The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053605	Escherichia coli strain NEB_Turbo chromosome, complete genome	4527032	405184	468143	4527032	protease,terminase,transposase,integrase,lysis,tRNA	Enterobacteria_phage(50.0%)	66	450801:450847	472103:472149
WP_001295836.1|405184_405808_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|405778_406465_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|406461_408876_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000014739.1|409306_413587_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
WP_000877768.1|413626_413995_+	immunity protein	NA	NA	NA	NA	NA
WP_001320180.1|414685_414946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001297301.1|415002_415176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001157938.1|416177_417272_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|417340_418267_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776377.1|418496_418979_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|419056_419872_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001096881.1|419961_421743_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
WP_000943544.1|421755_422532_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765839.1|422631_423510_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401100.1|423678_425133_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006900.1|425192_426554_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|426610_427912_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_001333621.1|427933_429079_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
WP_000540997.1|429306_430092_-	(S)-ureidoglycine aminohydrolase	NA	NA	NA	NA	NA
WP_001310618.1|430102_431338_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_000703900.1|431359_432409_-	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_000580829.1|432725_434393_+	acyl-CoA synthetase FdrA	NA	NA	NA	NA	NA
WP_000495367.1|434402_435662_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_000152519.1|435672_436488_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855379.1|436484_437378_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815571.1|437572_438640_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|438636_439146_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212247.1|439263_439986_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000255997.1|439988_440483_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912385.1|440656_442042_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.5	6.7e-45
WP_001143542.1|442077_442599_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|442706_442919_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729160.1|442920_443787_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|444257_444800_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988364.1|445019_445712_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001333622.1|445742_448346_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_001350487.1|448324_449365_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255230.1|449375_449891_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000805428.1|449893_450526_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
450801:450847	attL	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
WP_001350488.1|450860_452024_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.6	8.9e-200
WP_000672150.1|452143_452407_-	exonuclease	NA	B6DZ61	Enterobacteria_phage	97.7	1.8e-44
WP_000145909.1|452729_452825_+	hypothetical protein	NA	M1FPD5	Enterobacteria_phage	100.0	1.5e-09
WP_085947771.1|452887_454049_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001070439.1|454360_454693_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001372443.1|454740_454890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|454947_456474_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001306955.1|456938_457490_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|457499_458297_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|458413_458515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054340.1|458511_458967_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	4.1e-60
WP_000224915.1|458966_459137_+	protein NinE from lambdoid prophage DLP12	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774486.1|459129_459420_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	93.8	3.3e-47
WP_001099712.1|459416_459779_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|459775_459916_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204791.1|460001_460385_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	4.4e-55
WP_010723085.1|460782_461799_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000737282.1|461803_462871_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	77.9	2.0e-150
WP_000839596.1|463443_463659_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_001135281.1|463658_464156_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	98.2	1.1e-90
WP_001228697.1|464372_464555_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	78.3	1.4e-16
WP_000738500.1|464645_464939_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	97.9	5.7e-47
WP_000079503.1|465229_465640_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	1.2e-71
WP_001031427.1|465925_466132_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001421937.1|466296_466491_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	100.0	8.7e-28
WP_000453566.1|466879_467425_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	4.0e-94
WP_001027248.1|467399_468143_+|terminase	phage terminase large subunit family protein	terminase	K7PMH7	Enterobacteria_phage	93.1	4.1e-73
