The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	0	13829	4505366	protease	Enterobacteria_phage(100.0%)	6	NA	NA
WP_000639891.1|1341_1584_+	YfdY family protein	NA	NA	NA	NA	NA
WP_038395055.1|4955_5894_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_000839652.1|10257_11436_+	SfnB family sulfur acquisition oxidoreductase	NA	NA	NA	NA	NA
WP_159421181.1|11549_11726_+	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_170243775.1|11729_11978_+	SidA/IucD/PvdA family monooxygenase	NA	NA	NA	NA	NA
WP_038395064.1|12887_13829_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	87.9	4.9e-148
>prophage 2
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	23009	24095	4505366		Pandoravirus(100.0%)	1	NA	NA
WP_038395086.1|23009_24095_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.5	2.0e-89
>prophage 3
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	30700	31486	4505366		Campylobacter_virus(50.0%)	2	NA	NA
WP_000118253.1|30700_31069_-	C40 family peptidase	NA	H6SUH4	Campylobacter_virus	37.9	3.9e-08
WP_000433428.1|31237_31486_-	transcriptional regulator	NA	A0A0M4UV99	Ralstonia_phage	58.6	3.1e-17
>prophage 4
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	34490	35627	4505366		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699185.1|34490_35627_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.5	1.5e-21
>prophage 5
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	41995	43513	4505366		Mollivirus(100.0%)	1	NA	NA
WP_000334202.1|41995_43513_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.2	2.2e-89
>prophage 6
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	54836	55610	4505366		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_024131805.1|54836_55610_+	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	29.1	5.1e-10
>prophage 7
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	59332	60352	4505366		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000026939.1|59332_60352_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	28.0	5.0e-21
>prophage 8
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	93439	94444	4505366		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000368548.1|93439_94444_-	chemotaxis protein CheV	NA	Q56AR1	Bacillus_thuringiensis_phage	25.5	1.3e-26
>prophage 9
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	106003	108127	4505366		Tupanvirus(50.0%)	2	NA	NA
WP_079798697.1|106003_107224_-	4-deoxy-4-formamido-L-arabinose- phosphoundecaprenol deformylase	NA	A0A2K9L470	Tupanvirus	28.5	4.0e-17
WP_000879144.1|107521_108127_+	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	43.8	5.6e-12
>prophage 10
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	117918	131953	4505366		Pseudomonas_phage(33.33%)	9	NA	NA
WP_079827548.1|117918_118989_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	6.6e-08
WP_079827549.1|119104_119983_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_079827550.1|120144_121335_+	MFS transporter	NA	NA	NA	NA	NA
WP_000533917.1|121336_121591_-	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	74.6	3.1e-25
WP_000332031.1|121590_122721_-	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	78.9	3.0e-176
WP_001076506.1|122833_125119_-	ribonucleoside-diphosphate reductase subunit alpha	NA	I3UMG3	Colwellia_phage	63.8	1.3e-284
WP_000990738.1|125476_126205_-	bifunctional 3-demethylubiquinone 3-O-methyltransferase/2-octaprenyl-6-hydroxy phenol methylase	NA	NA	NA	NA	NA
WP_171776188.1|126351_128988_+	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.8	4.3e-93
WP_000876061.1|129106_131953_+	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	26.1	4.6e-40
>prophage 11
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	136118	143253	4505366		Enterobacteria_phage(33.33%)	6	NA	NA
WP_038395195.1|136118_137255_+	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	58.8	6.6e-115
WP_000784317.1|137371_138424_+	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_079827551.1|138504_139566_+	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A167R6J9	Powai_lake_megavirus	59.3	7.4e-20
WP_058344856.1|139568_140219_+	DNA oxidative demethylase AlkB	NA	NA	NA	NA	NA
WP_038395202.1|140294_141989_+	multidrug ABC transporter permease/ATP-binding protein	NA	NA	NA	NA	NA
WP_001276996.1|142005_143253_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	49.3	1.1e-78
>prophage 12
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	150208	150829	4505366		Staphylococcus_phage(100.0%)	1	NA	NA
WP_038395206.1|150208_150829_+	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	4.7e-14
>prophage 13
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	157714	158200	4505366		Vibrio_phage(100.0%)	1	NA	NA
WP_171776191.1|157714_158200_+	glycoside hydrolase family protein	NA	H9C148	Vibrio_phage	39.7	1.2e-22
>prophage 14
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	186599	194309	4505366		Vibrio_phage(50.0%)	7	NA	NA
WP_038395234.1|186599_187607_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.3	6.9e-84
WP_000494189.1|187758_188043_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_080161301.1|188167_189928_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.6	6.4e-101
WP_001234843.1|190079_190775_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000213406.1|190802_191993_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	22.6	1.9e-19
WP_001094643.1|192371_192716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080161300.1|192719_194309_-	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	32.8	1.6e-18
>prophage 15
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	200233	200806	4505366		Clostridioides_phage(100.0%)	1	NA	NA
WP_000241015.1|200233_200806_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.9	8.1e-13
>prophage 16
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	206024	207596	4505366	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_080161318.1|206024_207596_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	37.4	3.9e-81
>prophage 17
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	217077	218346	4505366	integrase	Stenotrophomonas_phage(100.0%)	1	216408:216421	229061:229074
216408:216421	attL	GCGCGGCCTGAAGC	NA	NA	NA	NA
WP_058820014.1|217077_218346_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	3.7e-82
WP_058820014.1|217077_218346_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	40.7	3.7e-82
229061:229074	attR	GCGCGGCCTGAAGC	NA	NA	NA	NA
>prophage 18
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	247162	248824	4505366		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000919503.1|247162_248824_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	65.5	8.4e-10
>prophage 19
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	254581	255643	4505366		Acanthamoeba_polyphaga_lentillevirus(100.0%)	1	NA	NA
WP_000075412.1|254581_255643_+	SIS domain-containing protein	NA	J3IZE6	Acanthamoeba_polyphaga_lentillevirus	24.8	2.4e-10
>prophage 20
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	259362	260642	4505366		Shigella_phage(50.0%)	2	NA	NA
WP_000799920.1|259362_260100_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	51.7	3.1e-65
WP_000098571.1|260102_260642_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	65.6	1.3e-28
>prophage 21
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	265587	266652	4505366		Bacillus_virus(100.0%)	1	NA	NA
WP_024132026.1|265587_266652_-	GGDEF domain-containing protein	NA	G3MA91	Bacillus_virus	33.7	4.2e-15
>prophage 22
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	270453	273352	4505366		Streptococcus_phage(50.0%)	3	NA	NA
WP_000175971.1|270453_272043_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	25.2	5.3e-30
WP_000178959.1|272444_273062_+	molecular chaperone OsmY	NA	NA	NA	NA	NA
WP_000490276.1|273190_273352_+	DUF1328 domain-containing protein	NA	A0A0N7CBR2	Salmonella_phage	66.0	1.8e-10
>prophage 23
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	278954	280277	4505366		Geobacillus_virus(100.0%)	1	NA	NA
WP_038397025.1|278954_280277_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	40.5	4.0e-79
>prophage 24
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	286785	291913	4505366		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093828.1|286785_288018_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	45.5	2.6e-88
WP_024132022.1|288099_289767_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.2e-41
WP_000373259.1|289975_291913_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	36.4	8.8e-11
>prophage 25
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	306130	318294	4505366	holin	Cyanophage(20.0%)	10	NA	NA
WP_000130176.1|306130_307084_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.0	9.7e-11
WP_080160918.1|307592_308183_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_024132020.1|308265_308832_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_000516119.1|309938_311855_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	50.8	9.9e-148
WP_001119027.1|311940_313068_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	32.7	1.2e-28
WP_000534917.1|313347_314295_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000026885.1|314421_314766_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_058818986.1|314825_315359_-	glycoside hydrolase family 108 protein	NA	A0A0U2I1S0	Escherichia_phage	56.6	2.0e-53
WP_000844349.1|315375_315819_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_058344624.1|316209_318294_+	chitinase	NA	O41478	Choristoneura_fumiferana_nuclear_polyhedrosis_virus	28.3	4.9e-31
>prophage 26
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	336706	338200	4505366		Tetraselmis_virus(100.0%)	1	NA	NA
WP_058344630.1|336706_338200_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	30.3	7.0e-32
>prophage 27
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	342766	349437	4505366	tRNA	uncultured_Caudovirales_phage(50.0%)	6	NA	NA
WP_058344633.1|342766_343933_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	54.7	4.6e-87
WP_000116528.1|343994_344900_+	transcriptional activator NhaR	NA	NA	NA	NA	NA
WP_001518655.1|345027_345291_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_058344634.1|345393_345612_+	DUF2575 family protein	NA	NA	NA	NA	NA
WP_000767308.1|345619_346558_+	bifunctional riboflavin kinase/FAD synthetase	NA	NA	NA	NA	NA
WP_058344701.1|346602_349437_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	8.5e-79
>prophage 28
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	355806	356955	4505366		Halovirus(100.0%)	1	NA	NA
WP_000597266.1|355806_356955_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.7	2.2e-49
>prophage 29
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	362546	371051	4505366		Catovirus(33.33%)	6	NA	NA
WP_000066325.1|362546_364436_+	sulfatase-like hydrolase/transferase	NA	A0A1V0SA98	Catovirus	26.8	2.0e-28
WP_000004480.1|364516_365302_-	crotonobetainyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000355786.1|365416_366970_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	26.5	5.4e-35
WP_038396995.1|367038_368259_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347101.1|368359_369502_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_058344641.1|369533_371051_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	22.7	2.9e-09
>prophage 30
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	379329	380806	4505366		Bacillus_phage(50.0%)	2	NA	NA
WP_000624384.1|379329_379809_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	47.1	2.3e-29
WP_000257213.1|379957_380806_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A0E3T919	Enterococcus_phage	44.9	4.9e-06
>prophage 31
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	388507	393940	4505366		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001116961.1|388507_391414_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.1	2.2e-21
WP_080160914.1|391588_393940_-	DNA polymerase II	NA	A0A1B2RW58	Lymphocystis_disease_virus	25.8	5.0e-16
>prophage 32
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	401140	401842	4505366		Bacillus_virus(100.0%)	1	NA	NA
WP_080160912.1|401140_401842_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G3M9Y6	Bacillus_virus	36.7	9.0e-22
>prophage 33
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	410977	412549	4505366		Micromonas_sp._RCC1109_virus(100.0%)	1	NA	NA
WP_000082805.1|410977_412549_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	25.7	1.2e-05
>prophage 34
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	445905	446949	4505366		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217362.1|445905_446949_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.5	2.6e-102
>prophage 35
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	451205	451769	4505366		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923241.1|451205_451769_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	30.8	1.3e-10
>prophage 36
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	462836	464261	4505366		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102488.1|462836_464261_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.1	1.2e-41
>prophage 37
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	467869	468427	4505366		Enterobacteria_phage(100.0%)	1	NA	NA
WP_079827769.1|467869_468427_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	90.2	1.0e-84
>prophage 38
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	477405	481712	4505366		Enterobacteria_phage(50.0%)	2	NA	NA
WP_171776201.1|477405_478479_+	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	75.6	6.8e-146
WP_080161258.1|478634_481712_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	79.0	0.0e+00
>prophage 39
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	485198	491796	4505366		Mamastrovirus(33.33%)	5	NA	NA
WP_058344671.1|485198_486809_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	59.8	3.0e-20
WP_079835804.1|486886_489280_-	pyrroloquinoline quinone-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_000683337.1|489485_490022_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.8	6.0e-18
WP_012210524.1|490098_490761_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150647.1|490869_491796_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	33.6	9.1e-22
>prophage 40
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	497563	498982	4505366		Bacillus_virus(100.0%)	1	NA	NA
WP_038396934.1|497563_498982_-	polynucleotide adenylyltransferase PcnB	NA	G3MAR3	Bacillus_virus	35.9	2.4e-26
>prophage 41
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	502043	504473	4505366		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_058819650.1|502043_504473_+	ATP-dependent helicase HrpB	NA	A0A2H4UU36	Bodo_saltans_virus	28.0	1.2e-33
>prophage 42
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	509718	510516	4505366		Planktothrix_phage(100.0%)	1	NA	NA
WP_038396929.1|509718_510516_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	27.4	4.6e-14
>prophage 43
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	516429	516774	4505366		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001278668.1|516429_516774_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	50.5	1.0e-26
>prophage 44
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	520770	525519	4505366	protease	uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_024132001.1|520770_522198_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.2	5.5e-26
WP_000929413.1|522349_523507_+	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_000272195.1|523585_523972_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_038396925.1|524217_525519_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	31.1	1.0e-34
>prophage 45
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	535648	611727	4505366	protease,tRNA,plate,transposase	Flavobacterium_phage(10.0%)	61	NA	NA
WP_024132000.1|535648_536407_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	42.2	3.2e-25
WP_079827786.1|536419_537277_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_038396922.1|537288_538641_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240917.1|538672_541105_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758960.1|541227_541713_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_038396921.1|541716_542742_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210741.1|542847_543303_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565955.1|543306_544095_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000741211.1|544094_545243_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569408.1|545239_545836_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	39.8	5.1e-26
WP_038396920.1|545859_549342_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.8	1.4e-208
WP_000055758.1|549354_550314_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_079782007.1|550633_552397_+	chitinase	NA	NA	NA	NA	NA
WP_079827788.1|552472_554614_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_058344689.1|554669_555059_+	VOC family protein	NA	NA	NA	NA	NA
WP_079827790.1|555121_556420_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062327.1|556462_556723_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417061.1|556709_556910_-	YaeP family protein	NA	NA	NA	NA	NA
WP_079827792.1|557107_557653_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000560520.1|557649_558072_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_079799296.1|558103_558805_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_058344693.1|558879_560598_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_038396914.1|560708_561416_-|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001202365.1|561412_561817_-	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000874212.1|561935_562751_-	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001287480.1|562789_563443_-	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000593985.1|563435_564467_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.6	4.2e-36
WP_001140198.1|564656_565223_+	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_079781219.1|571246_572161_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230967.1|572401_573202_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_012210504.1|573981_575349_-	murein transglycosylase D	NA	A0A0A7NU10	Lactobacillus_phage	33.5	4.8e-11
WP_079781218.1|575420_576176_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000801246.1|576210_576933_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000917872.1|576929_577397_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.9	4.7e-51
WP_077905537.1|577460_578192_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.9	1.3e-39
WP_001293124.1|578543_579395_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_024131997.1|580470_580968_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_012210503.1|581002_582550_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_079828727.1|582568_583906_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001097692.1|583902_584553_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_171776202.1|584556_586281_+	OmpA family protein	NA	NA	NA	NA	NA
