The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053619	Lactobacillus rhamnosus strain LV108 chromosome, complete genome	2923663	1042330	1120715	2923663	capsid,terminase,tail,holin,head,tRNA,integrase,protease,transposase,portal	Lactobacillus_phage(90.74%)	92	1021891:1021950	1084855:1084930
1021891:1021950	attL	ATGGAGGATTAGCTCAGTTGGGAGAGCGTCTGCCTTACAAGCAGAGGGTCACAGGTTCGA	NA	NA	NA	NA
WP_005714768.1|1042330_1043458_-|integrase	site-specific integrase	integrase	B4XYR4	Lactobacillus_phage	98.4	9.8e-212
WP_005712694.1|1043565_1043829_-	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	41.3	1.9e-09
WP_005714766.1|1043967_1044189_+	hypothetical protein	NA	U5U783	Lactobacillus_phage	69.0	1.1e-21
WP_005714764.1|1044298_1045480_-	restriction endonuclease subunit S	NA	E3T4D5	Cafeteria_roenbergensis_virus	25.5	2.0e-18
WP_005712700.1|1045570_1045789_-	S24 family peptidase	NA	NA	NA	NA	NA
WP_005712701.1|1045860_1046634_-	helix-turn-helix transcriptional regulator	NA	Q6J1W4	Lactobacillus_phage	93.8	4.0e-132
WP_005714763.1|1046791_1047043_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IX93	Lactobacillus_phage	98.6	4.2e-30
WP_005712705.1|1047039_1047189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003564805.1|1047185_1047386_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005712707.1|1047460_1047817_+	DUF771 domain-containing protein	NA	B4XYS0	Lactobacillus_phage	100.0	1.1e-63
WP_005712709.1|1047901_1048054_+	hypothetical protein	NA	A0A0P0HRK6	Lactobacillus_phage	100.0	2.4e-20
WP_005712711.1|1048058_1048262_+	hypothetical protein	NA	Q6J1W0	Lactobacillus_phage	89.6	2.7e-27
WP_005712713.1|1048280_1048766_+	siphovirus Gp157 family protein	NA	B4XYS3	Lactobacillus_phage	97.5	2.2e-80
WP_005712715.1|1048766_1049474_+	AAA family ATPase	NA	Q6J1V8	Lactobacillus_phage	97.0	5.9e-130
WP_005712717.1|1049477_1050035_+	DUF669 domain-containing protein	NA	B4XYS5	Lactobacillus_phage	94.1	3.8e-100
WP_005712719.1|1050049_1050847_+	hypothetical protein	NA	Q6J1V6	Lactobacillus_phage	70.2	1.2e-91
WP_005712721.1|1050833_1051616_+	ATP-binding protein	NA	Q6J1V5	Lactobacillus_phage	92.3	7.7e-131
WP_005712723.1|1051612_1051957_+	hypothetical protein	NA	B4XYS8	Lactobacillus_phage	91.6	3.6e-48
WP_005712725.1|1051943_1052198_+	hypothetical protein	NA	U5U728	Lactobacillus_phage	91.7	3.3e-35
WP_003607027.1|1052194_1052560_+	endodeoxyribonuclease	NA	A0A0P0HRU0	Lactobacillus_phage	100.0	1.8e-66
WP_005714761.1|1052573_1052909_+	hypothetical protein	NA	U5U3Z2	Lactobacillus_phage	97.3	2.2e-34
WP_005714760.1|1052920_1053622_+	N-6 DNA methylase	NA	A8YQM7	Lactobacillus_phage	94.8	1.4e-123
WP_005712729.1|1053618_1053801_+	hypothetical protein	NA	A8YQM8	Lactobacillus_phage	91.7	2.9e-25
WP_005712730.1|1053797_1054340_+	DUF1642 domain-containing protein	NA	Q6J1U8	Lactobacillus_phage	46.2	3.1e-30
WP_005712731.1|1054329_1054506_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005712732.1|1054495_1054876_+	hypothetical protein	NA	Q8LTB5	Lactobacillus_phage	71.1	1.5e-47
WP_005712733.1|1054872_1055082_+	hypothetical protein	NA	D6PSV2	Lactobacillus_phage	95.7	1.6e-30
WP_005712735.1|1055209_1055431_+	hypothetical protein	NA	A0A0P0IXA5	Lactobacillus_phage	51.4	4.6e-09
WP_005714759.1|1055500_1055944_+	autolysin regulatory protein arpU	NA	A0A0P0IZI6	Lactobacillus_phage	95.2	4.0e-76
WP_005712739.1|1056337_1057411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005712743.1|1058290_1059508_+	GcrA cell cycle regulator	NA	A8YQN3	Lactobacillus_phage	97.5	2.5e-237
WP_005712745.1|1059494_1060025_+	HNH endonuclease	NA	U5U4N5	Lactobacillus_phage	96.6	5.8e-98
WP_005712746.1|1060028_1060352_+	hypothetical protein	NA	A0A0P0IJY9	Lactobacillus_phage	87.5	3.9e-49