472103:472149	attR	CTTCTAAGTCGTGGGCCGCAGGTTCGAATCCTGCAGGGCGCGCCATT	NA	NA	NA	NA
>prophage 2
NZ_CP053605	Escherichia coli strain NEB_Turbo chromosome, complete genome	4527032	1080229	1101621	4527032	integrase,portal,plate,tRNA,tail	Shigella_phage(31.58%)	31	1072224:1072238	1108324:1108338
1072224:1072238	attL	CTTCAGCGTGGTTGT	NA	NA	NA	NA
WP_001297484.1|1080229_1081336_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|1081389_1081851_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248691.1|1081860_1082514_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444484.1|1082685_1083936_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	1.9e-22
WP_000241967.1|1084429_1085095_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_010723094.1|1085095_1085800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001257372.1|1086257_1087151_+	cell death peptidase Lit	NA	NA	NA	NA	NA
WP_000741310.1|1087241_1088369_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	61.5	7.2e-122
WP_000939945.1|1088349_1088595_-	excisionase-like protein from lambdoid prophage 14	NA	NA	NA	NA	NA
WP_011443584.1|1088631_1088943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723095.1|1089059_1089401_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001005353.1|1089338_1089647_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	80.0	3.8e-09
WP_000848748.1|1089821_1090496_-	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000649480.1|1090586_1090787_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	98.5	1.9e-30
WP_000515837.1|1090830_1091388_+	protein YmfL	NA	S5FXP0	Shigella_phage	95.7	7.4e-96
WP_001250269.1|1091563_1091743_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000104929.1|1091732_1093100_+	helix-turn-helix domain-containing protein	NA	A0A1C9IIA1	Salmonella_phage	99.2	5.1e-223
WP_000605606.1|1093111_1093294_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_001350502.1|1093293_1093767_+|portal	phage portal protein	portal	A0A1B5FP95	Escherichia_phage	100.0	3.6e-75
WP_001350503.1|1093693_1094485_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	97.3	4.7e-144
WP_000383574.1|1094475_1095060_+	YmfQ family protein	NA	O22003	Shigella_phage	98.5	2.0e-112
WP_000554707.1|1095063_1095852_+|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000548498.1|1095851_1096454_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	83.5	9.2e-92
WP_010723096.1|1096425_1096839_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	53.6	7.1e-27
WP_000905001.1|1097247_1097802_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	88.3	2.8e-87
WP_000557907.1|1097908_1098742_+	5-methylcytosine-specific endonuclease McrA	NA	NA	NA	NA	NA
WP_000943927.1|1098975_1099140_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	4.2e-23
WP_001295666.1|1099242_1099566_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_032082692.1|1100101_1100212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1100264_1100669_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1100889_1101621_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
1108324:1108338	attR	ACAACCACGCTGAAG	NA	NA	NA	NA
>prophage 3
NZ_CP053605	Escherichia coli strain NEB_Turbo chromosome, complete genome	4527032	1292925	1356872	4527032	lysis,tRNA,tail,transposase	Escherichia_phage(40.62%)	60	NA	NA
WP_000628058.1|1292925_1294158_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1294412_1295396_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1295873_1297247_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157406.1|1297375_1298311_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040852.1|1298362_1299598_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.8	5.5e-240
WP_000079604.1|1299599_1299815_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000276809.1|1299893_1300103_-	double-strand break reduction protein RcbA	NA	A0A0U2QL97	Escherichia_phage	98.4	6.1e-27
WP_001317028.1|1300095_1300290_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_000166319.1|1300346_1301156_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000105143.1|1301148_1303749_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	5.1e-248
WP_000632297.1|1303850_1304126_-	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_001352098.1|1304200_1304371_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560225.1|1304370_1304592_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	4.9e-35
WP_001312793.1|1305033_1305522_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1305518_1305674_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_000948459.1|1306127_1306604_-	DNA-binding transcriptional repressor RacR	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	2.2e-11
WP_000712069.1|1306727_1307024_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	44.9	9.6e-10
WP_000693797.1|1307046_1307469_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.0	1.5e-69
WP_000899748.1|1307481_1308339_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	84.5	8.3e-70
WP_000788970.1|1308345_1309092_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.9	3.8e-111
WP_000450663.1|1309114_1309675_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	88.1	1.9e-67
WP_001228696.1|1309762_1309948_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1310144_1311602_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001350510.1|1311739_1312003_+	ParB N-terminal domain-containing protein	NA	A0A0R6PD10	Moraxella_phage	56.1	6.3e-21
WP_000091628.1|1311983_1312343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000019448.1|1314108_1315089_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_000279097.1|1315411_1318774_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	X2KTY7	Enterobacteria_phage	36.4	8.1e-12