WP_038396876.1|586285_586777_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000152197.1|589602_590172_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065304584.1|590288_590630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103143138.1|590629_590857_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038396875.1|590934_593448_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_000528468.1|593492_595718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001046388.1|595723_596578_+	SUMF1/EgtB/PvdO family nonheme iron enzyme	NA	A0A7H6	Microcystis_virus	29.5	1.1e-13
WP_000033409.1|596607_596874_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_171776203.1|596877_598023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114064787.1|598099_599198_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.2	1.5e-47
WP_080161292.1|599236_602644_+	type VI secretion protein VasK	NA	NA	NA	NA	NA
WP_080161293.1|602643_604239_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_038396869.1|604269_605001_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077946362.1|605114_605594_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_080161294.1|605615_607379_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000553779.1|607333_608437_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_024131995.1|608417_608954_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000004546.1|608946_609399_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_080161295.1|610005_610404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038396866.1|610482_611727_+	GIY-YIG nuclease family protein	NA	Q9MC01	Enterobacteria_phage	63.0	5.8e-80
>prophage 46
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	619851	620430	4505366		Caulobacter_phage(100.0%)	1	NA	NA
WP_000284051.1|619851_620430_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	30.8	1.3e-13
>prophage 47
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	627555	632716	4505366	transposase	Streptococcus_phage(50.0%)	4	NA	NA
WP_038396854.1|627555_628608_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	58.7	3.9e-114
WP_038396853.1|628889_629993_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.1	6.9e-61
WP_080161297.1|630004_631255_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.2	2.6e-96
WP_114064787.1|631617_632716_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.2	1.5e-47
>prophage 48
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	647618	652559	4505366		Enterobacteria_phage(50.0%)	2	NA	NA
WP_079828038.1|647618_649577_+	site-specific DNA-methyltransferase	NA	Q1MVP0	Enterobacteria_phage	31.9	2.0e-79
WP_058819931.1|649589_652559_+	type III restriction-modification system endonuclease	NA	Q71TG1	Escherichia_phage	26.3	1.2e-83
>prophage 49
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	662449	667335	4505366		Staphylococcus_phage(50.0%)	3	NA	NA
WP_080152656.1|662449_664336_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	4.1e-53
WP_000130720.1|664462_665437_-	porphobilinogen synthase	NA	NA	NA	NA	NA
WP_000830789.1|666177_667335_-	D-alanyl-D-alanine- carboxypeptidase/endopeptidase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.7	1.9e-05
>prophage 50
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	680241	690160	4505366		Bacillus_phage(60.0%)	7	NA	NA
WP_080161087.1|680241_681153_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	4.2e-104
WP_038396760.1|681278_682187_+	fructokinase	NA	NA	NA	NA	NA
WP_080161088.1|682208_683381_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_080161089.1|683553_686694_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	23.8	7.9e-09
WP_001221241.1|686690_687893_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	37.5	9.7e-08
WP_000113922.1|688105_688795_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	2.6e-37
WP_000893650.1|688864_690160_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	31.1	2.0e-27
>prophage 51
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	697995	706898	4505366	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_038396750.1|697995_699123_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	1.1e-90
WP_000007630.1|699145_699478_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_071820926.1|699505_701353_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046624.1|701363_702335_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	38.1	1.8e-44
WP_079828875.1|702502_702850_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_038396748.1|702928_703792_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_000198490.1|704091_704631_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543531.1|704782_705232_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_058345705.1|705235_706339_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.2	1.1e-50
WP_001021368.1|706427_706898_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	49.7	7.8e-30
>prophage 52
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	729092	734133	4505366	protease	Agrobacterium_phage(33.33%)	3	NA	NA
WP_000122251.1|729092_729716_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.2e-64
WP_000130293.1|729842_731114_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.5	4.3e-131
WP_001043544.1|733860_734133_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.9e-20
>prophage 53
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	737431	738127	4505366		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_038396727.1|737431_738127_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	68.0	5.5e-88
>prophage 54
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	742529	746076	4505366		Bacillus_phage(100.0%)	2	NA	NA
WP_079828075.1|742529_744302_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.0	1.9e-52
WP_079828078.1|744294_746076_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	28.5	3.2e-39
>prophage 55
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	751622	757276	4505366		uncultured_Mediterranean_phage(33.33%)	6	NA	NA
WP_003021675.1|751622_752576_+	hypothetical protein	NA	A0A1B1ITH5	uncultured_Mediterranean_phage	29.3	1.9e-27
WP_040236483.1|752827_753955_-	beta family protein	NA	NA	NA	NA	NA
WP_058819146.1|753975_755184_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0P0ZCT8	Stx2-converting_phage	45.6	1.2e-21
WP_040236487.1|755173_755452_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_040236489.1|755804_756386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003847550.1|756712_757276_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	39.2	2.2e-23
>prophage 56
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	774435	785226	4505366	transposase	Sodalis_phage(20.0%)	12	NA	NA
WP_038396705.1|774435_775359_-|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	52.1	2.8e-63
WP_000051162.1|775428_775596_-	pleiotropic regulatory protein RsmS	NA	NA	NA	NA	NA
WP_170243772.1|775609_776137_-	primosomal replication protein N''	NA	NA	NA	NA	NA
WP_001189864.1|776205_776583_+	DUF454 family protein	NA	NA	NA	NA	NA
WP_000127355.1|776735_777287_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	45.2	1.3e-28
WP_000121960.1|777401_779324_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	2.3e-43
WP_000467098.1|779369_779699_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_038396698.1|779698_780304_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678179.1|780414_782289_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.3	7.5e-116
WP_001220231.1|782524_783169_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250085.1|783295_784258_+	ferrochelatase	NA	NA	NA	NA	NA
WP_079828089.1|784254_785226_-	acetyl esterase	NA	A0A2L2DMU8	Acanthamoeba_polyphaga_mimivirus	26.8	7.3e-14
>prophage 57
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	793404	798623	4505366		uncultured_virus(50.0%)	5	NA	NA
WP_080161097.1|793404_795906_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	37.0	8.8e-112
WP_001026759.1|796015_796432_+	Cu(I)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_000561182.1|796423_796885_-	NfeD family protein	NA	NA	NA	NA	NA
WP_000906148.1|796881_797799_-	SPFH/Band 7/PHB domain protein	NA	NA	NA	NA	NA
WP_079828091.1|797945_798623_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	32.4	5.1e-22
>prophage 58
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	801899	802586	4505366		Planktothrix_phage(100.0%)	1	NA	NA
WP_001110593.1|801899_802586_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	3.0e-30
>prophage 59
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	806392	807409	4505366		Planktothrix_phage(100.0%)	1	NA	NA
WP_038396677.1|806392_807409_+	virulence-associated ABC transporter ATP-binding protein SfbB	NA	G9BWD6	Planktothrix_phage	37.7	1.4e-31
>prophage 60
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	812361	814938	4505366	tRNA	Moumouvirus(50.0%)	3	NA	NA
WP_000912370.1|812361_813747_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	35.5	1.5e-44
WP_000190276.1|813857_814070_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729169.1|814071_814938_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.5	7.2e-29
>prophage 61
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	828862	830586	4505366		Klebsiella_phage(33.33%)	3	NA	NA
WP_077946354.1|828862_829123_+	hypothetical protein	NA	A0A286N2Q6	Klebsiella_phage	61.1	5.0e-10
WP_079827800.1|829314_829692_-	DUF1353 domain-containing protein	NA	I1TQ41	Pseudomonas_phage	38.2	1.4e-13
WP_079827802.1|829776_830586_-	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	49.5	1.3e-61
>prophage 62
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	841936	843265	4505366		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_171776208.1|841936_843265_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.9	8.0e-104
>prophage 63
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	872410	873205	4505366		Klosneuvirus(100.0%)	1	NA	NA
WP_000140617.1|872410_873205_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	24.4	6.4e-08
>prophage 64
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	887690	889516	4505366		uncultured_marine_virus(50.0%)	2	NA	NA
WP_012210391.1|887690_888308_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.3	2.5e-52
WP_058819217.1|888280_889516_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	33.6	5.0e-60
>prophage 65
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	892828	894958	4505366		Bacillus_virus(50.0%)	2	NA	NA
WP_080160884.1|892828_894394_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.0	1.6e-42
WP_000278500.1|894529_894958_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	5.7e-19
>prophage 66
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	910088	911613	4505366		Morganella_phage(33.33%)	3	NA	NA
WP_000034825.1|910088_910298_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939753.1|910351_910735_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	48.6	1.7e-22
WP_058345773.1|910824_911613_+	deaminated glutathione amidase	NA	M1H2P4	Paramecium_bursaria_Chlorella_virus	23.7	5.4e-07
>prophage 67
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	915567	918007	4505366		Stx2-converting_phage(50.0%)	2	NA	NA
WP_000848458.1|915567_916779_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.7	3.4e-101
WP_079782055.1|916918_918007_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	4.6e-09
>prophage 68
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	926234	931397	4505366	tRNA	Staphylococcus_phage(50.0%)	4	NA	NA
WP_001157882.1|926234_928817_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	3.7e-182
WP_001044890.1|929050_929524_+	zinc ribbon-containing protein	NA	NA	NA	NA	NA
WP_001207443.1|929619_930555_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631371.1|930671_931397_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	36.8	3.9e-28
>prophage 69
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	937290	938337	4505366		Pseudomonas_phage(100.0%)	1	NA	NA
WP_058345627.1|937290_938337_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	45.6	6.4e-48
>prophage 70
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	942311	943976	4505366		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_038396549.1|942311_943976_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	7.9e-85
>prophage 71
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	950748	952416	4505366	tRNA	Escherichia_phage(100.0%)	1	NA	NA
WP_171776211.1|950748_952416_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	95.3	0.0e+00
>prophage 72
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	971154	973203	4505366		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_058345619.1|971154_973203_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.3	5.5e-27
>prophage 73
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	978636	981578	4505366		Hokovirus(50.0%)	2	NA	NA
WP_080160878.1|978636_980058_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	31.7	2.1e-57
WP_079827865.1|980096_981578_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.7	4.2e-45
>prophage 74
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	985764	986556	4505366		Kaumoebavirus(100.0%)	1	NA	NA
WP_001113954.1|985764_986556_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	25.4	4.7e-11
>prophage 75
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1024150	1027676	4505366		Vibrio_phage(33.33%)	4	NA	NA
WP_171776213.1|1024150_1024870_+	nicotinamide riboside transporter PnuC	NA	A0A2I7SAC7	Vibrio_phage	27.9	1.4e-17
WP_079904156.1|1024866_1025808_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	27.3	5.8e-24
WP_000784384.1|1025918_1026305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038396484.1|1026623_1027676_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A0B6VT43	Edwardsiella_phage	46.7	1.4e-79
>prophage 76
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1036917	1043442	4505366		Tupanvirus(33.33%)	7	NA	NA
WP_038396470.1|1036917_1037934_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	47.1	7.2e-81
WP_038396468.1|1038145_1039618_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	26.5	8.8e-11
WP_001147423.1|1039685_1040474_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891516.1|1040602_1040752_+	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_058819250.1|1040918_1041692_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604021.1|1041691_1042381_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_079832953.1|1042383_1043442_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	34.3	5.1e-21
>prophage 77
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1067659	1071088	4505366		Catovirus(50.0%)	3	NA	NA
WP_001021638.1|1067659_1069180_+	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	39.9	2.6e-82
WP_038396447.1|1069264_1069741_-	kinase inhibitor	NA	NA	NA	NA	NA
WP_000205496.1|1069798_1071088_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.2	4.5e-19
>prophage 78
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1077981	1081293	4505366		Phage_Gifsy-2(50.0%)	2	NA	NA
WP_171776318.1|1077981_1080282_+	SPI-1 type III secretion system effector E3 ubiquitin transferase SlrP	NA	Q9MBL9	Phage_Gifsy-2	42.3	2.8e-19
WP_038396432.1|1080384_1081293_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	29.5	3.5e-26
>prophage 79
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1090937	1100246	4505366		Anomala_cuprea_entomopoxvirus(25.0%)	8	NA	NA
WP_171776216.1|1090937_1092674_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.9	3.5e-19
WP_079835855.1|1092666_1093662_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_080160863.1|1093661_1094336_-	transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_080160862.1|1094565_1095924_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.6	7.2e-52
WP_080160861.1|1096129_1098274_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.8	2.2e-42
WP_000386507.1|1098303_1099272_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_080160860.1|1099434_1099695_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146325.1|1099979_1100246_-	DksA/TraR family C4-type zinc finger protein	NA	E5E4B1	Acinetobacter_phage	51.7	4.9e-13
>prophage 80
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1103714	1109055	4505366		Planktothrix_phage(33.33%)	6	NA	NA
WP_000569091.1|1103714_1104437_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	7.3e-35
WP_001159073.1|1104433_1105093_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000836099.1|1105259_1106006_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100803.1|1106495_1106999_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	23.0	9.3e-05
WP_001119552.1|1107299_1108187_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_000716761.1|1108539_1109055_+	outer membrane protein OmpX	NA	A5LH44	Enterobacteria_phage	34.7	2.2e-17
>prophage 81
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1114053	1115649	4505366		Tupanvirus(100.0%)	1	NA	NA
WP_000961439.1|1114053_1115649_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.1	4.2e-59
>prophage 82
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1123175	1125608	4505366		Citrobacter_phage(100.0%)	1	NA	NA
WP_080160856.1|1123175_1125608_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	43.5	2.1e-09
>prophage 83
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1129042	1130914	4505366		Planktothrix_phage(100.0%)	1	NA	NA
WP_080152950.1|1129042_1130914_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	28.5	7.5e-15
>prophage 84
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1138557	1140563	4505366		Stx2-converting_phage(50.0%)	2	NA	NA
WP_038396358.1|1138557_1139760_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	46.8	2.4e-99
WP_058345563.1|1139804_1140563_-	DNA-binding transcriptional repressor DeoR	NA	A0A077SK06	Escherichia_phage	30.5	3.0e-15
>prophage 85
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1148138	1157304	4505366		Vibrio_phage(25.0%)	11	NA	NA
WP_000495514.1|1148138_1148402_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	3.5e-27
WP_080160851.1|1148571_1148862_+	YbjC family protein	NA	NA	NA	NA	NA
WP_000075293.1|1148845_1149568_+	nitroreductase NfsA	NA	NA	NA	NA	NA
WP_080160850.1|1149625_1150528_+	30S ribosomal protein S6--L-glutamate ligase	NA	A0A1D7SR78	Cyanophage	33.2	2.2e-33
WP_000624810.1|1150624_1151101_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_080160849.1|1151449_1152562_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_001000691.1|1152648_1153782_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.9	8.5e-30
WP_038396339.1|1153791_1154745_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_038396337.1|1154741_1155587_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_024131950.1|1155660_1156134_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149797.1|1156176_1157304_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	26.0	3.1e-24
>prophage 86
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1164117	1164846	4505366		Planktothrix_phage(100.0%)	1	NA	NA
WP_000027190.1|1164117_1164846_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	35.8	6.7e-28
>prophage 87
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1168922	1169753	4505366		Roseobacter_phage(100.0%)	1	NA	NA