WP_005712751.1|1060554_1061349_+	HNH endonuclease	NA	B4XYU4	Lactobacillus_phage	98.9	2.8e-149
WP_005712753.1|1061549_1062005_+|terminase	P27 family phage terminase small subunit	terminase	B4XYP1	Lactobacillus_phage	99.3	1.0e-79
WP_005714757.1|1062026_1063739_+|terminase	terminase large subunit	terminase	B4XYP2	Lactobacillus_phage	97.4	0.0e+00
WP_003661399.1|1063750_1063942_+	hypothetical protein	NA	A0A2D1GPE7	Lactobacillus_phage	100.0	3.0e-28
WP_005712758.1|1063947_1065201_+|portal	phage portal protein	portal	B4XYP4	Lactobacillus_phage	91.8	5.2e-222
WP_005714756.1|1065154_1065784_+|head,protease	HK97 family phage prohead protease	head,protease	B4XYP5	Lactobacillus_phage	94.3	1.0e-109
WP_005712762.1|1065825_1067028_+|capsid	phage major capsid protein	capsid	A0A2D1GPG3	Lactobacillus_phage	94.2	5.4e-208
WP_005712764.1|1067045_1067285_+	Ig-like domain-containing protein	NA	A0A2D1GPN4	Lactobacillus_phage	97.5	1.6e-31
WP_003564855.1|1067295_1067655_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5U4K5	Lactobacillus_phage	97.5	1.6e-59
WP_005712766.1|1067644_1067974_+|head,tail	head-tail adaptor protein	head,tail	B4XYP8	Lactobacillus_phage	97.2	1.5e-56
WP_005712768.1|1067973_1068360_+	HK97 gp10 family phage protein	NA	B4XYP9	Lactobacillus_phage	98.4	5.0e-67
WP_005712770.1|1068359_1068746_+	hypothetical protein	NA	U5U3W4	Lactobacillus_phage	96.1	1.6e-68
WP_005712772.1|1068779_1069397_+|tail	phage major tail protein, phi13 family	tail	U5U3Z7	Lactobacillus_phage	97.6	2.0e-110
WP_003661382.1|1069495_1069909_+	hypothetical protein	NA	A0A2D1GPL7	Lactobacillus_phage	100.0	6.4e-52
WP_005712773.1|1070031_1074894_+|tail	phage tail tape measure protein	tail	U5U708	Lactobacillus_phage	93.0	0.0e+00
WP_044434643.1|1074894_1076811_+|tail	phage tail family protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	63.7	4.2e-223
WP_044434646.1|1076811_1079766_+|tail	phage tail protein	tail	A8YQK1	Lactobacillus_phage	77.5	0.0e+00
WP_005711092.1|1079781_1080111_+	hypothetical protein	NA	A8YQK2	Lactobacillus_phage	99.1	4.2e-54
WP_005688592.1|1080107_1080251_+	XkdX family protein	NA	A8YQK3	Lactobacillus_phage	97.9	3.5e-18
WP_003581984.1|1080306_1080582_+	hypothetical protein	NA	A0A0P0IZF9	Lactobacillus_phage	100.0	7.5e-49
WP_005714728.1|1080596_1081010_+|holin	phage holin	holin	A0A0P0IDC6	Lactobacillus_phage	94.8	2.4e-43
WP_005711086.1|1081020_1082319_+	LysM peptidoglycan-binding domain-containing protein	NA	B4XYQ9	Lactobacillus_phage	86.8	1.0e-212
WP_005711084.1|1082363_1082588_+	hypothetical protein	NA	A0A0P0IUZ5	Lactobacillus_phage	98.6	6.1e-33
WP_005709578.1|1083209_1084667_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_005713236.1|1085082_1085736_-	hypothetical protein	NA	NA	NA	NA	NA
1084855:1084930	attR	ATGGAGGATTAGCTCAGTTGGGAGAGCGTCTGCCTTACAAGCAGAGGGTCACAGGTTCGAGCCCTGTATCCTCCAT	NA	NA	NA	NA
WP_005713641.1|1085914_1087099_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	66.0	1.1e-141
WP_005713241.1|1087629_1089123_+	MFS transporter	NA	NA	NA	NA	NA
WP_005713242.1|1089299_1089770_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005687221.1|1089991_1091470_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_005713248.1|1091466_1092192_+	DUF4811 domain-containing protein	NA	NA	NA	NA	NA
WP_020751877.1|1092256_1092928_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_005713254.1|1093348_1095760_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	69.1	0.0e+00