WP_001698950.1|1318773_1319349_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	2.5e-102
WP_000086527.1|1319446_1320037_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000836770.1|1320353_1320587_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	87.0	5.4e-32
WP_120795384.1|1320655_1320769_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_001300461.1|1321547_1321982_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1322122_1323256_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
WP_000628244.1|1323622_1327147_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|1327420_1327687_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001298828.1|1327683_1328106_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762236.1|1328216_1329206_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
WP_000900941.1|1329413_1332053_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|1332049_1332235_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001300734.1|1332242_1332569_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067514.1|1332740_1333646_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_000138615.1|1333881_1335381_+	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000535469.1|1335438_1337712_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001186469.1|1337959_1340005_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_000191077.1|1340289_1341219_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|1341230_1341518_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001072837.1|1341526_1342273_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189201.1|1342287_1342785_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_000206388.1|1342792_1343863_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001292353.1|1343859_1344627_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_000969784.1|1344626_1345415_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_000973360.1|1345416_1346844_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_000018413.1|1346833_1347256_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206197.1|1347255_1348461_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632280.1|1348487_1349801_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_000039887.1|1349901_1350852_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001123464.1|1350833_1351424_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_010723099.1|1351527_1351593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|1354283_1355512_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001254932.1|1355720_1356872_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
>prophage 4
NZ_CP053605	Escherichia coli strain NEB_Turbo chromosome, complete genome	4527032	1515815	1560343	4527032	lysis,tail,protease,transposase	Enterobacteria_phage(31.03%)	60	NA	NA
WP_000527743.1|1515815_1517276_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	4.3e-42
WP_000347482.1|1517364_1518648_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1519252_1519366_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_010723085.1|1519530_1520547_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_000078177.1|1521183_1521774_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000885611.1|1521871_1522447_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	95.3	6.5e-103
WP_001027733.1|1522446_1523409_-|tail	tail fiber protein	tail	K7PHC9	Enterobacteria_phage	70.9	4.1e-41
WP_000453612.1|1523359_1523929_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.3	1.5e-91
WP_001368374.1|1524317_1524551_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1524608_1525019_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1525170_1525344_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1525515_1525671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1525749_1525815_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1525817_1526006_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1526016_1526229_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1526591_1527089_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1527085_1527619_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1527615_1527927_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1527931_1528147_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|1528900_1529116_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1529416_1529629_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1529683_1529773_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1530050_1530803_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265198.1|1530816_1531866_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_012304870.1|1531867_1532146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1532212_1532464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1532680_1532836_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1532907_1533195_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1533194_1533434_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1533458_1533764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1533966_1534299_+	protein FlxA	NA	NA	NA	NA	NA