WP_079782382.1|1168922_1169753_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0UZW5	Roseobacter_phage	29.5	6.7e-08
>prophage 88
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1173342	1175061	4505366		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_000815319.1|1173342_1175061_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	2.2e-29
>prophage 89
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1181807	1188194	4505366	protease	Dickeya_phage(20.0%)	5	NA	NA
WP_038396319.1|1181807_1182926_+	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	38.9	2.4e-08
WP_000125883.1|1182922_1184869_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.4	1.8e-40
WP_000447499.1|1185021_1185243_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	64.2	9.3e-18
WP_000520785.1|1185566_1185887_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	3.5e-13
WP_038396315.1|1185917_1188194_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.1	5.3e-164
>prophage 90
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1192703	1209315	4505366	tRNA	Bacillus_phage(25.0%)	10	NA	NA
WP_001202242.1|1192703_1194425_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.5	5.4e-12
WP_080160845.1|1194425_1196192_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	25.9	1.4e-23
WP_000537410.1|1196307_1197276_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	1.7e-63
WP_000228469.1|1197822_1198317_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_085385988.1|1198451_1202366_+	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	49.5	2.1e-88
WP_139814956.1|1202498_1203110_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067798.1|1203119_1204463_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.6	2.8e-80
WP_080160842.1|1204714_1206007_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.2	4.3e-94
WP_080160841.1|1206242_1208687_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	50.5	5.4e-223
WP_000213069.1|1208697_1209315_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	4.3e-76
>prophage 91
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1214579	1219259	4505366		Tetraselmis_virus(100.0%)	3	NA	NA
WP_161737506.1|1214579_1215341_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	25.7	2.2e-21
WP_024131946.1|1215949_1216900_+	type III secretion system effector SopD2	NA	NA	NA	NA	NA
WP_058345537.1|1216976_1219259_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.9	1.1e-161
>prophage 92
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1223359	1224448	4505366		Streptococcus_phage(100.0%)	1	NA	NA
WP_079829374.1|1223359_1224448_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.0	3.1e-77
>prophage 93
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1228984	1233547	4505366		Bacillus_phage(100.0%)	3	NA	NA
WP_000167329.1|1228984_1229269_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	4.1e-10
WP_080160838.1|1229497_1231762_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551250.1|1231798_1233547_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.7	7.1e-60
>prophage 94
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1247962	1260678	4505366	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_000357049.1|1247962_1248511_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	34.7	2.4e-06
WP_038396267.1|1248538_1249186_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_000462661.1|1249248_1250439_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977712.1|1250623_1251715_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	51.2	2.4e-98
WP_000117861.1|1252929_1254330_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.7	2.9e-80
WP_012210305.1|1254498_1255701_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_171776221.1|1256905_1257340_-	hypothetical protein	NA	Q9MBL9	Phage_Gifsy-2	51.7	4.0e-28
WP_080160835.1|1258065_1260678_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.2	5.3e-19
>prophage 95
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1265938	1267846	4505366		Tupanvirus(100.0%)	1	NA	NA
WP_038396248.1|1265938_1267846_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.8	2.4e-53
>prophage 96
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1280349	1282404	4505366		Bacillus_phage(100.0%)	1	NA	NA
WP_080160831.1|1280349_1282404_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.7	1.8e-17
>prophage 97
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1287049	1287709	4505366	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000374049.1|1287049_1287709_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	44.7	5.6e-34
>prophage 98
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1291082	1291493	4505366		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_080160829.1|1291082_1291493_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	63.7	2.9e-41
>prophage 99
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1305415	1306096	4505366		Bacillus_phage(100.0%)	1	NA	NA
WP_141029326.1|1305415_1306096_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	36.5	6.9e-35
>prophage 100
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1319185	1321417	4505366		Phage_258-320(50.0%)	3	NA	NA
WP_024131940.1|1319185_1319548_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	41.7	9.3e-23
WP_001284252.1|1320191_1320497_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420607.1|1320496_1321417_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	46.7	3.2e-11
>prophage 101
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1327701	1327869	4505366		Enterobacteria_phage(100.0%)	1	NA	NA
WP_038396211.1|1327701_1327869_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	92.6	1.4e-05
>prophage 102
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1336794	1337893	4505366	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_114064787.1|1336794_1337893_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.2	1.5e-47
>prophage 103
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1341100	1344660	4505366		Cronobacter_phage(33.33%)	3	NA	NA
WP_000533520.1|1341100_1341889_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.7	7.8e-91
WP_038396207.1|1341994_1342876_-	MurR/RpiR family transcriptional regulator	NA	A0A2P0VNK5	Tetraselmis_virus	28.9	3.3e-05
WP_038396206.1|1343163_1344660_-	sodium:solute symporter	NA	A0A240F3J2	Aeromonas_phage	22.9	1.3e-17
>prophage 104
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1359320	1359860	4505366		Scale_drop_disease_virus(100.0%)	1	NA	NA
WP_000203937.1|1359320_1359860_+	O-acetyl-ADP-ribose deacetylase	NA	A0A0K1L687	Scale_drop_disease_virus	48.3	5.4e-27
>prophage 105
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1368940	1369861	4505366		Morganella_phage(100.0%)	1	NA	NA
WP_058345806.1|1368940_1369861_-	LpxL/LpxP family Kdo(2)-lipid IV(A) lauroyl/palmitoleoyl acyltransferasee	NA	A0A1W6JP29	Morganella_phage	40.1	1.2e-53
>prophage 106
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1374520	1374766	4505366		Salmonella_phage(100.0%)	1	NA	NA
WP_001217759.1|1374520_1374766_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	51.3	7.0e-14
>prophage 107
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1390836	1391787	4505366		Brevibacillus_phage(100.0%)	1	NA	NA
WP_000578691.1|1390836_1391787_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	32.5	3.3e-11
>prophage 108
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1404256	1405381	4505366		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_000007240.1|1404256_1404991_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	33.1	3.8e-15
WP_000103754.1|1405144_1405381_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 109
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1415080	1419258	4505366		Pseudomonas_phage(50.0%)	4	NA	NA
WP_000535398.1|1415080_1415722_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	35.7	3.2e-26
WP_000872462.1|1415718_1416723_+	DNA polymerase III subunit delta'	NA	NA	NA	NA	NA
WP_038396172.1|1416733_1417531_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000475728.1|1417824_1419258_+	PTS glucose transporter subunit IIBC	NA	A0A2I7SAJ6	Vibrio_phage	41.7	9.4e-10
>prophage 110
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1428862	1429120	4505366		Erwinia_phage(100.0%)	1	NA	NA
WP_000800122.1|1428862_1429120_+	DUF1471 domain-containing protein	NA	A0A1B2IFR9	Erwinia_phage	40.0	5.6e-06
>prophage 111
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1435325	1439049	4505366		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033711.1|1435325_1436027_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.7	8.3e-36
WP_000168085.1|1436026_1437271_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_080161049.1|1437299_1438211_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_079781939.1|1438227_1439049_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	34.0	1.4e-21
>prophage 112
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1442753	1444737	4505366		Mycoplasma_phage(50.0%)	2	NA	NA
WP_000799379.1|1442753_1443617_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	26.2	1.5e-10
WP_000531349.1|1443600_1444737_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	G3M9Y6	Bacillus_virus	33.5	6.1e-28
>prophage 113
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1449782	1451153	4505366		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423755.1|1449782_1451153_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	45.1	8.5e-109
>prophage 114
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1454679	1457052	4505366		Phage_21(50.0%)	2	NA	NA
WP_079827582.1|1454679_1455930_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.1e-19
WP_080161043.1|1456365_1457052_-	PipA/GogA/GtgA family type III secretion system effector	NA	Q9MBM0	Phage_Gifsy-2	67.7	4.0e-83
>prophage 115
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1463728	1473693	4505366		Enterobacteria_phage(75.0%)	9	NA	NA
WP_000598354.1|1463728_1464019_-	hypothetical protein	NA	C6ZCX3	Enterobacteria_phage	68.8	2.0e-31
WP_000695107.1|1464819_1465221_-	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_080161041.1|1465915_1470070_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA54	Enterobacteria_phage	42.2	2.8e-304
WP_000497456.1|1470160_1470400_-	DinI family protein	NA	K7P6H1	Enterobacteria_phage	88.6	8.5e-33
WP_012210247.1|1470610_1471132_-	ricin-type beta-trefoil lectin domain protein	NA	NA	NA	NA	NA
WP_024131921.1|1471678_1471891_-	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_038396146.1|1472021_1472285_-	virulence factor	NA	NA	NA	NA	NA
WP_139814953.1|1472333_1472852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038396145.1|1473135_1473693_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9LA63	Enterobacterial_phage	32.0	7.6e-16
>prophage 116
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1483381	1484179	4505366		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_038396141.1|1483381_1484179_+	ATP-binding cassette domain-containing protein	NA	A0A2R8FG22	Brazilian_cedratvirus	29.2	4.4e-09
>prophage 117
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1499132	1502550	4505366		Bacillus_phage(100.0%)	2	NA	NA
WP_058345389.1|1499132_1500623_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	28.5	8.9e-11
WP_000219709.1|1501269_1502550_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	27.0	1.4e-09
>prophage 118
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1511432	1512089	4505366		Tupanvirus(100.0%)	1	NA	NA
WP_038396125.1|1511432_1512089_-	bifunctional nicotinamidase/pyrazinamidase	NA	A0A2K9L2K0	Tupanvirus	35.2	4.3e-18
>prophage 119
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1516965	1518915	4505366		Streptococcus_phage(100.0%)	1	NA	NA
WP_038396119.1|1516965_1518915_+	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.0	1.8e-40
>prophage 120
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1522501	1523728	4505366		Klosneuvirus(100.0%)	1	NA	NA
WP_000059517.1|1522501_1523728_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	28.3	1.1e-25
>prophage 121
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1530425	1531253	4505366		Bacillus_virus(100.0%)	1	NA	NA
WP_079903668.1|1530425_1531253_-	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.2	8.5e-72
>prophage 122
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1551773	1571777	4505366	tRNA	Tupanvirus(20.0%)	20	NA	NA
WP_000394195.1|1551773_1552193_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	58.9	7.2e-35
WP_000457668.1|1552195_1553464_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	86.0	6.2e-215
WP_001144222.1|1553829_1555758_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.4	6.1e-129
WP_001574431.1|1555761_1556304_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.7	4.8e-15
WP_001124225.1|1556399_1556597_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124849.1|1556647_1557004_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|1557124_1557169_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018570.1|1557306_1558290_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_038396101.1|1558305_1560693_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229266.1|1560697_1560997_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_038396100.1|1561199_1562180_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001181558.1|1562271_1562823_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_038396099.1|1562822_1563572_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	27.2	1.6e-08
WP_038396098.1|1563648_1564113_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	39.4	2.0e-14
WP_171776227.1|1564425_1565139_+	anti-FlhDC factor YdiV	NA	NA	NA	NA	NA
WP_079832375.1|1565200_1566643_+	YdiU family protein	NA	NA	NA	NA	NA
WP_000089115.1|1566677_1566869_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082186.1|1567027_1568074_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.4	3.7e-80
WP_000370989.1|1568229_1569063_-	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_080161025.1|1569398_1571777_+	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	7.2e-172
>prophage 123
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1581042	1584252	4505366		Cedratvirus(50.0%)	3	NA	NA
WP_000932071.1|1581042_1581789_+	Fe-S cluster assembly ATPase SufC	NA	A0A285PWH2	Cedratvirus	32.5	4.0e-12
WP_079835170.1|1581763_1583029_+	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000143846.1|1583031_1584252_+	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	40.8	2.9e-92
>prophage 124
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1597858	1602187	4505366		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000331735.1|1597858_1598587_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	46.9	7.6e-48
WP_000666339.1|1598755_1599394_-	two component system response regulator	NA	NA	NA	NA	NA
WP_080161023.1|1599424_1602187_-	two component system sensor kinase	NA	Q8QKV7	Ectocarpus_siliculosus_virus	27.1	4.9e-31
>prophage 125
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1626004	1633574	4505366		Orpheovirus(20.0%)	7	NA	NA
WP_000493935.1|1626004_1626646_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	37.3	1.1e-23
WP_000098883.1|1626686_1627835_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	46.2	2.9e-86
WP_001182306.1|1628125_1629331_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000190994.1|1630373_1631399_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	8.2e-32
WP_000102277.1|1631695_1631785_+	YnhF family membrane protein	NA	NA	NA	NA	NA
WP_000007290.1|1632038_1632620_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	9.0e-44
WP_170243763.1|1632746_1633574_-	C40 family peptidase	NA	A0A1S5SEZ8	Streptococcus_phage	41.0	1.9e-15
>prophage 126
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1638689	1639211	4505366		Salmonella_phage(100.0%)	1	NA	NA
WP_000826815.1|1638689_1639211_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	60.3	1.2e-50
>prophage 127
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1646127	1647402	4505366	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_000168623.1|1646127_1647402_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.3	3.2e-86
>prophage 128
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1672536	1675463	4505366		Bacillus_phage(50.0%)	2	NA	NA
WP_079782331.1|1672536_1673838_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	22.4	3.4e-14
WP_079782330.1|1674311_1675463_-	porin OmpS2	NA	Q1MVN1	Enterobacteria_phage	57.8	2.5e-114
>prophage 129
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1692090	1711370	4505366		Escherichia_phage(40.0%)	19	NA	NA
WP_000593083.1|1692090_1693239_-	osmoprotectant ABC transporter ATP-binding protein OsmV	NA	G9BWD6	Planktothrix_phage	33.9	1.1e-24
WP_000379681.1|1693238_1693886_-	osmoprotectant ABC transporter permease OsmW	NA	NA	NA	NA	NA
WP_080161122.1|1693895_1694798_-	osmoprotectant ABC transporter substrate-binding protein OsmX	NA	NA	NA	NA	NA
WP_000288454.1|1694826_1695537_-	osmoprotectant ABC transporter permease OsmY	NA	NA	NA	NA	NA
WP_171776230.1|1695841_1696456_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.8	4.7e-27
WP_080161121.1|1696498_1697356_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	NA	NA	NA	NA
WP_000213064.1|1697357_1697975_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	7.3e-76
WP_079799508.1|1697985_1700421_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	47.9	3.3e-204
WP_170243764.1|1700520_1702962_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	49.3	3.1e-218
WP_000685010.1|1703109_1703415_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_072160212.1|1703522_1704233_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_000199999.1|1704273_1704834_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001110005.1|1704869_1705211_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000921384.1|1705364_1705691_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	52.9	9.9e-24
WP_079799510.1|1705812_1707027_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.2	1.8e-46
WP_058345311.1|1707037_1708057_+	Zn-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_171776231.1|1708110_1709490_+	MHS family MFS transporter	NA	Q6JIH2	Burkholderia_virus	25.8	4.3e-28
WP_080161119.1|1709633_1711100_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.8	1.5e-42
WP_000989267.1|1711166_1711370_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	2.9e-13
>prophage 130
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1718878	1719262	4505366		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091193.1|1718878_1719262_-	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 131
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1726253	1729637	4505366		Stx2-converting_phage(100.0%)	1	NA	NA
WP_171776319.1|1726253_1729637_+	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	50.0	4.4e-311
>prophage 132
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1741868	1742033	4505366		Salmonella_phage(100.0%)	1	NA	NA
WP_001576629.1|1741868_1742033_+	glycoside hydrolase family protein	NA	A0A0M4R365	Salmonella_phage	63.0	3.3e-12
>prophage 133
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1748193	1748795	4505366		Escherichia_phage(100.0%)	2	NA	NA