WP_005713257.1|1096348_1097992_+	polysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_005713259.1|1097996_1098707_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_005688621.1|1098792_1099008_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_005713261.1|1099140_1099971_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_005713643.1|1099967_1100468_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_005688627.1|1100863_1101337_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_005713644.1|1101443_1102652_+	putative C-S lyase	NA	NA	NA	NA	NA
WP_005713267.1|1102778_1104107_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_005687240.1|1104321_1104588_+	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_005687242.1|1104738_1106082_+	PFL family protein	NA	NA	NA	NA	NA
WP_005713647.1|1106248_1107316_+	competence protein	NA	NA	NA	NA	NA
WP_171831314.1|1107556_1108192_-	DsbA family protein	NA	NA	NA	NA	NA
WP_005713275.1|1108261_1108855_-	CYTH domain-containing protein	NA	NA	NA	NA	NA
WP_005713649.1|1109021_1109699_+	GTP pyrophosphokinase family protein	NA	NA	NA	NA	NA
WP_005687253.1|1109700_1110498_+	NAD kinase	NA	NA	NA	NA	NA
WP_005713277.1|1110497_1111400_+	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_005713278.1|1111543_1112602_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_005713279.1|1112817_1113456_-	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_005713280.1|1113475_1114294_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_005713281.1|1114498_1115539_-	lactonase family protein	NA	NA	NA	NA	NA
WP_005688651.1|1115782_1116157_+	PTS glucitol/sorbitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_003564153.1|1116206_1116476_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_005713651.1|1116590_1117580_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	71.6	1.1e-137
WP_005713283.1|1117763_1118711_-	magnesium transporter CorA family protein	NA	NA	NA	NA	NA
WP_005687265.1|1118776_1119619_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_080565087.1|1120018_1120204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005687266.1|1120205_1120715_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP053619	Lactobacillus rhamnosus strain LV108 chromosome, complete genome	2923663	1332056	1369561	2923663	capsid,terminase,tail,holin,head,integrase,portal	Lactobacillus_phage(82.22%)	49	1326122:1326136	1356866:1356880
1326122:1326136	attL	TCGGTTTAAAGCCCA	NA	NA	NA	NA
WP_005714751.1|1332056_1333241_-|integrase	site-specific integrase	integrase	A0A0P0I3D2	Lactobacillus_phage	99.2	1.6e-225
WP_020751901.1|1333411_1333618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005714749.1|1333585_1334587_-	hypothetical protein	NA	A0A1S5SA20	Streptococcus_phage	23.9	4.9e-05
WP_020751902.1|1334700_1335291_-	DUF5067 domain-containing protein	NA	Q6SEF8	Lactobacillus_prophage	57.7	2.8e-40
WP_003594164.1|1335350_1335773_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A1B0YA58	Lactobacillus_phage	94.9	5.5e-75
WP_003574523.1|1335762_1336101_-	helix-turn-helix transcriptional regulator	NA	A0A0P0IZG9	Lactobacillus_phage	98.2	6.6e-55
WP_005711333.1|1336235_1336478_+	helix-turn-helix transcriptional regulator	NA	A0A0P0HRP5	Lactobacillus_phage	92.5	3.9e-33
WP_005711335.1|1336474_1336633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005711337.1|1336650_1337382_+	ORF6C domain-containing protein	NA	A0A059NT90	Lactococcus_phage	40.1	5.3e-41
WP_005714742.1|1337447_1337996_+	hypothetical protein	NA	A0A1B0YE60	Lactobacillus_phage	97.8	1.0e-97
WP_005711341.1|1337974_1338205_+	hypothetical protein	NA	A0A1B0Y6A3	Lactobacillus_phage	86.3	2.0e-31
WP_005711345.1|1338348_1338576_+	hypothetical protein	NA	A0A0P0I7L5	Lactobacillus_phage	80.0	3.4e-07
WP_005711347.1|1338568_1338772_+	hypothetical protein	NA	A8YQL1	Lactobacillus_phage	46.2	3.0e-10
WP_005711348.1|1338782_1339658_+	recombinase RecT	NA	A0A1X9I5N6	Streptococcus_phage	52.2	2.0e-58
