2811088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001030592.1|2811109_2811319_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000416274.1|2811417_2811933_-	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_171804326.1|2812179_2813490_+	conjugal transfer protein TraF	NA	NA	NA	NA	NA
WP_023177390.1|2813577_2814576_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000891414.1|2814743_2814986_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_023177388.1|2815160_2816144_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918353.1|2816208_2817624_+	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
WP_001147305.1|2817655_2818735_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.3	3.1e-29
WP_171804327.1|2818810_2819797_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP053585	Salmonella enterica strain 2011K-1440 chromosome, complete genome	4888815	3359561	3378729	4888815	bacteriocin,transposase	Saccharomonospora_phage(33.33%)	21	NA	NA
WP_171804398.1|3359561_3360002_-|transposase	IS200/IS605-like element ISSen6 family transposase	transposase	I4AZM1	Saccharomonospora_phage	53.6	2.7e-32
WP_023179822.1|3361377_3362319_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001286421.1|3362315_3362507_-	DNA gyrase inhibitor YacG	NA	NA	NA	NA	NA
WP_023179821.1|3362516_3363260_-	cell division protein ZapD	NA	NA	NA	NA	NA
WP_001270912.1|3363259_3363880_-	dephospho-CoA kinase	NA	NA	NA	NA	NA
WP_023179820.1|3364105_3365149_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	55.9	2.9e-101
WP_046094101.1|3365180_3366383_-	protein transport protein HofC	NA	NA	NA	NA	NA
WP_046094100.1|3366372_3367758_-	type II secretion system protein GspE	NA	NA	NA	NA	NA
WP_000414991.1|3367767_3368205_-	prepilin peptidase-dependent pilin	NA	NA	NA	NA	NA
WP_001135140.1|3368426_3369320_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_115397604.1|3369407_3369971_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.0	2.6e-11
WP_000172034.1|3369967_3370822_+	beta-lactamase regulator AmpE	NA	NA	NA	NA	NA
WP_079797706.1|3370914_3371865_-	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_000357544.1|3371864_3373271_-	MFS transporter	NA	NA	NA	NA	NA
WP_088744785.1|3373434_3374808_-	aromatic amino acid transporter AroP	NA	NA	NA	NA	NA
WP_171804399.1|3375209_3376988_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_023179812.1|3376992_3377283_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_171804703.1|3377352_3377643_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_023177798.1|3377712_3378009_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_115397601.1|3378078_3378369_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_127175095.1|3378438_3378729_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
>prophage 5
NZ_CP053585	Salmonella enterica strain 2011K-1440 chromosome, complete genome	4888815	3519578	3619391	4888815	terminase,tail,transposase,portal,plate,head,holin,integrase,capsid	Enterobacteria_phage(28.12%)	104	3568196:3568241	3620620:3620665
WP_000246457.1|3519578_3520910_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_023177479.1|3520912_3521443_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000796976.1|3521439_3522729_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000509053.1|3522753_3523842_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_171804416.1|3523805_3525659_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_023177469.1|3525663_3526080_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000056998.1|3526076_3527549_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000031250.1|3527832_3528336_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001142956.1|3528964_3529483_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000103454.1|3529700_3531839_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	7.0e-25
WP_171804417.1|3531963_3536472_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	34.5	3.9e-25
WP_023180784.1|3536471_3536849_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077910333.1|3537106_3537511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171804418.1|3539152_3543478_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.1	3.8e-22
WP_079806395.1|3543474_3544047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171804419.1|3544843_3545134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157196175.1|3545192_3545348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000467855.1|3545437_3545707_+	BPSL0067 family protein	NA	NA	NA	NA	NA
WP_001187433.1|3545678_3546104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171804420.1|3546664_3547384_-	adhesin/invasin protein PagN	NA	NA	NA	NA	NA
WP_171804421.1|3547701_3550233_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_000714953.1|3550473_3550881_-	Spy/CpxP family protein refolding chaperone	NA	NA	NA	NA	NA
WP_000015784.1|3551042_3551810_-	amidohydrolase	NA	NA	NA	NA	NA
WP_000973031.1|3551918_3554363_-	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000284051.1|3554602_3555181_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	1.3e-13