WP_001195491.1|1748193_1748415_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	A0A222YXU1	Escherichia_phage	45.2	1.5e-07
WP_079781811.1|1748411_1748795_+	type II toxin-antitoxin system death-on-curing family toxin	NA	Q71T66	Escherichia_phage	55.9	1.1e-29
>prophage 134
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1764545	1765556	4505366		Tupanvirus(100.0%)	1	NA	NA
WP_080161110.1|1764545_1765556_+	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.9	3.9e-26
>prophage 135
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1774684	1776805	4505366		Salmonella_phage(100.0%)	1	NA	NA
WP_079828626.1|1774684_1776805_+	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	64.7	3.4e-133
>prophage 136
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1794759	1796724	4505366		Phage_TP(100.0%)	1	NA	NA
WP_171776234.1|1794759_1796724_-	U32 family peptidase	NA	Q6DW11	Phage_TP	27.0	3.9e-22
>prophage 137
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1805139	1812244	4505366		Bandra_megavirus(33.33%)	5	NA	NA
WP_058819537.1|1805139_1806648_-	carboxylesterase/lipase family protein	NA	A0A2K9V9Q0	Bandra_megavirus	36.4	1.9e-32
WP_038395958.1|1806697_1808041_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414253.1|1808346_1809270_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_080161106.1|1809330_1810956_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	8.5e-07
WP_000842131.1|1811125_1812244_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	28.8	4.4e-31
>prophage 138
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1819023	1824437	4505366		Escherichia_phage(50.0%)	3	NA	NA
WP_000527272.1|1819023_1819554_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	1.6e-18
WP_079781784.1|1819670_1820471_-	YdcF family protein	NA	NA	NA	NA	NA
WP_080161130.1|1820534_1824437_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SBU4	Catovirus	29.8	1.6e-51
>prophage 139
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1830387	1831377	4505366		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_080161102.1|1830387_1831377_+	2-hydroxyacid dehydrogenase	NA	M1HMI7	Paramecium_bursaria_Chlorella_virus	42.5	3.6e-69
>prophage 140
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1836490	1849050	4505366	tRNA	Morganella_phage(16.67%)	10	NA	NA
WP_001082296.1|1836490_1836925_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.1	9.4e-30
WP_000159238.1|1836977_1837316_-	EamA family transporter	NA	NA	NA	NA	NA
WP_150363950.1|1837806_1841226_-	DUF4765 family protein	NA	A0A0N7KZG3	Stx2-converting_phage	51.2	0.0e+00
WP_058345251.1|1841957_1842893_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	95.7	6.8e-142
WP_080161134.1|1842936_1844310_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.0	2.1e-51
WP_001277679.1|1844338_1844521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038395944.1|1844796_1845780_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_080161135.1|1845921_1847079_-	chemoreceptor protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.3	5.8e-10
WP_001046805.1|1847509_1848073_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000945022.1|1848534_1849050_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	55.1	1.6e-23
>prophage 141
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1858696	1859554	4505366		Streptococcus_phage(100.0%)	1	NA	NA
WP_077946176.1|1858696_1859554_+	helix-turn-helix domain-containing protein	NA	D0R0F8	Streptococcus_phage	28.1	1.5e-07
>prophage 142
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1862876	1865105	4505366		Escherichia_phage(66.67%)	3	NA	NA
WP_000739349.1|1862876_1863452_-	hypothetical protein	NA	G1BEM5	Escherichia_phage	45.9	1.5e-35
WP_024131874.1|1863448_1864276_-	cytolethal distending toxin subunit B family protein	NA	A5LH53	Enterobacteria_phage	64.6	4.2e-95
WP_080161140.1|1864292_1865105_-	hypothetical protein	NA	G1BEM3	Escherichia_phage	45.0	1.8e-45
>prophage 143
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1874136	1875219	4505366		Planktothrix_phage(100.0%)	1	NA	NA
WP_079781771.1|1874136_1875219_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.2	1.1e-21
>prophage 144
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1893349	1893901	4505366	tail	Salmonella_phage(100.0%)	1	NA	NA
WP_080161143.1|1893349_1893901_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	86.3	3.9e-89
>prophage 145
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1898813	1899620	4505366		Bacillus_virus(100.0%)	1	NA	NA
WP_000250887.1|1898813_1899620_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-14
>prophage 146
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1904064	1905999	4505366		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_058345223.1|1904064_1905999_+	exoribonuclease II	NA	A0A2H4UVB7	Bodo_saltans_virus	23.8	2.3e-06
>prophage 147
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1912612	1913203	4505366		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176284.1|1912612_1913203_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.4	2.9e-42
>prophage 148
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1918000	1923461	4505366	protease	Tupanvirus(50.0%)	4	NA	NA
WP_038395914.1|1918000_1920598_-	type I DNA topoisomerase	NA	A0A2K9L5F8	Tupanvirus	35.1	1.3e-86
WP_000548612.1|1921000_1921252_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422085.1|1921415_1922462_-|protease	protease SohB	protease	NA	NA	NA	NA
WP_000559304.1|1922699_1923461_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	22.2	2.0e-06
>prophage 149
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1930821	1933779	4505366		Acinetobacter_phage(100.0%)	2	NA	NA
WP_038395910.1|1930821_1932417_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	39.3	5.3e-54
WP_038395909.1|1932420_1933779_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.9	4.3e-36
>prophage 150
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1945448	1948347	4505366		Lactobacillus_phage(33.33%)	3	NA	NA
WP_000059069.1|1945448_1946285_-	ion transporter	NA	A0A1B0Y2S3	Lactobacillus_phage	40.5	5.2e-08
WP_000990506.1|1946332_1947337_-	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.2	1.8e-15
WP_000058851.1|1947333_1948347_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.9	6.4e-13
>prophage 151
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1956722	1966689	4505366		Serratia_phage(25.0%)	10	NA	NA
WP_000068105.1|1956722_1957340_-	thymidine kinase	NA	A0A023W530	Serratia_phage	53.7	2.7e-54
WP_001287383.1|1957877_1958291_+	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000729453.1|1958420_1959329_-	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	47.5	8.2e-60
WP_000193427.1|1959531_1960545_-	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_012210099.1|1960635_1961541_-	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_024131864.1|1961651_1962110_+	YchJ family protein	NA	NA	NA	NA	NA
WP_001191153.1|1962160_1963003_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	3.7e-14
WP_000545598.1|1963769_1964447_-	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_079781107.1|1964446_1965157_-	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_079799104.1|1965153_1966689_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	41.4	4.8e-20
>prophage 152
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1977099	1982756	4505366		Mythimna_unipuncta_granulovirus(33.33%)	7	NA	NA
WP_058345212.1|1977099_1977330_-	putative cation transport regulator ChaB	NA	A0A1S5YE01	Mythimna_unipuncta_granulovirus	41.3	7.2e-05
WP_080161183.1|1977595_1978696_+	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_000811042.1|1978749_1979604_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	38.8	7.0e-45
WP_001257062.1|1979641_1980451_-	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000150663.1|1980454_1980844_-	SirB family protein	NA	NA	NA	NA	NA
WP_000347302.1|1980840_1981674_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000804706.1|1981673_1982756_-	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	8.7e-08
>prophage 153
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1986112	1988870	4505366		Tupanvirus(50.0%)	2	NA	NA
WP_001518537.1|1986112_1987060_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	8.6e-44
WP_001037192.1|1987184_1988870_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.4	1.0e-23
>prophage 154
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	1994830	1996063	4505366		Erwinia_phage(100.0%)	1	NA	NA
WP_012210090.1|1994830_1996063_-	anaerobic sulfatase maturase	NA	A0A1B2IB49	Erwinia_phage	28.5	3.5e-05
>prophage 155
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2035538	2042850	4505366	tRNA	Staphylococcus_phage(33.33%)	7	NA	NA
WP_038397763.1|2035538_2037224_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.3e-34
WP_000290588.1|2037428_2038010_-	Slp family lipoprotein	NA	NA	NA	NA	NA
WP_001221010.1|2038081_2038777_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_079781124.1|2038834_2040745_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	32.3	5.0e-91
WP_000158031.1|2040875_2041220_+	RidA family protein	NA	NA	NA	NA	NA
WP_000457328.1|2041225_2041405_-	YoaH family protein	NA	NA	NA	NA	NA
WP_080161185.1|2041485_2042850_+	aminodeoxychorismate synthase component 1	NA	A0A0B5J984	Pandoravirus	34.8	5.0e-45
>prophage 156
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2046828	2048388	4505366		Moraxella_phage(100.0%)	1	NA	NA
WP_079799121.1|2046828_2048388_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	44.0	1.2e-39
>prophage 157
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2055874	2056084	4505366		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|2055874_2056084_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 158
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2060385	2125945	4505366	protease,tail,head,lysis,plate,integrase	Edwardsiella_phage(16.33%)	81	2079583:2079608	2122230:2122255
WP_000984498.1|2060385_2061267_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_171776243.1|2061460_2063509_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	1.6e-87
WP_000431406.1|2063528_2064215_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_000004840.1|2064312_2064810_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_001207301.1|2064938_2066222_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_038395814.1|2066190_2068824_+	PqiB family protein	NA	NA	NA	NA	NA
WP_080161191.1|2068901_2070341_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_024131167.1|2070458_2070695_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_000457840.1|2070805_2070997_+	YebW family protein	NA	NA	NA	NA	NA
WP_058818997.1|2071025_2071676_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	51.4	1.7e-59
WP_000161566.1|2072360_2073083_-	type III secretion system guanine nucleotide exchange factor SopE2	NA	NA	NA	NA	NA
WP_000030953.1|2073594_2074071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171776244.1|2074213_2074918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171776245.1|2074931_2075213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171776246.1|2076271_2078629_-	type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	88.8	1.7e-72
WP_103143133.1|2078747_2078918_-|tail	phage tail protein	tail	NA	NA	NA	NA
2079583:2079608	attL	AAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_171776247.1|2080396_2081197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079828305.1|2081225_2081417_-	helix-turn-helix domain-containing protein	NA	S4TTF2	Salmonella_phage	97.0	6.2e-10
WP_171776248.1|2081593_2081812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171776249.1|2081933_2082512_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	85.1	1.4e-89
WP_171776250.1|2082511_2083972_-|tail	tail fiber protein	tail	E5G6P0	Salmonella_phage	69.4	1.1e-40
WP_079828299.1|2083961_2084564_-	DUF2612 domain-containing protein	NA	A0A2R3UAM9	Myoviridae_environmental_samples	39.3	3.3e-33
WP_171776251.1|2084565_2085807_-|plate	baseplate J/gp47 family protein	plate	A0A077KGW9	Edwardsiella_phage	49.9	7.0e-102
WP_079828298.1|2085803_2086160_-	hypothetical protein	NA	A0A077KCA1	Edwardsiella_phage	50.0	2.5e-20
WP_079828297.1|2086172_2086847_-	oxidoreductase	NA	A0A077KAY0	Edwardsiella_phage	36.0	5.4e-32
WP_079828296.1|2086830_2087697_-	hypothetical protein	NA	A0A077KC17	Edwardsiella_phage	32.4	3.4e-31
WP_001525448.1|2087693_2087996_-	hypothetical protein	NA	A0A077K9U4	Edwardsiella_phage	49.5	7.0e-24
WP_079828294.1|2087995_2088706_-	hypothetical protein	NA	A0A077KGW3	Edwardsiella_phage	34.6	1.2e-26
WP_171776252.1|2088702_2090874_-	lytic transglycosylase domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	66.4	3.2e-49
WP_000228830.1|2090857_2091040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079828291.1|2091081_2091486_-	hypothetical protein	NA	H9C0W7	Aeromonas_phage	43.1	2.6e-18
WP_000016413.1|2091485_2091932_-	hypothetical protein	NA	Q2NPD1	Xanthomonas_phage	39.7	4.8e-21
WP_079828290.1|2091932_2093417_-	DUF3383 domain-containing protein	NA	A0A077KGV4	Edwardsiella_phage	41.2	2.3e-96
WP_000094504.1|2093397_2093943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085386023.1|2093927_2094293_-	hypothetical protein	NA	A0A077KAW7	Edwardsiella_phage	39.7	8.8e-21
WP_079828289.1|2094289_2094874_-	hypothetical protein	NA	H9C0W2	Aeromonas_phage	30.8	2.7e-16
WP_079828287.1|2094867_2095314_-	DUF4054 domain-containing protein	NA	A0A068CGG9	Acinetobacter_phage	40.8	2.3e-15
WP_023209779.1|2095320_2095668_-	hypothetical protein	NA	H9C0V9	Aeromonas_phage	38.1	1.5e-09
WP_001031913.1|2095671_2096700_-	hypothetical protein	NA	A0A219YBB0	Aeromonas_phage	48.7	2.3e-82
WP_079828286.1|2096699_2097182_-	hypothetical protein	NA	K4HYQ5	Acinetobacter_phage	41.2	1.3e-19
WP_079828284.1|2097183_2098530_-	DUF2213 domain-containing protein	NA	A0A219YCD3	Aeromonas_phage	36.5	7.1e-68
WP_079828283.1|2098526_2099216_-|head	phage head morphogenesis protein	head	H9C0V1	Aeromonas_phage	50.0	1.1e-59
WP_079828281.1|2099256_2100777_-	DUF1073 domain-containing protein	NA	A0A2R3UAL5	Myoviridae_environmental_samples	44.4	4.8e-105
WP_094172071.1|2100776_2102396_-	TerL protein	NA	A0A0M5M1R6	Salmonella_phage	81.0	3.3e-261
WP_079828278.1|2102398_2103028_-	hypothetical protein	NA	A0A0M3ULJ9	Salmonella_phage	98.1	3.3e-108
WP_023229530.1|2103091_2103280_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_086814035.1|2103505_2103946_-|lysis	lysis protein	lysis	A0A0M4RD57	Salmonella_phage	78.7	2.8e-53
WP_079828276.1|2104278_2104818_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	70.6	1.7e-76
WP_001525456.1|2104795_2105098_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001668190.1|2105230_2105767_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000639985.1|2105973_2106528_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	64.6	1.7e-63
WP_000926965.1|2106524_2106821_-	DUF1364 family protein	NA	K7P7Q1	Enterobacteria_phage	79.8	1.1e-34
WP_079828274.1|2106802_2106997_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	53.4	3.7e-10
WP_171776253.1|2106993_2107593_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	83.4	3.3e-97
WP_000911591.1|2107656_2107905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001597144.1|2108154_2108310_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	84.3	1.2e-14
WP_079828272.1|2108631_2109567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079828268.1|2110205_2110730_-	antitermination protein	NA	A0A0P0ZCW0	Stx2-converting_phage	62.2	1.0e-38
WP_171776254.1|2110945_2111188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079828264.1|2111184_2111580_-	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	38.8	9.8e-18
WP_000788954.1|2111597_2112350_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	76.5	5.9e-104
WP_171776255.1|2112356_2113250_-	DNA-binding protein	NA	A0A088CD36	Shigella_phage	58.5	7.1e-32
WP_171776256.1|2113294_2113789_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033911.1|2113775_2114030_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	60.9	5.3e-17
WP_001574209.1|2114128_2114527_+	helix-turn-helix domain-containing protein	NA	K7PH19	Enterobacteria_phage	56.0	1.2e-18
WP_001525799.1|2114957_2115137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000103933.1|2115397_2115673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682660.1|2115676_2115883_+	cell division inhibitor protein	NA	I6PBM9	Cronobacter_phage	45.6	3.0e-10
WP_001525802.1|2115958_2116294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171776257.1|2116434_2119125_+	exodeoxyribonuclease VIII	NA	Q9QF34	Lambdoid_phage	83.5	2.0e-117
WP_001126028.1|2119117_2119948_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	72.0	1.0e-104
WP_000280164.1|2119994_2120180_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	59.6	2.9e-12
WP_076735133.1|2120278_2120707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031603794.1|2120767_2121040_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	39.7	1.8e-10
WP_000078710.1|2121020_2122100_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	51.4	3.3e-100
WP_058344983.1|2122476_2122827_-	YebY family protein	NA	NA	NA	NA	NA
2122230:2122255	attR	AAAAAGAGACCGAATACGATTCCTGT	NA	NA	NA	NA
WP_072159161.1|2122843_2123719_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_171776258.1|2123719_2124094_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000856224.1|2124231_2124462_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	60.3	2.9e-14
WP_038395796.1|2124569_2125226_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_038395794.1|2125249_2125945_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	40.4	1.6e-07
>prophage 159
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2133841	2135317	4505366		Cyanophage(100.0%)	1	NA	NA
WP_000301708.1|2133841_2135317_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	2.6e-79
>prophage 160
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2139266	2145441	4505366		Bacillus_virus(50.0%)	7	NA	NA
WP_001184058.1|2139266_2140586_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	2.6e-14
WP_024131845.1|2140601_2141546_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202977.1|2141624_2142380_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	29.4	6.5e-18
WP_000571519.1|2142376_2143162_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568510.1|2143207_2144218_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.9	3.1e-07
WP_024131844.1|2144226_2144838_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_080161204.1|2144916_2145441_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 161
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2149461	2156018	4505366	tRNA	Escherichia_coli_phage(33.33%)	7	NA	NA
WP_079829475.1|2149461_2150280_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	78.7	5.0e-56
WP_000252975.1|2150331_2150727_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019582.1|2150767_2151511_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.9	5.4e-25
WP_000569022.1|2151507_2152479_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_001185713.1|2152712_2153459_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_038395768.1|2153478_2154048_-	VOC family protein	NA	NA	NA	NA	NA