WP_005711350.1|1339677_1340442_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0P0IZH9	Lactobacillus_phage	53.6	2.6e-75
WP_005711352.1|1340457_1341414_+	DnaD domain protein	NA	A0A1B0Y2R2	Lactobacillus_phage	92.1	1.3e-127
WP_005711354.1|1341426_1341912_+	single-stranded DNA-binding protein	NA	U5U726	Lactobacillus_phage	82.0	1.7e-59
WP_005711356.1|1342219_1342435_+	helix-turn-helix transcriptional regulator	NA	A0A0P0IJY1	Lactobacillus_phage	67.1	9.7e-20
WP_005711359.1|1342431_1342881_+	hypothetical protein	NA	B4XYT0	Lactobacillus_phage	87.8	2.9e-66
WP_005711361.1|1342927_1343182_+	hypothetical protein	NA	A8YQM4	Lactobacillus_phage	95.2	7.2e-38
WP_005714739.1|1343178_1343544_+	hypothetical protein	NA	A0A0P0I7M2	Lactobacillus_phage	98.3	2.6e-65
WP_005711364.1|1343556_1344021_+	hypothetical protein	NA	A0A0P0IXF6	Lactobacillus_phage	98.0	2.8e-19
WP_005711368.1|1344403_1344910_+	DUF1642 domain-containing protein	NA	Q8LTB6	Lactobacillus_phage	72.4	3.9e-59
WP_005711370.1|1344899_1345250_+	hypothetical protein	NA	B4XYT7	Lactobacillus_phage	46.2	4.2e-20
WP_005711376.1|1345582_1345804_+	hypothetical protein	NA	A0A0P0IXA5	Lactobacillus_phage	51.4	2.1e-09
WP_005711378.1|1346012_1346441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005711380.1|1346773_1347634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005711382.1|1348174_1349323_+	hypothetical protein	NA	A0A0P0I3G0	Lactobacillus_phage	97.9	5.8e-220
WP_005711383.1|1349315_1349639_+	hypothetical protein	NA	A0A0N7IRA2	Lactobacillus_phage	92.5	3.5e-53
WP_005711385.1|1349675_1350209_+|terminase	terminase small subunit	terminase	A0A0P0IUY4	Lactobacillus_phage	94.8	1.6e-63
WP_005714737.1|1350186_1351542_+|terminase	PBSX family phage terminase large subunit	terminase	A4L7R3	Lactococcus_phage	58.9	4.9e-149
WP_005711389.1|1351546_1352935_+|portal	phage portal protein	portal	A0A0P0IJV3	Lactobacillus_phage	87.3	2.7e-235
WP_005711391.1|1352937_1354680_+|capsid	minor capsid protein	capsid	A0A0P0ID43	Lactobacillus_phage	46.0	1.0e-74
WP_005711393.1|1354828_1355485_+	DUF4355 domain-containing protein	NA	A0A0P0ID10	Lactobacillus_phage	80.0	1.6e-57
WP_005711395.1|1355500_1356514_+	hypothetical protein	NA	A0A0A7RVZ1	Clostridium_phage	26.5	4.0e-23
WP_005711397.1|1356741_1357116_+|head,tail	phage head-tail connector protein	head,tail	A0A0P0IZF6	Lactobacillus_phage	86.2	1.4e-53
1356866:1356880	attR	TCGGTTTAAAGCCCA	NA	NA	NA	NA
WP_005711399.1|1357120_1357423_+	hypothetical protein	NA	A0A0N7IR97	Lactobacillus_phage	88.0	5.0e-46
WP_005711401.1|1357419_1357785_+|head,tail	phage head-tail joining protein	head,tail	A0A0P0IUZ3	Lactobacillus_phage	95.9	2.0e-57
WP_003582636.1|1357785_1358190_+	DUF3168 domain-containing protein	NA	A0A0P0I3C8	Lactobacillus_phage	99.3	6.0e-71
WP_005711403.1|1358201_1358807_+|tail	phage tail protein	tail	A0A0P0ID88	Lactobacillus_phage	93.0	5.8e-102
WP_005711405.1|1358893_1359226_+	hypothetical protein	NA	A0A0P0IQQ6	Lactobacillus_phage	93.6	1.8e-49
WP_005711407.1|1359330_1359684_+	hypothetical protein	NA	A0A0P0I7N9	Lactobacillus_phage	97.4	2.4e-55
WP_005711409.1|1359676_1362766_+	tape measure protein	NA	A0A0P0IJD2	Lactobacillus_phage	84.2	2.4e-260
WP_005714730.1|1362766_1364755_+|tail	phage tail family protein	tail	Q3L0S3	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	63.4	2.7e-220
WP_020751906.1|1364755_1367191_+|tail	phage tail protein	tail	Q6J1X1	Lactobacillus_phage	74.2	0.0e+00
WP_005713395.1|1367192_1367483_+	hypothetical protein	NA	Q3L0S1	Lactobacillus_rhamnosus_Lc-Nu-like_prophage	48.9	7.7e-20
WP_005714776.1|1367636_1367927_+	hypothetical protein	NA	B4XYQ7	Lactobacillus_phage	99.0	1.9e-47