WP_000333387.1|3555306_3556074_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225656.1|3556044_3556785_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001226208.1|3557035_3558091_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_079789973.1|3558434_3559574_+	RNA ligase RtcB family protein	NA	A0A222ZM82	Mycobacterium_phage	30.7	1.3e-30
WP_079818669.1|3559570_3560185_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_171804422.1|3560341_3561799_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001292018.1|3562047_3562506_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189587.1|3562594_3563839_+	esterase FrsA	NA	NA	NA	NA	NA
WP_171804423.1|3563896_3564298_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749852.1|3564350_3565403_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.7	1.0e-114
WP_001285278.1|3565685_3566789_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	39.8	6.9e-61
WP_171804424.1|3566799_3568050_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.5	6.8e-97
3568196:3568241	attL	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
WP_079815185.1|3568255_3569419_-|integrase	site-specific integrase	integrase	G8C7S0	Escherichia_phage	67.1	1.4e-152
WP_111770500.1|3569684_3569924_-	DUF4060 family protein	NA	S4TR31	Salmonella_phage	98.7	5.7e-37
WP_171804425.1|3569966_3571076_-	recombinase RecT	NA	A0A2I7RQF1	Vibrio_phage	42.6	6.5e-59
WP_171804426.1|3571087_3574000_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	76.2	0.0e+00
WP_171804427.1|3574126_3574477_-	DNA breaking-rejoining protein	NA	S4TSN6	Salmonella_phage	96.6	9.2e-60
WP_079773333.1|3574498_3574657_-	hypothetical protein	NA	H6WRX3	Salmonella_phage	98.1	9.0e-23
WP_151336281.1|3574769_3574994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171804428.1|3575287_3575494_+	hypothetical protein	NA	K7P7I0	Enterobacteria_phage	64.7	2.4e-15
WP_111760015.1|3575616_3576819_-|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.0	1.3e-76
WP_171804429.1|3577870_3578338_-	helix-turn-helix domain-containing protein	NA	K7PHG0	Enterobacteria_phage	87.1	6.5e-69
WP_171804430.1|3578351_3578579_+	helix-turn-helix domain-containing protein	NA	K7PKS2	Enterobacteria_phage	95.9	1.5e-34
WP_072143007.1|3578544_3578919_+	hypothetical protein	NA	S4TTD7	Salmonella_phage	97.6	2.8e-62
WP_001191966.1|3579193_3580255_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	83.1	1.1e-36
WP_000800012.1|3580257_3581007_+	ATP-binding protein	NA	S4TNF5	Salmonella_phage	100.0	4.3e-139
WP_171804431.1|3581017_3581365_+	DUF977 family protein	NA	H6WRX9	Salmonella_phage	97.4	1.5e-57
WP_079815188.1|3581361_3581757_+	hypothetical protein	NA	H6WRY0	Salmonella_phage	81.5	2.4e-48
WP_000224241.1|3581759_3582017_+	hypothetical protein	NA	A0A192Y5W0	Salmonella_phage	100.0	1.3e-42
WP_171804704.1|3582525_3583191_+	DUF550 domain-containing protein	NA	A0A192Y7X3	Salmonella_phage	49.1	1.7e-38
WP_023249898.1|3583286_3583613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171804705.1|3583612_3583855_+	DNA polymerase III subunit theta	NA	Q71T70	Escherichia_phage	77.3	6.6e-25
WP_111760015.1|3584005_3585208_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	71.0	1.3e-76
WP_154023501.1|3585573_3585807_+	DinI-like family protein	NA	H6WRY5	Salmonella_phage	97.4	3.6e-36
WP_014343878.1|3585923_3586172_+	hypothetical protein	NA	A0A0U2C0C8	Salmonella_phage	100.0	1.6e-42
WP_171804432.1|3586206_3586806_+	DUF1367 family protein	NA	H6WRY7	Salmonella_phage	99.0	9.1e-108
WP_079820395.1|3586805_3587012_+	hypothetical protein	NA	H6WRY8	Salmonella_phage	89.4	9.9e-30
WP_079815192.1|3587014_3587656_+	recombination protein NinG	NA	S4TSR3	Salmonella_phage	98.1	3.1e-114
WP_000801757.1|3587652_3587793_+	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	78.9	7.2e-08
WP_171804433.1|3587789_3588470_+	antiterminator	NA	I6PDF8	Cronobacter_phage	52.9	6.2e-60
WP_079815193.1|3588740_3589055_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	69.2	1.5e-32
WP_058114795.1|3589317_3589878_+	ORF6N domain-containing protein	NA	A0A0P0ZDQ5	Stx2-converting_phage	86.3	2.0e-56
WP_000508330.1|3590032_3590251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001534733.1|3590426_3590552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798709.1|3590688_3591138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000988276.1|3591663_3591858_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024136787.1|3591844_3592096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000658039.1|3592383_3592572_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001803642.1|3592661_3593051_+|holin	phage holin family protein	holin	K7PHB9	Enterobacterial_phage	71.8	1.8e-40
WP_021000643.1|3593037_3593319_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	80.6	2.6e-36
WP_171804434.1|3593318_3593933_+	glycoside hydrolase family 19 protein	NA	Q8HA86	Salmonella_phage	82.4	2.6e-94
WP_171804435.1|3593929_3594472_+	DUF2514 family protein	NA	A0A291AXG6	Shigella_phage	26.3	4.5e-05
WP_171804436.1|3594574_3595078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171804437.1|3595336_3595882_+|terminase	terminase small subunit	terminase	A0A0U2S671	Escherichia_phage	80.6	8.7e-57
WP_171804438.1|3595853_3597785_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	8.2e-259