WP_079781864.1|2154284_2156018_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.2	1.4e-84
>prophage 162
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2165577	2169720	4505366		Bacillus_thuringiensis_phage(66.67%)	4	NA	NA
WP_000763861.1|2165577_2165967_-	chemotaxis protein CheY	NA	Q56AR1	Bacillus_thuringiensis_phage	30.4	2.2e-06
WP_000036388.1|2165984_2167034_-	chemotaxis response regulator protein-glutamate methylesterase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204359.1|2167030_2167897_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483287.1|2168058_2169720_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	26.5	3.3e-14
>prophage 163
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2190753	2191419	4505366		Sphingomonas_phage(100.0%)	1	NA	NA
WP_000781530.1|2190753_2191419_-	YecA family protein	NA	H9NBT7	Sphingomonas_phage	58.1	4.2e-05
>prophage 164
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2199875	2200628	4505366		Bacillus_virus(100.0%)	1	NA	NA
WP_058345035.1|2199875_2200628_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.0	1.6e-24
>prophage 165
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2227224	2233241	4505366		Burkholderia_phage(66.67%)	6	NA	NA
WP_058819313.1|2227224_2228937_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	42.2	1.1e-20
WP_000232161.1|2229101_2229287_-	YodC family protein	NA	NA	NA	NA	NA
WP_103143130.1|2229363_2230281_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_079781879.1|2230450_2231371_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000786010.1|2231359_2231830_-	very short patch repair endonuclease	NA	E5E3X5	Burkholderia_phage	46.9	2.7e-30
WP_079828203.1|2231810_2233241_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	56.5	7.8e-105
>prophage 166
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2236511	2242211	4505366	transposase	Morganella_phage(33.33%)	5	NA	NA
WP_000208505.1|2236511_2236724_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	68.6	1.5e-20
WP_109462786.1|2237358_2238363_+	SPI-2 type III secretion system effector PipB	NA	NA	NA	NA	NA
WP_134940772.1|2238643_2239806_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	42.3	8.1e-52
WP_000158651.1|2240956_2241817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000249903.1|2241992_2242211_+	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	48.0	1.2e-06
>prophage 167
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2248904	2250476	4505366	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_079829696.1|2248904_2250476_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	37.4	3.9e-81
>prophage 168
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2254278	2262204	4505366		Rhizobium_phage(25.0%)	4	NA	NA
WP_000280762.1|2254278_2255049_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A076YN96	Rhizobium_phage	27.2	6.6e-10
WP_080161319.1|2256179_2257646_-	type III secretion effector GogB	NA	Q9MBM1	Phage_Gifsy-1	91.2	3.9e-237
WP_075826416.1|2258468_2260826_+	type III secretion system effector E3 ubiquitin transferase SspH2	NA	Q9MBL9	Phage_Gifsy-2	86.7	6.0e-70
WP_000829183.1|2261178_2262204_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.1	2.7e-27
>prophage 169
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2265383	2266482	4505366	transposase	Leptospira_phage(100.0%)	1	NA	NA
WP_114064787.1|2265383_2266482_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.2	1.5e-47
>prophage 170
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2275571	2276642	4505366	transposase	Stenotrophomonas_phage(100.0%)	1	NA	NA
WP_079781425.1|2275571_2276642_+|transposase	transposase	transposase	B7SYF8	Stenotrophomonas_phage	40.8	2.7e-33
>prophage 171
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2285577	2286393	4505366		Amsacta_moorei_entomopoxvirus(100.0%)	1	NA	NA
WP_000881537.1|2285577_2286393_-	energy-coupling factor ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	24.7	7.7e-09
>prophage 172
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2299866	2300700	4505366		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_079828178.1|2299866_2300700_-	propanediol diffusion facilitator PduF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	27.1	1.4e-10
>prophage 173
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2320343	2325270	4505366		Escherichia_phage(66.67%)	4	NA	NA
WP_038395558.1|2320343_2321516_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	87.9	3.6e-201
WP_058345088.1|2321639_2322404_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_058345089.1|2322400_2322979_-	thiosulfate reductase electron transport protein PhsB	NA	A0A077SL61	Escherichia_phage	36.3	9.6e-22
WP_079781403.1|2322993_2325270_-	thiosulfate reductase PhsA	NA	A0A077SK27	Escherichia_phage	26.5	2.1e-35
>prophage 174
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2334293	2335193	4505366		Cellulophaga_phage(100.0%)	1	NA	NA
WP_038395454.1|2334293_2335193_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	100.0	1.7e-12
>prophage 175
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2342547	2354164	4505366	transposase	Catovirus(28.57%)	8	NA	NA
WP_000704819.1|2342547_2343714_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.7	3.5e-111
WP_058819954.1|2343949_2345356_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.2e-36
WP_114064787.1|2345581_2346681_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.2	1.5e-47
WP_141029343.1|2346941_2348066_-	acyltransferase family protein	NA	A0A2H4JA46	uncultured_Caudovirales_phage	27.3	4.8e-17
WP_080161252.1|2350291_2351311_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	49.5	3.2e-84
WP_080161251.1|2351340_2352468_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_171776261.1|2352746_2353511_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	36.9	7.3e-09
WP_080161250.1|2353507_2354164_-	polysaccharide biosynthesis protein	NA	A0A1V0SBR5	Catovirus	30.3	8.4e-06
>prophage 176
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2357694	2360168	4505366		Bacillus_phage(50.0%)	2	NA	NA
WP_023183910.1|2357694_2358588_-	GalU regulator GalF	NA	A0A127AW70	Bacillus_phage	42.2	4.8e-44
WP_080161246.1|2358764_2360168_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	1.2e-20
>prophage 177
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2365819	2372525	4505366		Bacillus_phage(25.0%)	6	NA	NA
WP_080161243.1|2365819_2367190_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	26.9	6.4e-32
WP_171776262.1|2367300_2368743_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.7	3.6e-49
WP_080161241.1|2368739_2369963_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_080161240.1|2369959_2370433_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_058819090.1|2370435_2371401_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.2	3.5e-85
WP_000048166.1|2371403_2372525_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.5	5.3e-133
>prophage 178
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2377701	2387013	4505366		Streptococcus_phage(25.0%)	8	NA	NA
WP_171776264.1|2377701_2379861_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	31.2	4.9e-18
WP_000482223.1|2379857_2380307_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_079798987.1|2380312_2381452_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_170243780.1|2381387_2381621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038395385.1|2382133_2383714_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	44.9	1.8e-38
WP_080161238.1|2383802_2385659_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234784.1|2385699_2386281_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.6	2.1e-32
WP_000132082.1|2386371_2387013_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	2.5e-34
>prophage 179
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2391304	2392657	4505366		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_058345126.1|2391304_2392657_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	21.4	1.6e-06
>prophage 180
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2397458	2404709	4505366	tRNA	Bacillus_phage(50.0%)	4	NA	NA
WP_080161235.1|2397458_2400539_+	multidrug efflux RND transporter permease subunit MdtC	NA	S5VTK5	Leptospira_phage	23.0	8.4e-64
WP_000870086.1|2401069_2402473_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	1.6e-30
WP_079798980.1|2402469_2403192_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	1.4e-30
WP_024131826.1|2403347_2404709_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	95.6	1.4e-207
>prophage 181
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2419575	2427702	4505366	tRNA	Enterobacteria_phage(60.0%)	8	NA	NA
WP_079903798.1|2419575_2421609_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.4	6.1e-55
WP_038395352.1|2422019_2422490_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	91.7	3.2e-76
WP_038395350.1|2422536_2423256_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_171776265.1|2423252_2424938_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	90.4	2.9e-276
WP_001240411.1|2425160_2425892_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	89.4	1.4e-102
WP_038395344.1|2425951_2426059_+	protein YohO	NA	NA	NA	NA	NA
WP_079798970.1|2426039_2426771_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569159.1|2426754_2427702_-	ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.5	5.3e-09
>prophage 182
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2445607	2447572	4505366		Stx1_converting_phage(100.0%)	1	NA	NA
WP_001137953.1|2445607_2447572_+	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	53.6	8.1e-145
>prophage 183
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2451929	2455941	4505366	transposase	Leptospira_phage(50.0%)	4	NA	NA
WP_171776266.1|2451929_2453037_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	37.1	4.0e-40
WP_079829112.1|2453022_2453346_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_000114953.1|2453394_2454405_-	galactose/methyl galactoside ABC transporter permease MglC	NA	NA	NA	NA	NA
WP_000255142.1|2454420_2455941_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	31.9	5.9e-10
>prophage 184
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2459693	2460362	4505366		Cellulophaga_phage(100.0%)	1	NA	NA
WP_038395281.1|2459693_2460362_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	1.2e-55
>prophage 185
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2465802	2467794	4505366		Acinetobacter_phage(100.0%)	1	NA	NA
WP_038395272.1|2465802_2467794_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	37.9	6.7e-14
>prophage 186
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2471910	2472768	4505366		Catovirus(100.0%)	1	NA	NA
WP_000873902.1|2471910_2472768_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	28.1	7.6e-23
>prophage 187
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2482404	2483976	4505366	transposase	uncultured_virus(100.0%)	1	NA	NA
WP_080161318.1|2482404_2483976_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	37.4	3.9e-81
>prophage 188
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2496332	2504693	4505366	transposase	Burkholderia_phage(33.33%)	10	NA	NA
WP_114064787.1|2496332_2497431_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.2	1.5e-47
WP_075810488.1|2497533_2498073_+	DUF4145 domain-containing protein	NA	A0A222YYQ2	Escherichia_phage	56.1	1.7e-49
WP_058819998.1|2498194_2498722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058819999.1|2498862_2500161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072209872.1|2500281_2500503_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_032170344.1|2500542_2500806_-	helix-turn-helix transcriptional regulator	NA	S5M643	Brevibacillus_phage	39.6	8.3e-05
WP_058820000.1|2500915_2501176_+	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	69.6	9.0e-20
WP_058820001.1|2501172_2501910_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_168169430.1|2502042_2503437_+	DNA (cytosine-5-)-methyltransferase	NA	E5E3X6	Burkholderia_phage	50.9	2.1e-102
WP_168169429.1|2503487_2504693_-	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	39.3	4.6e-34
>prophage 189
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2523817	2524729	4505366		Caulobacter_phage(100.0%)	1	NA	NA
WP_058819804.1|2523817_2524729_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.6	9.5e-48
>prophage 190
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2528449	2541518	4505366	tRNA	Tupanvirus(25.0%)	9	NA	NA
WP_000152570.1|2528449_2529469_+	NAD(P)-dependent alcohol dehydrogenase	NA	A0A2K9L7I1	Tupanvirus	31.4	1.9e-44
WP_012210613.1|2529496_2530045_-	gluconokinase	NA	NA	NA	NA	NA
WP_170243779.1|2531844_2532261_+	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_038397056.1|2532338_2533841_+	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.8	1.3e-81
WP_038397057.1|2533940_2535023_-	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_012210617.1|2535022_2536123_-	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_000397141.1|2536515_2538027_+	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	7.1e-48
WP_000786389.1|2538219_2538663_+	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_038397060.1|2538662_2541518_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.0e-140
>prophage 191
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2544633	2545206	4505366		Cellulophaga_phage(100.0%)	1	NA	NA
WP_080161066.1|2544633_2545206_-	relaxase/mobilization nuclease domain-containing protein	NA	M1Q738	Cellulophaga_phage	66.7	2.2e-63
>prophage 192
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2555109	2559814	4505366		Paramecium_bursaria_Chlorella_virus(50.0%)	4	NA	NA
WP_080161068.1|2555109_2556045_+	aspartate carbamoyltransferase	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	40.2	3.2e-51
WP_079799562.1|2556058_2556520_+	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000047545.1|2556625_2557012_+	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000920852.1|2557105_2559814_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	25.9	2.5e-48
>prophage 193
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2564345	2567659	4505366		Vibrio_phage(50.0%)	4	NA	NA
WP_000187814.1|2564345_2566484_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.4	1.5e-266
WP_079828005.1|2566668_2567133_+	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	57.8	3.9e-50
WP_079828004.1|2567142_2567427_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	64.9	1.4e-29
WP_023182636.1|2567416_2567659_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	50.0	9.6e-16
>prophage 194
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2573469	2577520	4505366		Klosneuvirus(33.33%)	6	NA	NA
WP_000853765.1|2573469_2574468_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.4	9.6e-70
WP_012210633.1|2574492_2574675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000055080.1|2574692_2575223_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	4.2e-56
WP_001087408.1|2575293_2575575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080161071.1|2575575_2576787_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_001219170.1|2577175_2577520_-	gamma-glutamylcyclotransferase	NA	S0A0M5	Cellulophaga_phage	34.6	1.0e-07
>prophage 195
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2611543	2615969	4505366		Lactococcus_phage(50.0%)	3	NA	NA
WP_038397095.1|2611543_2613988_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.8	1.3e-67
WP_001177646.1|2614025_2614451_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527941.1|2614670_2615969_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.2	1.9e-65
>prophage 196
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2621516	2624693	4505366		Wolbachia_phage(50.0%)	2	NA	NA
WP_171776270.1|2621516_2623367_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.2	7.1e-58
WP_079781484.1|2623376_2624693_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	29.6	1.8e-15
>prophage 197
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2629606	2630152	4505366		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001271546.1|2629606_2630152_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	41.6	4.5e-29
>prophage 198
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2637964	2638942	4505366		Tupanvirus(100.0%)	1	NA	NA
WP_000004801.1|2637964_2638942_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	29.1	9.9e-27
>prophage 199
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2642669	2643203	4505366		Morganella_phage(100.0%)	1	NA	NA
WP_001238394.1|2642669_2643203_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	8.0e-47
>prophage 200
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2648282	2650266	4505366		Vibrio_phage(50.0%)	2	NA	NA
WP_000719109.1|2648282_2649929_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.7	2.6e-189
WP_000027827.1|2649972_2650266_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	43.3	1.2e-12
>prophage 201
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2658611	2662098	4505366	integrase	Pseudomonas_phage(50.0%)	2	2655082:2655095	2662302:2662315
2655082:2655095	attL	AAAGCGGGGATGAG	NA	NA	NA	NA
WP_001131487.1|2658611_2659871_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	43.6	4.0e-81
WP_024132048.1|2661882_2662098_-	helix-turn-helix domain-containing protein	NA	A0A2I7S995	Vibrio_phage	60.6	5.9e-17
2662302:2662315	attR	AAAGCGGGGATGAG	NA	NA	NA	NA
>prophage 202
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2672837	2674808	4505366		Pithovirus(100.0%)	1	NA	NA
WP_079829248.1|2672837_2674808_-	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	24.5	2.1e-07
>prophage 203
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2691932	2696440	4505366		Escherichia_phage(100.0%)	4	NA	NA
WP_072160231.1|2691932_2692586_-	molecular chaperone	NA	A0A077SLS7	Escherichia_phage	72.4	6.1e-81
WP_000544909.1|2692601_2693375_-	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	78.7	1.4e-100
WP_080161079.1|2693367_2693994_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	91.8	2.4e-119
WP_000403107.1|2694007_2696440_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	81.2	0.0e+00
>prophage 204
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2703912	2705484	4505366		Tupanvirus(100.0%)	1	NA	NA
WP_079781951.1|2703912_2705484_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	27.7	7.4e-40
>prophage 205
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2723906	2728946	4505366		Bacillus_phage(33.33%)	6	NA	NA
WP_038397152.1|2723906_2724977_+	two-component system sensor histidine kinase PmrB	NA	W8CYF6	Bacillus_phage	24.8	1.3e-08
WP_000844408.1|2724985_2725075_-	LpxT activity modulator PmrR	NA	NA	NA	NA	NA
WP_038397153.1|2725144_2726647_-	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	30.5	2.7e-55
WP_038397154.1|2727126_2727462_+	phnA family protein	NA	NA	NA	NA	NA
WP_038397155.1|2727581_2728025_+	VOC family metalloprotein YjdN	NA	NA	NA	NA	NA
WP_079799567.1|2728157_2728946_+	phosphonate ABC transporter ATP-binding protein	NA	W5SAS9	Pithovirus	28.8	9.5e-12
>prophage 206
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2733843	2735390	4505366		Bacillus_virus(50.0%)	2	NA	NA