WP_011443592.1|1534735_1534885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|1535181_1535412_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|1535495_1535903_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|1536069_1536225_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171942.1|1536384_1536603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_014639039.1|1536606_1536771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1537170_1537359_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|1537355_1537547_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_001360138.1|1540289_1540400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|1540457_1541477_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1541488_1542703_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1542908_1543235_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1543369_1543711_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1543745_1544306_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1544308_1545019_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|1545126_1545432_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041675.1|1545630_1548057_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001340362.1|1548117_1550541_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|1550551_1551169_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|1551170_1552025_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1552067_1552682_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_071592181.1|1552840_1554133_+	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000919231.1|1554085_1554781_-	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_000225262.1|1554905_1556126_-	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_001019525.1|1556260_1557154_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000091840.1|1557260_1558514_+	MFS transporter	NA	NA	NA	NA	NA
WP_000743957.1|1558910_1559246_+	acid shock protein	NA	NA	NA	NA	NA
WP_000233093.1|1559338_1559422_+	stationary phase-induced protein	NA	NA	NA	NA	NA
WP_001260865.1|1559521_1560343_+|protease	serine protease	protease	NA	NA	NA	NA
>prophage 5
NZ_CP053605	Escherichia coli strain NEB_Turbo chromosome, complete genome	4527032	2354973	2367444	4527032	integrase,tail,transposase	Enterobacteria_phage(46.67%)	16	2352948:2352964	2371119:2371135
2352948:2352964	attL	TATTGGTATCGACAACC	NA	NA	NA	NA
WP_000368140.1|2354973_2355906_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
WP_000958671.1|2356217_2357375_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	100.0	5.7e-223
WP_000915541.1|2357527_2357890_+	bactoprenol glucosyl transferase	NA	U5P0S6	Shigella_phage	88.3	1.0e-53
WP_085947771.1|2358038_2359200_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001030215.1|2360064_2361396_+	hypothetical protein	NA	U5P0I5	Shigella_phage	36.7	6.8e-63
WP_047792215.1|2361430_2361712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001106835.1|2362010_2362451_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	70.1	9.5e-54
WP_011443597.1|2362477_2362996_-	hypothetical protein	NA	M1FN94	Enterobacteria_phage	68.8	4.6e-39
WP_000066913.1|2363045_2363321_-	phage N-6-adenine-methyltransferase	NA	Q8SBE9	Shigella_phage	100.0	2.6e-49
WP_001393497.1|2363320_2363815_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.2e-86
WP_000135673.1|2364537_2364900_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	1.9e-60
WP_000081278.1|2364965_2365790_+	YfdQ family protein	NA	K7PJQ6	Enterobacteria_phage	99.3	7.8e-150
WP_000008183.1|2365917_2366454_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.9	3.7e-100
WP_001242717.1|2366444_2366807_+	phage protein	NA	K7PH61	Enterobacteria_phage	99.1	2.0e-65
WP_000206809.1|2366806_2367112_+	hypothetical protein	NA	U5P0J0	Shigella_phage	96.0	2.2e-49
WP_001163428.1|2367243_2367444_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
2371119:2371135	attR	TATTGGTATCGACAACC	NA	NA	NA	NA
>prophage 6
NZ_CP053605	Escherichia coli strain NEB_Turbo chromosome, complete genome	4527032	2741225	2748364	4527032		Escherichia_phage(83.33%)	6	NA	NA
WP_001272928.1|2741225_2743787_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	3.0e-30
WP_001141337.1|2743892_2744549_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	4.7e-49
WP_001300386.1|2744599_2745367_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000848004.1|2745562_2746471_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	4.3e-117
WP_001393459.1|2746467_2747634_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	60.6	1.1e-120
WP_001278994.1|2747725_2748364_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 1
NZ_CP053606	Escherichia coli strain NEB_Turbo plasmid F', complete sequence	231547	3508	52192	231547	integrase,transposase	Streptococcus_phage(18.18%)	49	17994:18053	52302:52361
WP_000006255.1|3508_4006_+|transposase	REP-associated tyrosine transposase RayT	transposase	NA	NA	NA	NA
WP_001334802.1|4229_5969_-	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000207552.1|5913_6699_+	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001226164.1|6769_7825_+	DNA polymerase IV	NA	A0A290GHP0	Caldibacillus_phage	27.3	4.4e-12
WP_000554758.1|7876_8170_+	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001263489.1|8172_8571_+	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_001059892.1|8580_9033_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001295202.1|9338_9605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001352051.1|9516_10074_+	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001292994.1|10130_11588_-	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_001291990.1|11848_12307_+	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000189532.1|12398_13643_+	esterase FrsA	NA	NA	NA	NA	NA
WP_000174689.1|13700_14102_+	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000749863.1|14140_15196_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|15483_16587_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|16598_17852_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
17994:18053	attL	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