WP_000201415.1|3597768_3597972_+	gpW family protein	NA	K7PM10	Enterobacteria_phage	73.8	1.9e-17
WP_171804439.1|3597968_3599549_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	62.4	4.7e-188
WP_171804440.1|3599538_3601035_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	52.7	7.4e-98
WP_000011258.1|3601047_3601395_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	53.8	4.1e-20
WP_000522566.1|3601449_3602478_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.1	1.7e-114
WP_171804441.1|3602535_3602895_+	DNA packaging protein	NA	NA	NA	NA	NA
WP_171804442.1|3602905_3603265_+|tail	phage tail protein	tail	K7P6U9	Enterobacteria_phage	68.4	7.0e-39
WP_127174396.1|3603268_3603853_+|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	78.1	2.4e-76
WP_171804443.1|3603849_3604251_+|tail	phage tail protein	tail	A0A291AWY2	Escherichia_phage	69.7	4.0e-51
WP_171804444.1|3604261_3605005_+|tail	phage tail protein	tail	A0A291AWU6	Escherichia_phage	72.9	3.8e-95
WP_171804445.1|3605050_3605446_+|tail	phage minor tail protein G	tail	A5LH36	Enterobacteria_phage	56.2	8.6e-30
WP_127174392.1|3605463_3605781_+|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	64.2	7.3e-32
WP_171804446.1|3605752_3608902_+|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	52.9	4.0e-263
WP_171804447.1|3608911_3609241_+|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	72.2	1.6e-42
WP_171804448.1|3609249_3609945_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	72.3	1.4e-96
WP_171804449.1|3610003_3610738_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	74.9	5.7e-112
WP_171804450.1|3610635_3611277_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	70.7	9.5e-79
WP_171804451.1|3611340_3611865_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	94.8	3.6e-92
WP_171804452.1|3612010_3615406_+	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	70.0	0.0e+00
WP_171804453.1|3615448_3616042_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q687E6	Enterobacteria_phage	60.0	2.7e-27
WP_171804454.1|3616038_3616341_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171804455.1|3616343_3617702_+	SGNH/GDSL hydrolase family protein	NA	A0A223LJ40	Erwinia_phage	54.8	1.5e-129
WP_171804456.1|3617767_3619165_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	61.2	5.7e-60
WP_171804457.1|3619151_3619391_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	61.4	8.6e-17
3620620:3620665	attR	ATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCA	NA	NA	NA	NA
>prophage 6
NZ_CP053585	Salmonella enterica strain 2011K-1440 chromosome, complete genome	4888815	4096517	4104645	4888815	integrase	Enterobacteria_phage(33.33%)	11	4100915:4100929	4114084:4114098
WP_079820137.1|4096517_4097993_-	molybdate ABC transporter ATP-binding protein ModF	NA	W5SAS9	Pithovirus	31.3	5.7e-10
WP_001147421.1|4098060_4098849_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891513.1|4098977_4099127_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_079796999.1|4099292_4100066_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604021.1|4100065_4100755_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_079797000.1|4100757_4101816_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.3	2.3e-21
4100915:4100929	attL	GACGCATTGCGCTGA	NA	NA	NA	NA
WP_079818356.1|4101816_4102635_-	pyridoxal phosphatase	NA	NA	NA	NA	NA
WP_079820135.1|4102877_4103924_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	K7PHK0	Enterobacteria_phage	42.8	2.3e-74
WP_079820133.1|4103898_4104147_-	hypothetical protein	NA	A0A1V0E5M4	Salmonella_phage	53.2	1.6e-13
WP_079820131.1|4104212_4104455_-	DUF4060 family protein	NA	K7PHF4	Enterobacteria_phage	83.5	2.0e-29
WP_079820129.1|4104441_4104645_-	hypothetical protein	NA	A0A1B0VN94	Pseudomonas_phage	66.7	1.7e-10
4114084:4114098	attR	GACGCATTGCGCTGA	NA	NA	NA	NA
>prophage 7
NZ_CP053585	Salmonella enterica strain 2011K-1440 chromosome, complete genome	4888815	4797298	4805142	4888815		Salmonella_phage(33.33%)	14	NA	NA
WP_171804650.1|4797298_4798819_+	hypothetical protein	NA	W6ATR9	Escherichia_phage	37.7	2.4e-48
WP_171804651.1|4798815_4799493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171804652.1|4799707_4800472_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023201955.1|4800658_4801264_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	33.3	6.1e-19
WP_171804653.1|4801385_4801619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171804654.1|4801608_4801920_+	hypothetical protein	NA	A0A0H5ARP9	Pseudomonas_phage	51.6	8.0e-15
WP_171804655.1|4802139_4802592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171804656.1|4802542_4802962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171804657.1|4802997_4803165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171804658.1|4803509_4803824_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_171804659.1|4803820_4804024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171803944.1|4804056_4804305_+	hypothetical protein	NA	A0A0N7CG33	Salmonella_phage	84.1	2.2e-36
WP_171804660.1|4804657_4804885_+	hypothetical protein	NA	H6WRY2	Salmonella_phage	58.2	1.0e-11
WP_171804661.1|4804884_4805142_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	52.6	2.7e-16