WP_000193408.1|2733843_2734602_+	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	27.3	1.5e-14
WP_000621683.1|2734709_2735390_+	phosphonate C-P lyase system protein PhnL	NA	F2Y1V6	Organic_Lake_phycodnavirus	24.9	6.7e-06
>prophage 207
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2738607	2740593	4505366		Tetraselmis_virus(100.0%)	1	NA	NA
WP_080161082.1|2738607_2740593_+	MBL fold metallo-hydrolase	NA	A0A2P0VMX1	Tetraselmis_virus	43.5	3.5e-148
>prophage 208
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2745773	2747921	4505366		Escherichia_phage(100.0%)	1	NA	NA
WP_077905510.1|2745773_2747921_+	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	24.6	4.5e-32
>prophage 209
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2757405	2759364	4505366		Staphylococcus_phage(100.0%)	1	NA	NA
WP_079827948.1|2757405_2759364_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.0	2.8e-89
>prophage 210
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2765526	2766876	4505366		Moraxella_phage(100.0%)	1	NA	NA
WP_000106909.1|2765526_2766876_-	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.1	1.5e-158
>prophage 211
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2773012	2775079	4505366		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000379943.1|2773012_2775079_-	peptidase domain-containing ABC transporter	NA	F2Y2R6	Organic_Lake_phycodnavirus	23.7	1.0e-12
>prophage 212
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2803333	2806937	4505366		Enterobacteria_phage(50.0%)	2	NA	NA
WP_000168328.1|2803333_2803864_-	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	88.9	3.9e-54
WP_000357718.1|2804111_2806937_+	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	55.8	0.0e+00
>prophage 213
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2811029	2813556	4505366		Yellowstone_lake_mimivirus(50.0%)	2	NA	NA
WP_080161173.1|2811029_2812109_-	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	29.3	8.1e-30
WP_000918370.1|2812140_2813556_-	replicative DNA helicase	NA	A0A1B0VG30	Salmonella_phage	78.4	7.0e-199
>prophage 214
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2822156	2822765	4505366		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646079.1|2822156_2822765_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 215
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2830022	2831132	4505366		Mycoplasma_phage(100.0%)	1	NA	NA
WP_079782316.1|2830022_2831132_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	47.2	6.2e-17
>prophage 216
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2849973	2853657	4505366		Dickeya_phage(100.0%)	1	NA	NA
WP_079903990.1|2849973_2853657_-	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.7e-26
>prophage 217
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2867497	2869087	4505366		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_038397219.1|2867497_2869087_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	4.2e-67
>prophage 218
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2874610	2876373	4505366		Bacillus_phage(50.0%)	3	NA	NA
WP_001044509.1|2874610_2874883_-	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	57.8	5.5e-20
WP_000940089.1|2875069_2875660_-	YjaG family protein	NA	NA	NA	NA	NA
WP_000362358.1|2875701_2876373_-	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	2.1e-20
>prophage 219
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2885856	2897344	4505366		Salmonella_phage(33.33%)	4	NA	NA
WP_079828753.1|2885856_2886885_-	type III secretion system effector arginine glycosyltransferase SseK1	NA	Q8HAB2	Salmonella_phage	60.5	4.7e-104
WP_141029345.1|2887427_2888105_+	NleE/OspZ family T3SS effector cysteine methyltransferase	NA	NA	NA	NA	NA
WP_171776276.1|2889054_2893239_-	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	27.1	6.5e-67
WP_000263105.1|2893315_2897344_-	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
>prophage 220
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2901343	2904435	4505366		Tupanvirus(50.0%)	3	NA	NA
WP_000031748.1|2901343_2902528_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
WP_038397233.1|2903102_2903276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058346079.1|2903484_2904435_+	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	3.0e-28
>prophage 221
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2913144	2914989	4505366		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591410.1|2913144_2914989_-	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	29.4	3.8e-11
>prophage 222
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2931131	2931794	4505366		Synechococcus_phage(100.0%)	1	NA	NA
WP_058346036.1|2931131_2931794_+	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.1	2.5e-29
>prophage 223
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2952110	2956719	4505366		Erwinia_phage(50.0%)	5	NA	NA
WP_038397250.1|2952110_2953442_+	HslU--HslV peptidase ATPase subunit	NA	W6AS21	Erwinia_phage	28.3	1.4e-44
WP_000139643.1|2953508_2954438_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000872920.1|2954530_2955016_+	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000051365.1|2955237_2955477_-	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_079829235.1|2955873_2956719_+	aquaporin	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	29.7	5.2e-16
>prophage 224
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2971555	2975085	4505366		Feldmannia_irregularis_virus(33.33%)	4	NA	NA
WP_038397257.1|2971555_2972254_+	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
WP_000580434.1|2972250_2973624_+	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.6	1.1e-15
WP_000559239.1|2973723_2974395_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_079829231.1|2974464_2975085_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.9	1.1e-63
>prophage 225
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	2993349	2997524	4505366		Lactobacillus_phage(50.0%)	3	NA	NA
WP_000873051.1|2993349_2993976_+	hypothetical protein	NA	A0A0A7NNQ5	Lactobacillus_phage	42.4	4.7e-06
WP_000488564.1|2994157_2995432_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_079828369.1|2995424_2997524_+	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.1	1.4e-38
>prophage 226
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3006136	3009187	4505366		Escherichia_phage(100.0%)	1	NA	NA
WP_077946856.1|3006136_3009187_+	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	24.3	1.3e-05
>prophage 227
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3012527	3013442	4505366		Tupanvirus(100.0%)	1	NA	NA
WP_171776278.1|3012527_3013442_+	alpha/beta hydrolase	NA	A0A2K9L5W3	Tupanvirus	55.8	2.1e-07
>prophage 228
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3016543	3019337	4505366		Escherichia_phage(50.0%)	2	NA	NA
WP_000059685.1|3016543_3017347_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.4	3.8e-24
WP_000268247.1|3018440_3019337_+	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	99.2	2.6e-66
>prophage 229
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3032045	3034513	4505366		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000190540.1|3032045_3033095_+	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	24.8	2.9e-08
WP_012210755.1|3033103_3034513_+	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	27.9	6.9e-05
>prophage 230
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3038430	3041217	4505366		Enterococcus_phage(100.0%)	1	NA	NA
WP_079782304.1|3038430_3041217_-	DNA polymerase I	NA	A0A0C5K9B9	Enterococcus_phage	27.0	2.2e-47
>prophage 231
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3053321	3053936	4505366		Streptococcus_phage(100.0%)	1	NA	NA
WP_000378897.1|3053321_3053936_-	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	39.3	6.2e-19
>prophage 232
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3062776	3066211	4505366		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000257557.1|3062776_3063556_-	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	30.7	1.1e-25
WP_000459614.1|3063558_3064107_-	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000508972.1|3064110_3064365_-	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000187525.1|3064570_3066211_-	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	5.3e-41
>prophage 233
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3080505	3082335	4505366		Catovirus(100.0%)	1	NA	NA
WP_024132071.1|3080505_3082335_-	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.4	3.4e-81
>prophage 234
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3087898	3091815	4505366		Bacillus_phage(100.0%)	3	NA	NA
WP_000383436.1|3087898_3090061_-	DNA helicase II	NA	A7KV33	Bacillus_phage	37.1	1.7e-116
WP_038397321.1|3090196_3090913_-	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000132873.1|3090912_3091815_-	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	31.0	1.7e-25
>prophage 235
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3108253	3114410	4505366		Enterobacteria_phage(40.0%)	6	NA	NA
WP_000612086.1|3108253_3109384_-	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	42.5	1.5e-18
WP_058346017.1|3109388_3110066_-	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_038397330.1|3110043_3110925_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.0	3.9e-107
WP_038397331.1|3110953_3112021_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	1.4e-98
WP_038397332.1|3112020_3113283_-	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1H3J6	Paramecium_bursaria_Chlorella_virus	27.4	3.1e-25
WP_038397333.1|3113279_3114410_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	27.7	3.0e-27
>prophage 236
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3118544	3123819	4505366		Indivirus(33.33%)	4	NA	NA
WP_001280776.1|3118544_3118874_-	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
WP_000047529.1|3119017_3120283_+	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.7	2.2e-42
WP_038397336.1|3120294_3121779_+	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_038397337.1|3121794_3123819_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.8	1.7e-113
>prophage 237
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3133924	3135571	4505366		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_079828680.1|3133924_3135571_-	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	2.0e-64
>prophage 238
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3146831	3151151	4505366	tRNA	Pandoravirus(33.33%)	6	NA	NA
WP_038397510.1|3146831_3147404_-	L-threonylcarbamoyladenylate synthase type 1 TsaC	NA	S4VW33	Pandoravirus	26.7	6.9e-12
WP_001086025.1|3147393_3147951_-	topoisomerase DNA-binding C4 zinc finger domain-containing protein	NA	NA	NA	NA	NA
WP_024132108.1|3147977_3148451_-	DUF494 domain-containing protein	NA	NA	NA	NA	NA
WP_000198664.1|3148422_3149547_-	DNA-protecting protein DprA	NA	NA	NA	NA	NA
WP_000114995.1|3149678_3150188_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.1	5.1e-19
WP_038397509.1|3150203_3151151_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.9	8.4e-07
>prophage 239
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3171049	3176620	4505366		Tupanvirus(33.33%)	7	NA	NA
WP_000031748.1|3171049_3172234_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.5	2.6e-13
WP_000124693.1|3172305_3174420_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	8.1e-58
WP_035894363.1|3174516_3174987_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|3175082_3175457_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903398.1|3175582_3175870_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820709.1|3175877_3176234_-	sulfurtransferase complex subunit TusC	NA	NA	NA	NA	NA
WP_001268007.1|3176233_3176620_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	6.0e-20
>prophage 240
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3182351	3187763	4505366		Tupanvirus(50.0%)	5	NA	NA
WP_080160976.1|3182351_3184256_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	33.5	4.2e-74
WP_000117013.1|3184273_3185206_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000697269.1|3185285_3186182_-	malonate decarboxylase subunit epsilon	NA	NA	NA	NA	NA
WP_001098397.1|3186182_3186800_-	malonate decarboxylase holo-ACP synthase	NA	NA	NA	NA	NA
WP_000222845.1|3186803_3187763_-	AEC family transporter	NA	A0A0U2C0Y4	Salmonella_phage	98.4	1.1e-57
>prophage 241
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3196804	3200801	4505366		environmental_Halophage(50.0%)	3	NA	NA
WP_079827391.1|3196804_3198892_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	89.1	4.2e-67
WP_079827392.1|3198934_3200152_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_038397489.1|3200237_3200801_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	4.2e-62
>prophage 242
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3211859	3212696	4505366		Vibrio_phage(100.0%)	1	NA	NA
WP_000742127.1|3211859_3212696_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.5	2.9e-67
>prophage 243
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3229713	3233504	4505366		Bacillus_phage(66.67%)	3	NA	NA
WP_001265686.1|3229713_3231333_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	53.5	5.3e-142
WP_012210857.1|3231435_3232788_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	22.5	8.1e-11
WP_001157751.1|3232784_3233504_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 244
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3246719	3249113	4505366		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_171776281.1|3246719_3249113_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	40.2	4.7e-14
>prophage 245
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3256375	3258823	4505366		Dickeya_phage(100.0%)	1	NA	NA
WP_000993429.1|3256375_3258823_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	82.1	3.6e-33
>prophage 246
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3274734	3276542	4505366		Enterococcus_phage(50.0%)	2	NA	NA
WP_079781276.1|3274734_3275475_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	26.5	4.0e-12
WP_038397457.1|3275471_3276542_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.5	2.0e-20
>prophage 247
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3280275	3281758	4505366		Planktothrix_phage(50.0%)	2	NA	NA
WP_079781278.1|3280275_3280989_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	32.4	2.8e-15
WP_079781279.1|3280990_3281758_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	A0A2R8FG22	Brazilian_cedratvirus	27.1	7.5e-14
>prophage 248
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3287385	3290205	4505366		Salicola_phage(50.0%)	3	NA	NA
WP_000159619.1|3287385_3288240_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	42.3	7.0e-45
WP_038397453.1|3288485_3289544_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617715.1|3289536_3290205_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.2	1.1e-13
>prophage 249
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3293209	3299058	4505366		Dickeya_phage(40.0%)	5	NA	NA
WP_080160969.1|3293209_3293836_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	62.8	1.9e-31
WP_171776283.1|3293916_3296115_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	36.9	3.2e-118
WP_038397449.1|3296310_3297954_+	methyl-accepting chemotaxis citrate transducer	NA	A0A2H4J162	uncultured_Caudovirales_phage	30.3	5.9e-16
WP_038397893.1|3297977_3298223_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	6.1e-10
WP_024132095.1|3298392_3299058_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	55.3	9.6e-58
>prophage 250
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3312560	3314603	4505366		Indivirus(100.0%)	1	NA	NA
WP_000184167.1|3312560_3314603_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.4	5.6e-48
>prophage 251
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3327726	3330220	4505366		Bacteriophage(50.0%)	3	NA	NA
WP_001120245.1|3327726_3328077_+	lysozyme	NA	B6SD02	Bacteriophage	36.3	1.4e-07
WP_038397435.1|3328088_3328691_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_024132094.1|3329320_3330220_+	LysR family transcriptional regulator	NA	Q6JIH3	Burkholderia_virus	26.2	3.6e-07
>prophage 252
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3358873	3360867	4505366		Bacillus_virus(50.0%)	2	NA	NA
WP_000103569.1|3358873_3359887_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	28.9	2.1e-16
WP_001196447.1|3359883_3360867_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.2	6.7e-15
>prophage 253
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3369194	3371528	4505366		Escherichia_phage(100.0%)	1	NA	NA
WP_079832549.1|3369194_3371528_-	molybdopterin guanine dinucleotide-containing S/N-oxide reductase	NA	A0A077SK27	Escherichia_phage	30.5	2.0e-70
>prophage 254
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3374736	3374949	4505366		Morganella_phage(100.0%)	1	NA	NA
WP_000014593.1|3374736_3374949_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
>prophage 255
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3378568	3378913	4505366	integrase,transposase	Macacine_betaherpesvirus(100.0%)	1	3370315:3370329	3381375:3381389
3370315:3370329	attL	GGGTTTTCCAGCGCC	NA	NA	NA	NA
WP_012210821.1|3378568_3378913_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2I6AZV9	Macacine_betaherpesvirus	63.2	2.3e-23
WP_012210821.1|3378568_3378913_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2I6AZV9	Macacine_betaherpesvirus	63.2	2.3e-23
3381375:3381389	attR	GGGTTTTCCAGCGCC	NA	NA	NA	NA
>prophage 256
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3382699	3383695	4505366		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_079827432.1|3382699_3383695_+	acyltransferase	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	27.5	6.3e-13
>prophage 257
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3396391	3398251	4505366		Tupanvirus(100.0%)	1	NA	NA
WP_080160958.1|3396391_3398251_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	25.5	1.8e-13
>prophage 258
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3404612	3406151	4505366		Vibrio_phage(100.0%)	1	NA	NA
WP_000088636.1|3404612_3406151_-	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	41.7	1.5e-08
>prophage 259
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3424859	3434360	4505366		Rhizobium_phage(16.67%)	9	NA	NA
WP_001273795.1|3424859_3425111_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	53.4	2.2e-15
WP_001156179.1|3425196_3425628_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116580.1|3425875_3427420_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_058344896.1|3427429_3428713_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	30.3	6.1e-08
WP_079903615.1|3428716_3429679_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_080160953.1|3429665_3430700_-	glycosyltransferase	NA	A0A1V0SAH6	Catovirus	31.3	1.4e-07
WP_000646000.1|3430993_3432019_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213790.1|3432028_3433225_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.0	1.9e-35
WP_000587783.1|3433427_3434360_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	37.2	1.5e-35
>prophage 260