WP_005714775.1|1367919_1368366_+|holin	phage holin	holin	B4XYQ8	Lactobacillus_phage	98.0	7.6e-67
WP_005713391.1|1368376_1369561_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A0P0HRN9	Lactobacillus_phage	94.7	3.1e-216
>prophage 3
NZ_CP053619	Lactobacillus rhamnosus strain LV108 chromosome, complete genome	2923663	2591237	2675865	2923663	tRNA,bacteriocin,transposase,protease	Bacillus_phage(18.75%)	79	NA	NA
WP_005686122.1|2591237_2592731_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_005713596.1|2593401_2594232_-|protease	YhfC family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005713598.1|2594245_2595262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686116.1|2595258_2595645_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005713599.1|2595776_2597405_-	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_005714532.1|2597903_2599220_-	MucBP domain-containing protein	NA	NA	NA	NA	NA
WP_005692337.1|2599503_2600262_-	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_005692336.1|2600263_2601169_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	39.5	1.7e-33
WP_005692335.1|2601310_2602207_+	Rgg/GadR/MutR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005686113.1|2602298_2603414_-	PIN/TRAM domain-containing protein	NA	NA	NA	NA	NA
WP_005686111.1|2603434_2604799_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_005713603.1|2604818_2605358_-	dUTP diphosphatase	NA	J9PV85	Bacillus_phage	48.6	1.5e-37
WP_005714535.1|2606002_2606293_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_005713617.1|2606665_2607262_+|transposase	IS607 family transposase	transposase	Q331V0	Clostridium_botulinum_C_phage	60.6	2.4e-68
WP_005714520.1|2607296_2608478_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	C1KFS0	Lactobacillus_virus	49.1	3.3e-101
WP_005709712.1|2608652_2609972_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	35.8	4.0e-63
WP_005714538.1|2610116_2611463_+	C1 family peptidase	NA	R4TV59	Phaeocystis_globosa_virus	38.5	1.3e-72
WP_005709714.1|2611679_2612780_+	ABC transporter	NA	NA	NA	NA	NA
WP_005709716.1|2612776_2613973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005714541.1|2613986_2614862_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.5	1.4e-11
WP_005709719.1|2615013_2617068_+	KUP/HAK/KT family potassium transporter	NA	A7K9V6	Acanthocystis_turfacea_chlorella_virus	32.9	1.6e-63
WP_005709722.1|2617287_2619918_-	pyruvate, phosphate dikinase	NA	H8YJB7	Vibrio_phage	38.6	9.6e-85
WP_072137620.1|2620217_2620805_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_005692313.1|2620976_2621648_-	2,3-bisphosphoglycerate-dependent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_005714543.1|2621805_2622924_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_005686095.1|2622942_2623227_+	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_005686092.1|2624751_2624961_-	CsbD family protein	NA	NA	NA	NA	NA
WP_005709728.1|2625088_2626279_-	phosphopentomutase	NA	NA	NA	NA	NA
WP_005692303.1|2626275_2627505_-	MFS transporter	NA	NA	NA	NA	NA
WP_005709730.1|2627532_2628276_-	nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_005709732.1|2628268_2629486_-	MFS transporter	NA	NA	NA	NA	NA
WP_005714545.1|2629613_2630792_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005686089.1|2630991_2631249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005686086.1|2631438_2631645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005714546.1|2631844_2632099_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005714547.1|2632789_2634022_+	MFS transporter	NA	NA	NA	NA	NA
WP_005709743.1|2634093_2635350_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	55.6	7.8e-109