WP_000854672.1|18423_18765_-	type IV toxin-antitoxin system toxin YkfI	NA	NA	NA	NA	NA
WP_000070395.1|18785_19103_-	type IV toxin-antitoxin system antitoxin YafW	NA	NA	NA	NA	NA
WP_000691994.1|19121_19343_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	41.7	3.7e-06
WP_000811693.1|19351_19828_-	RadC family protein	NA	NA	NA	NA	NA
WP_000211838.1|19843_20302_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000194654.1|20399_20639_-	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_001547765.1|20715_21183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824223.1|21205_21649_-	lipoprotein, inner membrane; degP regulator; CP4-6 prophage	NA	NA	NA	NA	NA
WP_001548158.1|21648_21876_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000197389.1|22279_23101_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.4	7.2e-47
WP_001065553.1|23192_24056_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000770246.1|24384_25278_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001254938.1|25698_26850_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.9	8.9e-43
WP_010723085.1|29196_30213_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	100.0	4.4e-187
WP_001393629.1|30420_31824_+	S-methylmethionine permease	NA	NA	NA	NA	NA
WP_000081352.1|31810_32743_+	homocysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_000192349.1|32851_33898_-	ferric ABC transporter ATP-binding protein	NA	F2Y1V5	Organic_Lake_phycodnavirus	26.9	8.4e-08
WP_000015532.1|35119_35458_-|transposase	transposase	transposase	U5P4I9	Shigella_phage	91.2	2.7e-32
WP_001030800.1|35480_35831_-	type IV toxin-antitoxin system antitoxin YagB	NA	NA	NA	NA	NA
WP_010723086.1|35924_37079_-|transposase	IS481-like element ISEc19 family transposase	transposase	NA	NA	NA	NA
WP_001136613.1|37373_38282_+	2-keto-3-deoxygluconate aldolase	NA	NA	NA	NA	NA
WP_000151261.1|38296_40264_+	xylonate dehydratase YagF	NA	NA	NA	NA	NA
WP_000192863.1|40490_41873_+	MFS transporter	NA	NA	NA	NA	NA
WP_000406871.1|41884_43495_+	glycoside hydrolase family 43 protein	NA	NA	NA	NA	NA
WP_001121657.1|43499_44258_-	DNA-binding transcriptional repressor XynR	NA	NA	NA	NA	NA
WP_001281825.1|44396_45401_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000388269.1|46595_47327_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000860996.1|47417_48044_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_001214248.1|48315_49014_-	recombinase family protein	NA	NA	NA	NA	NA
WP_000072039.1|49040_49895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001272156.1|50013_50238_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000224818.1|50234_50675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001407714.1|50791_52192_-|integrase	integrase family protein	integrase	A0A221SAN4	Ralstonia_phage	28.4	9.5e-07
52302:52361	attR	CGCATTCGTAATGCGAAGGTCGTAGGTTCGACTCCTATTATCGGCACCATTAAAATCAAA	NA	NA	NA	NA
>prophage 2
NZ_CP053606	Escherichia coli strain NEB_Turbo plasmid F', complete sequence	231547	70386	117992	231547	integrase,transposase,protease	Acinetobacter_phage(22.22%)	31	62420:62433	122016:122029
62420:62433	attL	AATATCACCCCAGC	NA	NA	NA	NA
WP_085947771.1|70386_71548_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	3.1e-51
WP_001345829.1|71881_72070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000802277.1|72534_72846_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001362723.1|73189_73396_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_000083834.1|73679_73937_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001442103.1|74170_74245_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000422420.1|74623_76720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001235704.1|76735_77287_-	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	81.8	1.7e-76
WP_001143750.1|77450_80459_+|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	64.4	0.0e+00
WP_001092154.1|81049_82111_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001351580.1|82220_82634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001351581.1|82797_83262_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_000483319.1|83367_83781_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000131420.1|84383_84572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085955200.1|85478_86640_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.2	4.4e-50
WP_088895425.1|87993_89222_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000286435.1|90416_91109_-	hypothetical protein	NA	NA	NA	NA	NA
WP_064753882.1|91861_94768_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_000995793.1|97805_101921_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	37.1	1.6e-126
WP_001193612.1|102641_103589_+|protease	omptin family outer membrane protease OmpP	protease	NA	NA	NA	NA
WP_072145210.1|103693_105181_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001066941.1|105937_106678_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_000361610.1|106962_107940_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	59.2	1.4e-100
WP_000990665.1|108779_109421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000538310.1|111535_111826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000963206.1|111815_112715_+	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_000698737.1|112764_114990_-	phage T7 exclusion protein	NA	NA	NA	NA	NA
WP_000952217.1|114991_116080_-	transcriptional repressor PifC	NA	NA	NA	NA	NA
WP_000813634.1|116659_116878_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|116879_117185_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016982.1|117185_117992_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	100.0	5.8e-57
122016:122029	attR	GCTGGGGTGATATT	NA	NA	NA	NA