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3448549	3453091	4505366		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171889.1|3448549_3449029_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	43.2	4.4e-28
WP_058344885.1|3449052_3449862_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	31.7	1.0e-24
WP_001051798.1|3449959_3450127_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_001519051.1|3450140_3450377_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_000380122.1|3450593_3451259_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_164967348.1|3451434_3452655_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.6	4.2e-43
WP_000976080.1|3452632_3453091_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	60.1	9.6e-49
>prophage 261
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3459075	3464101	4505366		Pseudomonas_phage(33.33%)	4	NA	NA
WP_080160951.1|3459075_3460761_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.0	8.2e-21
WP_000046966.1|3461017_3461641_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	35.6	2.8e-19
WP_000135058.1|3461695_3461971_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_171776286.1|3461989_3464101_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
>prophage 262
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3468598	3469990	4505366		environmental_Halophage(100.0%)	1	NA	NA
WP_080160947.1|3468598_3469990_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	95.2	8.7e-69
>prophage 263
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3482708	3486348	4505366		Only_Syngen_Nebraska_virus(50.0%)	2	NA	NA
WP_171776287.1|3482708_3485435_-	magnesium-translocating P-type ATPase	NA	A0A1J0FA34	Only_Syngen_Nebraska_virus	24.7	7.5e-40
WP_012210793.1|3485652_3486348_-	MgtC family protein	NA	G3MA03	Bacillus_virus	43.8	1.2e-15
>prophage 264
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3500170	3505050	4505366		Micromonas_pusilla_virus(50.0%)	5	NA	NA
WP_079798670.1|3500170_3501859_-	acetolactate synthase large subunit	NA	G8DDL3	Micromonas_pusilla_virus	30.5	1.2e-56
WP_012210789.1|3501965_3502064_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_000117642.1|3502620_3502710_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_079827450.1|3502802_3503663_+	EamA family transporter	NA	NA	NA	NA	NA
WP_079798671.1|3503865_3505050_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	24.1	2.2e-12
>prophage 265
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3509434	3512640	4505366		Tupanvirus(50.0%)	2	NA	NA
WP_038397367.1|3509434_3510928_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L727	Tupanvirus	28.6	1.6e-28
WP_001056754.1|3510924_3512640_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.0	2.1e-40
>prophage 266
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3516914	3517865	4505366		Synechococcus_phage(50.0%)	2	NA	NA
WP_001246917.1|3516914_3517343_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	38.2	3.8e-15
WP_023186035.1|3517451_3517865_-	heat shock chaperone IbpA	NA	A0A2L0V0Y9	Agrobacterium_phage	44.7	2.1e-18
>prophage 267
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3525539	3546700	4505366		Staphylococcus_phage(28.57%)	17	NA	NA
WP_038395206.1|3525539_3526160_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	A0A2H4PQG7	Staphylococcus_phage	27.6	4.7e-14
WP_000595426.1|3527754_3528387_-	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_080161291.1|3528379_3530932_-	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	31.1	2.8e-73
WP_038397360.1|3530921_3532106_-	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_024132082.1|3532235_3532928_+	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.4	4.5e-18
WP_001202032.1|3532900_3533941_-	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_038397359.1|3534020_3536759_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	30.9	4.7e-34
WP_080161290.1|3537005_3537407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134940538.1|3537614_3537728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985566.1|3538112_3538934_-	sugar-phosphatase	NA	NA	NA	NA	NA
WP_000072049.1|3539142_3541557_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.2	6.3e-115
WP_079782217.1|3541585_3542659_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673474.1|3542797_3543898_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	34.7	4.1e-53
WP_024132081.1|3543902_3545300_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_000831330.1|3545962_3546103_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_012210778.1|3546119_3546479_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_024132079.1|3546442_3546700_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	55.2	2.1e-16
>prophage 268
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3553679	3564331	4505366		Moraxella_phage(20.0%)	9	NA	NA
WP_000082686.1|3553679_3555017_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	37.1	1.4e-63
WP_171776288.1|3555185_3555851_+	6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_000377794.1|3555894_3556620_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_134940536.1|3556634_3557435_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	29.6	1.0e-13
WP_000212191.1|3557504_3558395_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741630.1|3558394_3559354_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867133.1|3559479_3560520_-	phosphate ABC transporter substrate-binding protein PstS	NA	M4QHS4	Cyanophage	35.9	1.6e-46
WP_058345790.1|3560836_3562666_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	42.1	9.2e-127
WP_038397351.1|3562963_3564331_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	37.4	1.5e-33
>prophage 269
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3576276	3577269	4505366		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_080161287.1|3576276_3577269_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	38.0	3.2e-49
>prophage 270
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3580564	3586467	4505366		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_038397347.1|3580564_3582433_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	2.5e-63
WP_038397346.1|3582648_3583068_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_058819460.1|3583075_3584581_+	ribose ABC transporter ATP-binding protein RbsA	NA	A0A2H4PQG7	Staphylococcus_phage	24.6	1.5e-13
WP_079776435.1|3584586_3585552_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056266.1|3585576_3586467_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	25.0	7.4e-05
>prophage 271
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3604058	3604943	4505366		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_000642615.1|3604058_3604943_-	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	32.1	1.9e-24
>prophage 272
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3619830	3620874	4505366		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3619830_3620874_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 273
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3638966	3640334	4505366	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_012210888.1|3638966_3640334_-|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	5.1e-21
>prophage 274
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3644298	3648334	4505366	protease	Pseudomonas_phage(50.0%)	4	NA	NA
WP_000366115.1|3644298_3644799_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	56.9	1.9e-26
WP_038397537.1|3644908_3645700_+	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_038397539.1|3645834_3646728_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000108077.1|3646843_3648334_+	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.5	1.6e-07
>prophage 275
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3661036	3675942	4505366		Staphylococcus_phage(25.0%)	17	NA	NA
WP_058345470.1|3661036_3661966_+	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	34.2	2.0e-16
WP_000809806.1|3662059_3664396_+	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	30.6	4.6e-38
WP_171776290.1|3664622_3665276_+	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_079781834.1|3665272_3666001_+	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_000612655.1|3666084_3666717_-	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000216790.1|3666956_3667229_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000243747.1|3667225_3668080_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.4e-05
WP_000609330.1|3668125_3668617_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_001176592.1|3668734_3669022_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_000809016.1|3669044_3670478_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_079799049.1|3670525_3671251_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	7.1e-22
WP_000669766.1|3671257_3671812_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000047848.1|3671780_3672356_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000030024.1|3672352_3672919_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	74.8	1.2e-53
WP_000018623.1|3672939_3673926_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	30.8	2.5e-38
WP_000922738.1|3673939_3674917_-	calcium/sodium antiporter	NA	A0A2D1GNI8	Pseudoalteromonas_phage	24.6	4.3e-06
WP_000531682.1|3675129_3675942_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	30.7	2.6e-20
>prophage 276
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3680068	3681547	4505366		Vibrio_phage(50.0%)	2	NA	NA
WP_000444165.1|3680068_3680350_-	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	5.9e-17
WP_001047356.1|3680575_3681547_-	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.4	1.7e-07
>prophage 277
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3688272	3700005	4505366	protease	Micromonas_pusilla_virus(25.0%)	8	NA	NA
WP_001107481.1|3688272_3690207_+|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.3	9.2e-117
WP_000764706.1|3690310_3691159_+	dihydropteroate synthase	NA	S4W084	Pandoravirus	30.3	1.4e-21
WP_000071157.1|3691151_3692489_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_000272681.1|3692710_3693043_+	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_079832912.1|3693336_3694686_-	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	91.3	2.0e-62
WP_000105461.1|3695316_3695769_+	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001031042.1|3695796_3697299_+	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000133074.1|3697323_3700005_+	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.1	7.4e-24
>prophage 278
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3705477	3707376	4505366		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000807237.1|3705477_3707376_+	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	7.7e-52
>prophage 279
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3713082	3719736	4505366		Invertebrate_iridovirus(25.0%)	9	NA	NA
WP_072159250.1|3713082_3713400_-	GIY-YIG nuclease family protein	NA	S6DF82	Invertebrate_iridovirus	50.0	6.5e-12
WP_038397573.1|3713437_3713881_+	YhbP family protein	NA	NA	NA	NA	NA
WP_038397574.1|3713860_3714379_-	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.6	2.6e-10
WP_038397576.1|3714506_3715142_+	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_038397577.1|3715208_3715784_-	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000893481.1|3715793_3716384_-	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.9	7.1e-12
WP_000057288.1|3716405_3716801_-	YraN family protein	NA	NA	NA	NA	NA
WP_038397578.1|3716758_3718810_-	penicillin-binding protein activator	NA	NA	NA	NA	NA
WP_000812282.1|3718872_3719736_+	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	42.6	1.1e-50
>prophage 280
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3730015	3731161	4505366		Streptococcus_phage(100.0%)	1	NA	NA
WP_079828510.1|3730015_3731161_+	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	40.9	2.4e-48
>prophage 281
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3738288	3740583	4505366		Tetraselmis_virus(100.0%)	1	NA	NA
WP_038397587.1|3738288_3740583_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	40.7	2.4e-156
>prophage 282
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3749515	3751825	4505366		Pseudomonas_phage(100.0%)	1	NA	NA
WP_115399439.1|3749515_3751825_-	N-acetylmuramidase family protein	NA	A0A142IF03	Pseudomonas_phage	40.5	4.0e-26
>prophage 283
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3758901	3759870	4505366		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001098841.1|3758901_3759870_-	TerC family protein	NA	I7HPH5	Enterobacteria_phage	34.6	1.5e-38
>prophage 284
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3765278	3782352	4505366	tRNA	Klosneuvirus(14.29%)	14	NA	NA
WP_079828609.1|3765278_3766658_-	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.5	9.3e-31
WP_171776293.1|3767086_3768607_+	PAS domain-containing protein	NA	A0A1B0V854	Salmonella_phage	48.5	1.2e-34
WP_000478451.1|3769009_3770575_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	28.1	6.5e-12
WP_103143120.1|3770571_3771222_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_058819756.1|3771451_3772219_+	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_038397606.1|3772815_3773322_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_000437365.1|3773444_3775292_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.4e-35
WP_038397607.1|3775441_3777187_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.2	2.1e-72
WP_001144069.1|3777404_3777620_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_038397608.1|3777847_3778861_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.5	1.1e-108
WP_001272781.1|3779050_3779668_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_000355773.1|3779774_3780134_+	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_079828607.1|3780230_3781052_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_171776294.1|3781110_3782352_-	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.7	1.9e-91
>prophage 285
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3787582	3791351	4505366		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_000867673.1|3787582_3789016_+	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	1.0e-40
WP_159426482.1|3789173_3789359_-	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_000928917.1|3789679_3789889_+	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_000566821.1|3789962_3790259_-	accessory factor UbiK family protein	NA	NA	NA	NA	NA
WP_001076980.1|3790697_3791351_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	42.6	2.9e-43
>prophage 286
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3796814	3798652	4505366		Ralstonia_phage(50.0%)	2	NA	NA
WP_000442837.1|3796814_3797975_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	8.3e-89
WP_000831527.1|3797980_3798652_-	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	47.8	4.4e-42
>prophage 287
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3803057	3804950	4505366		Bacillus_virus(100.0%)	1	NA	NA
WP_038397614.1|3803057_3804950_+	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	34.9	1.2e-92
>prophage 288
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3808266	3818838	4505366		Stx_converting_phage(20.0%)	8	NA	NA
WP_000731555.1|3808266_3808659_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	48.6	3.6e-20
WP_080160929.1|3808788_3811047_+	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.3	1.3e-85
WP_080160930.1|3811303_3812041_+	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_000010651.1|3812115_3813528_+	cell division protein FtsP	NA	NA	NA	NA	NA
WP_080160931.1|3813636_3815808_+	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	71.2	4.5e-104
WP_058819745.1|3815852_3816314_-	HIT family protein	NA	Q5YEY9	Rock_bream_iridovirus	38.9	3.4e-22
WP_000818487.1|3816358_3817813_-	DASS family sodium-coupled anion symporter	NA	NA	NA	NA	NA
WP_038397620.1|3818010_3818838_-	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	46.0	5.5e-63
>prophage 289
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3824777	3829697	4505366		Diadromus_pulchellus_ascovirus(50.0%)	5	NA	NA
WP_080160932.1|3824777_3825662_-	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.8	7.5e-66
WP_000665649.1|3825785_3826190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038397623.1|3826176_3826587_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077916604.1|3826677_3827193_+	RNA helicase	NA	NA	NA	NA	NA
WP_058345426.1|3828053_3829697_+	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	56.7	1.4e-09
>prophage 290
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3843431	3844904	4505366		Micromonas_pusilla_virus(100.0%)	1	NA	NA
WP_079781469.1|3843431_3844904_-	fructuronate reductase	NA	G9E6E2	Micromonas_pusilla_virus	28.7	3.5e-44
>prophage 291
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3848510	3849389	4505366		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000197724.1|3848510_3849389_+	carbon-nitrogen hydrolase family protein	NA	M1HPY5	Paramecium_bursaria_Chlorella_virus	25.4	7.3e-05
>prophage 292
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3867867	3873042	4505366		Bacteriophage(100.0%)	3	NA	NA
WP_079798888.1|3867867_3870156_+	hypothetical protein	NA	A0A1W5K0N1	Bacteriophage	30.8	1.0e-74
WP_079798889.1|3870137_3871763_+	RHS repeat protein	NA	B6SD27	Bacteriophage	30.1	1.7e-63
WP_058346002.1|3871818_3873042_+	RHS repeat-associated core domain-containing protein	NA	A0A1W5K0N1	Bacteriophage	38.6	3.8e-28
>prophage 293
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3883615	3884701	4505366		Geobacillus_virus(100.0%)	1	NA	NA
WP_079798914.1|3883615_3884701_-	membrane-bound lytic murein transglycosylase MltC	NA	A0A0H3V0Q1	Geobacillus_virus	39.0	5.8e-12
>prophage 294
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3900848	3902003	4505366		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062142.1|3900848_3902003_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	64.2	6.6e-131
>prophage 295
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3914706	3915396	4505366		Bacillus_virus(100.0%)	1	NA	NA
WP_080161276.1|3914706_3915396_-	ATP-binding cassette domain-containing protein	NA	G3M9Y6	Bacillus_virus	28.6	2.0e-10
>prophage 296
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3932987	3934220	4505366		Catovirus(100.0%)	1	NA	NA
WP_001151633.1|3932987_3934220_+	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	47.6	6.9e-102
>prophage 297
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3942295	3946724	4505366		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_038397687.1|3942295_3945169_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	50.8	6.9e-262
WP_000737104.1|3945290_3946724_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	4.4e-31
>prophage 298
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3950693	3961960	4505366	integrase,tRNA	Bacillus_phage(33.33%)	11	3958568:3958593	3964054:3964079
WP_000434304.1|3950693_3951590_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.9	2.3e-30