WP_005709745.1|2635430_2636267_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	41.9	9.6e-47
WP_107711099.1|2636520_2636670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005709747.1|2636715_2636901_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005714549.1|2637476_2638019_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005714551.1|2639039_2640209_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_005709753.1|2640219_2640888_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.3	2.2e-33
WP_005709755.1|2640884_2641610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171831324.1|2642134_2642959_-	class C sortase	NA	NA	NA	NA	NA
WP_005709760.1|2642965_2644519_-	SpaH/EbpB family LPXTG-anchored major pilin	NA	NA	NA	NA	NA
WP_171831325.1|2644509_2645865_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_020752021.1|2645866_2648818_-	LPXTG cell wall anchor domain-containing protein	NA	NA	NA	NA	NA
WP_005687861.1|2649092_2649650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005709767.1|2649826_2650615_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005709769.1|2650619_2651819_-	DUF2075 domain-containing protein	NA	NA	NA	NA	NA
WP_005709771.1|2652011_2653067_+	DUF2974 domain-containing protein	NA	NA	NA	NA	NA
WP_005714556.1|2653358_2654006_+	helix-turn-helix transcriptional regulator	NA	B5LPU3	Bacillus_virus	42.3	3.4e-07
WP_005687855.1|2654136_2654469_+	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_005709777.1|2654465_2655251_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005709779.1|2655294_2656071_+	hypothetical protein	NA	NA	NA	NA	NA
WP_005709780.1|2656098_2656389_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005709782.1|2656514_2657597_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_123811849.1|2657896_2658790_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	33.7	4.3e-37
WP_005714558.1|2658741_2659278_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_005711099.1|2659372_2660728_-	threonine/serine exporter family protein	NA	NA	NA	NA	NA
WP_005714559.1|2660907_2661261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005711102.1|2661379_2662759_-|bacteriocin	bacteriocin secretion accessory protein	bacteriocin	NA	NA	NA	NA
WP_005711104.1|2662771_2664964_-	peptide cleavage/export ABC transporter	NA	W8CYL7	Bacillus_phage	25.3	3.6e-37
WP_005714562.1|2665258_2665414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005711108.1|2665593_2666889_+	GHKL domain-containing protein	NA	NA	NA	NA	NA
WP_005711110.1|2666893_2667670_+	LytTR family transcriptional regulator DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_005711112.1|2667788_2668049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005711118.1|2669023_2669269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005714564.1|2669518_2669818_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_005714566.1|2669995_2670154_-|bacteriocin	class IIb bacteriocin, lactobin A/cerein 7B family	bacteriocin	NA	NA	NA	NA
WP_005711122.1|2670621_2670807_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_005711123.1|2670866_2671052_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005711129.1|2671443_2671629_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005711130.1|2671678_2672485_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_005711133.1|2672805_2673246_-	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_005711134.1|2673300_2674728_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	26.4	3.0e-32
WP_005692222.1|2674900_2675233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005714569.1|2675523_2675865_-|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