WP_080161281.1|3951613_3952327_+	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_079828655.1|3952332_3954066_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.4	5.2e-63
WP_103143145.1|3954169_3955267_+	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000003336.1|3955277_3956795_+|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	37.1	1.7e-89
WP_000133987.1|3956866_3957415_-	isopentenyl-diphosphate Delta-isomerase	NA	NA	NA	NA	NA
WP_038397690.1|3957685_3958438_+	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	39.5	1.2e-11
3958568:3958593	attL	GTTCGATTCCCTTCGCCCGCTCCAGA	NA	NA	NA	NA
WP_079798890.1|3959401_3960559_-	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_000816357.1|3960738_3961062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000236392.1|3961178_3961388_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024132134.1|3961381_3961960_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	24.9	5.9e-11
3964054:3964079	attR	GTTCGATTCCCTTCGCCCGCTCCAGA	NA	NA	NA	NA
>prophage 299
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3966910	3967441	4505366		Salmonella_phage(100.0%)	1	NA	NA
WP_000748438.1|3966910_3967441_+	superoxide dismutase [Cu-Zn]	NA	Q9MC02	Salmonella_phage	46.6	1.3e-36
>prophage 300
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3978014	3980665	4505366		Trichoplusia_ni_ascovirus(50.0%)	3	NA	NA
WP_000602487.1|3978014_3978776_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	2.0e-19
WP_128971925.1|3978753_3978999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000253653.1|3979246_3980665_+	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.5	2.1e-25
>prophage 301
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	3990739	3997641	4505366		Moraxella_phage(33.33%)	6	NA	NA
WP_000895633.1|3990739_3991453_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.7	6.9e-46
WP_080161221.1|3991581_3992277_-	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000564482.1|3992959_3993490_+	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000957876.1|3993502_3995749_+	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	25.7	7.9e-11
WP_171776303.1|3995964_3996840_+	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000816224.1|3996846_3997641_+	thymidylate synthase	NA	R4IFY1	Cronobacter_phage	62.6	4.4e-118
>prophage 302
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4003119	4019684	4505366	tRNA	Klosneuvirus(16.67%)	10	NA	NA
WP_058345950.1|4003119_4006008_+	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	23.6	4.3e-62
WP_079829215.1|4006000_4009546_+	exodeoxyribonuclease V subunit beta	NA	A0A068EQC7	Bacillus_phage	21.4	1.1e-06
WP_080161217.1|4009542_4011378_+	exodeoxyribonuclease V subunit alpha	NA	A0A2P0VMS9	Tetraselmis_virus	25.0	2.4e-18
WP_000588972.1|4011481_4012813_-	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_012210975.1|4013045_4014299_+	N-acetylmuramoyl-L-alanine amidase AmiC	NA	E5DV68	Deep-sea_thermophilic_phage	28.0	4.2e-14
WP_079782084.1|4014798_4015896_+	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000117754.1|4016005_4016812_+|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	32.8	1.7e-16
WP_012210976.1|4016867_4017755_-	EamA family transporter RarD	NA	NA	NA	NA	NA
WP_000211080.1|4018035_4018479_-	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000991071.1|4018478_4019684_-	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	35.5	2.1e-71
>prophage 303
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4031249	4032008	4505366		Bacillus_phage(100.0%)	1	NA	NA
WP_000268231.1|4031249_4032008_-	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	31.2	6.5e-10
>prophage 304
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4036901	4037750	4505366		Vibrio_phage(100.0%)	1	NA	NA
WP_038397718.1|4036901_4037750_-	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.5	6.1e-41
>prophage 305
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4045171	4050533	4505366		Streptococcus_phage(33.33%)	3	NA	NA
WP_079799300.1|4045171_4046314_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	40.6	2.0e-47
WP_000186469.1|4046423_4049180_-	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	29.3	2.3e-52
WP_000046841.1|4049237_4050533_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	28.5	4.3e-38
>prophage 306
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4053912	4059058	4505366		Only_Syngen_Nebraska_virus(33.33%)	3	NA	NA
WP_000210868.1|4053912_4055550_+	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.7	1.4e-153
WP_000036734.1|4055632_4056931_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.6	1.3e-130
WP_001199964.1|4058386_4059058_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	24.1	1.1e-13
>prophage 307
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4069076	4071108	4505366		Hokovirus(50.0%)	2	NA	NA
WP_058819870.1|4069076_4070516_+	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	26.3	4.7e-33
WP_001173650.1|4070502_4071108_+	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	39.7	1.7e-29
>prophage 308
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4074218	4077954	4505366		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_001221532.1|4074218_4074980_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.4	1.9e-57
WP_000254715.1|4074973_4075600_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.1	2.2e-35
WP_038394617.1|4075776_4076898_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	5.0e-06
WP_000081498.1|4076961_4077954_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
>prophage 309
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4084625	4087193	4505366		Catovirus(100.0%)	1	NA	NA
WP_038397721.1|4084625_4087193_-	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.2	2.5e-29
>prophage 310
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4091695	4092265	4505366		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000960105.1|4091695_4092265_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	50.8	1.5e-43
>prophage 311
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4100202	4105127	4505366	transposase	Wolbachia_phage(50.0%)	4	NA	NA
WP_171776306.1|4100202_4101543_+|transposase	IS110 family transposase	transposase	Q9JMN8	Wolbachia_phage	47.0	7.0e-116
WP_000715103.1|4101887_4102331_-	SPI-1 type III secretion system invasion lipoprotein InvH	NA	NA	NA	NA	NA
WP_072159337.1|4102788_4103439_+	AraC family transcriptional regulator InvF	NA	NA	NA	NA	NA
WP_058345861.1|4103435_4105127_+	type III secretion system outer membrane ring protein InvG	NA	R9TEZ5	Vibrio_phage	27.9	4.0e-15
>prophage 312
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4137251	4138073	4505366		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_058819062.1|4137251_4138073_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	A0A2R8FG22	Brazilian_cedratvirus	26.5	6.8e-13
>prophage 313
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4161129	4162095	4505366		Tetraselmis_virus(100.0%)	1	NA	NA
WP_038394712.1|4161129_4162095_-	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	34.8	8.0e-37
>prophage 314
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4167586	4173143	4505366	tRNA	Pseudomonas_phage(25.0%)	5	NA	NA
WP_024131773.1|4167586_4168084_+	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	51.0	8.8e-32
WP_000963149.1|4168168_4169230_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.8	4.0e-114
WP_001294855.1|4169346_4169847_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_058345880.1|4170092_4172723_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.4	7.1e-80
WP_000906486.1|4172957_4173143_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
>prophage 315
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4185045	4190101	4505366		Bacillus_virus(25.0%)	4	NA	NA
WP_080161147.1|4185045_4186248_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.8	1.4e-27
WP_079799642.1|4186603_4187563_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A0M4S3B4	Mycobacterium_phage	71.2	8.8e-129
WP_080161148.1|4187573_4189718_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	48.8	1.4e-195
WP_080161149.1|4189690_4190101_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	42.2	1.6e-15
>prophage 316
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4194672	4198678	4505366		Clostridium_phage(50.0%)	4	NA	NA
WP_000522408.1|4194672_4195122_+	peptidoglycan-binding protein LysM	NA	A0A090DBR9	Clostridium_phage	38.2	7.5e-06
WP_080161150.1|4195128_4195821_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000531292.1|4195864_4197265_-	GABA permease	NA	NA	NA	NA	NA
WP_038394744.1|4197394_4198678_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.4	3.0e-31
>prophage 317
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4219169	4222823	4505366		Bacillus_phage(100.0%)	1	NA	NA
WP_079835362.1|4219169_4222823_-	salmochelin/enterobactin export ABC transporter IroC	NA	W8CYL7	Bacillus_phage	31.0	3.2e-46
>prophage 318
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4227283	4233712	4505366		Phage_Gifsy-2(50.0%)	3	NA	NA
WP_171776312.1|4227283_4229470_+	E3 ubiquitin--protein ligase	NA	Q9MBL9	Phage_Gifsy-2	88.1	5.0e-71
WP_079829292.1|4230360_4231524_-	HlyD family type I secretion periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000196132.1|4231531_4233712_-	type I secretion system permease/ATPase	NA	F2Y302	Organic_Lake_phycodnavirus	34.5	5.8e-19
>prophage 319
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4247301	4247784	4505366		Staphylococcus_phage(100.0%)	1	NA	NA
WP_024131783.1|4247301_4247784_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	47.4	5.2e-29
>prophage 320
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4260955	4262026	4505366		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168062.1|4260955_4262026_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.8	2.4e-90
>prophage 321
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4270424	4272998	4505366		Enterobacteria_phage(100.0%)	1	NA	NA
WP_079833300.1|4270424_4272998_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	9.9e-127
>prophage 322
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4279017	4280878	4505366		Prochlorococcus_phage(50.0%)	2	NA	NA
WP_038394812.1|4279017_4279473_+	DUF4385 domain-containing protein	NA	E3SMI8	Prochlorococcus_phage	50.0	2.5e-33
WP_000807799.1|4279576_4280878_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	30.1	5.9e-43
>prophage 323
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4286177	4290796	4505366	tRNA	Achromobacter_phage(25.0%)	5	NA	NA
WP_001098734.1|4286177_4286597_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	41.7	5.2e-17
WP_058344705.1|4286800_4287838_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_000179980.1|4287956_4288646_-	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	49.1	3.9e-54
WP_000627811.1|4288964_4289348_+	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	74.0	6.1e-33
WP_038394827.1|4289461_4290796_-	ATP-dependent RNA helicase SrmB	NA	A0A1B1IS59	uncultured_Mediterranean_phage	29.7	2.1e-43
>prophage 324
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4296545	4309026	4505366	tail	Salmonella_phage(42.86%)	13	NA	NA
WP_048908581.1|4296545_4296752_-	DUF4060 family protein	NA	H6WRW9	Salmonella_phage	72.5	8.4e-13
WP_058819030.1|4296817_4297336_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	76.7	8.5e-62
WP_077946361.1|4297450_4297684_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	66.2	3.5e-23
WP_058819031.1|4297889_4298108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058344711.1|4299476_4301471_+	E3 ubiquitin--protein ligase	NA	Q9MBL9	Phage_Gifsy-2	83.9	2.2e-65
WP_012209904.1|4302151_4303951_+	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.2	1.2e-22
WP_038394854.1|4303967_4304942_+	signal peptidase I	NA	NA	NA	NA	NA
WP_001068341.1|4305215_4305896_+	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.8	7.4e-21
WP_000021199.1|4305892_4306798_+	GTPase Era	NA	NA	NA	NA	NA
WP_024131787.1|4306809_4307538_+	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000818961.1|4307549_4308281_+	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_038394857.1|4308280_4308676_+	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001196292.1|4308756_4309026_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	53.5	3.9e-18
>prophage 325
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4312092	4324310	4505366	tRNA	Bacillus_phage(40.0%)	9	NA	NA
WP_080160981.1|4312092_4312623_+|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	S4VYT2	Pandoravirus	30.2	5.8e-05
WP_038394880.1|4312658_4314203_-	membrane-bound lytic murein transglycosylase MltF	NA	NA	NA	NA	NA
WP_024131788.1|4314203_4314434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080160982.1|4314458_4318346_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	57.3	2.6e-126
WP_164504062.1|4318861_4320292_+	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	26.1	7.4e-15
WP_076915356.1|4320293_4321052_+	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_000625586.1|4321048_4322386_+	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	34.1	1.8e-10
WP_000717694.1|4322462_4322801_+	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_058819035.1|4322849_4324310_-	MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	28.8	4.9e-46
>prophage 326
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4331518	4332772	4505366		Aeromonas_phage(100.0%)	1	NA	NA
WP_080160984.1|4331518_4332772_+	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	53.9	1.3e-100
>prophage 327
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4342773	4349480	4505366		Faustovirus(20.0%)	8	NA	NA
WP_000775269.1|4342773_4343988_+	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	32.6	9.4e-35
WP_000331704.1|4344015_4344402_+	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	2.4e-53
WP_000028952.1|4344430_4344754_+	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	4.1e-22
WP_079903966.1|4345020_4345536_+	co-chaperone HscB	NA	NA	NA	NA	NA
WP_038394898.1|4345548_4347399_+	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	40.8	5.2e-101
WP_001124473.1|4347400_4347736_+	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_000523621.1|4347747_4347948_+	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_000133612.1|4348196_4349480_+	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	38.2	6.9e-36
>prophage 328
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4359205	4364454	4505366		Escherichia_phage(66.67%)	5	NA	NA
WP_077946156.1|4359205_4361611_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	37.8	2.3e-141
WP_000077446.1|4361607_4362237_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	54.9	8.8e-61
WP_058344728.1|4362229_4363039_+	dimethyl sulfoxide reductase anchor subunit family protein	NA	NA	NA	NA	NA
WP_079903963.1|4363038_4363902_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_080160987.1|4364022_4364454_+	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	36.4	4.1e-17
>prophage 329
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4375028	4378020	4505366		Bodo_saltans_virus(50.0%)	2	NA	NA
WP_012209920.1|4375028_4376393_-	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	34.2	1.1e-39
WP_000944174.1|4376553_4378020_+	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.0e-88
>prophage 330
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4388339	4388531	4505366		Escherichia_phage(100.0%)	1	NA	NA
WP_000075925.1|4388339_4388531_-	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	85.7	1.3e-23
>prophage 331
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4394994	4400265	4505366		Prochlorococcus_phage(25.0%)	6	NA	NA
WP_058115543.1|4394994_4395633_-	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	43.6	4.3e-31
WP_000130478.1|4395632_4396670_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	41.5	2.9e-69
WP_000706208.1|4397079_4397706_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_079827473.1|4397793_4399083_+	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.0	3.9e-63
WP_001192386.1|4399153_4399879_+	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_038394941.1|4399905_4400265_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	44.7	3.1e-18
>prophage 332
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4405849	4406989	4505366		Streptococcus_phage(100.0%)	1	NA	NA
WP_038394945.1|4405849_4406989_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.1	4.7e-44
>prophage 333
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4410336	4411050	4505366		Synechococcus_phage(100.0%)	1	NA	NA
WP_001171624.1|4410336_4411050_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	37.1	1.0e-36
>prophage 334
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4428613	4429564	4505366		Cyanophage(100.0%)	1	NA	NA
WP_001072454.1|4428613_4429564_-	transaldolase	NA	A0A127KMN5	Cyanophage	35.2	2.4e-09
>prophage 335
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4432572	4434225	4505366		Tetraselmis_virus(100.0%)	1	NA	NA
WP_079781986.1|4432572_4434225_+	sulfatase-like hydrolase/transferase	NA	A0A2P0VMN7	Tetraselmis_virus	29.4	2.3e-44
>prophage 336
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4451555	4456484	4505366		Paenibacillus_phage(33.33%)	6	NA	NA
WP_038394995.1|4451555_4452425_-	N-acetylmuramoyl-L-alanine amidase AmiA	NA	A0A0N9SGH1	Paenibacillus_phage	31.9	2.8e-17
WP_000406008.1|4452637_4453063_+	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000842930.1|4453049_4453499_+	DUF2919 domain-containing protein	NA	NA	NA	NA	NA
WP_171776316.1|4453559_4454135_+	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_038394999.1|4454229_4455129_+	Dyp-type peroxidase	NA	S4VVJ7	Pandoravirus	32.9	8.5e-25
WP_001022325.1|4455185_4456484_-	penicillin binding protein PBP4B	NA	A0A2K9VHZ2	Mycobacterium_phage	23.9	2.9e-10
>prophage 337
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4461719	4467455	4505366		Trichoplusia_ni_ascovirus(33.33%)	6	NA	NA
WP_038395008.1|4461719_4462511_+	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.2	2.9e-16
WP_000290194.1|4462667_4463684_+	sulfate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000880643.1|4463683_4464517_+	sulfate/thiosulfate ABC transporter permease CysT	NA	NA	NA	NA	NA
WP_079827487.1|4464516_4465392_+	sulfate/thiosulfate ABC transporter permease CysW	NA	NA	NA	NA	NA
WP_058819480.1|4465381_4466476_+	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G9BWD6	Planktothrix_phage	38.0	5.9e-28
WP_001093893.1|4466543_4467455_+	cysteine synthase CysM	NA	A0A1X9I5F1	Streptococcus_phage	42.1	4.5e-58
>prophage 338
NZ_CP053584	Salmonella enterica strain 2014K-1020 chromosome, complete genome	4505366	4471430	4479041	4505366		Hokovirus(33.33%)	6	NA	NA
WP_000623116.1|4471430_4473158_-	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	7.4e-17
WP_000487600.1|4473206_4473464_-	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_038395019.1|4473846_4474818_-	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	1.3e-74
WP_000255009.1|4474981_4475743_-	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000983111.1|4475973_4476954_+	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000433259.1|4477025_4479041_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	42.6	5.7e-146
