The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038284	Escherichia coli O157:H7 strain YB14-1 chromosome, complete genome	5546361	1229829	1243266	5546361	tail,holin	Enterobacteria_phage(38.46%)	17	NA	NA
WP_001223948.1|1229829_1230441_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1230437_1231103_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1231099_1231723_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1231975_1232719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1232804_1232972_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143067.1|1233379_1235233_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1235382_1235598_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1235602_1235947_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1236303_1236684_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1236680_1237028_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001023396.1|1237645_1237915_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1238075_1238498_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1238627_1239686_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1239764_1240415_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1240597_1241188_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1241689_1241938_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1242783_1243266_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP038284	Escherichia coli O157:H7 strain YB14-1 chromosome, complete genome	5546361	1522162	1528901	5546361	transposase,integrase	Shigella_phage(33.33%)	6	1511150:1511166	1531097:1531113
1511150:1511166	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1522162_1522732_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1522731_1523199_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_162829202.1|1523773_1524987_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000257010.1|1525188_1526325_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1526499_1527657_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1527968_1528901_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1531097:1531113	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038284	Escherichia coli O157:H7 strain YB14-1 chromosome, complete genome	5546361	1774495	1875434	5546361	protease,portal,terminase,holin,tRNA,tail	Enterobacteria_phage(51.39%)	108	NA	NA
WP_000569336.1|1774495_1775422_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1775426_1776158_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1776138_1776246_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1776305_1777007_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1777027_1778314_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1778347_1778602_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1778620_1778755_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1778758_1779001_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1779088_1779451_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1779447_1779804_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1780137_1780314_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1780315_1781263_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1781259_1781481_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1781579_1781861_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1781871_1782063_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_032195523.1|1782035_1782218_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	1.6e-28
WP_000186740.1|1782217_1782895_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1782891_1783677_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1783682_1783979_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1784054_1784345_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1784848_1786456_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|1786562_1787255_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182876.1|1787618_1788158_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000147884.1|1788154_1789174_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	9.7e-110
WP_000788906.1|1789170_1789872_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145928.1|1789868_1790153_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_001481254.1|1790380_1790578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|1790621_1790903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141214.1|1790993_1791095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053021.1|1791091_1791547_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224907.1|1791546_1791717_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1791709_1792000_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|1791996_1792359_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1792355_1792496_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1792581_1793016_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1793264_1793417_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_171878409.1|1794220_1796167_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.0	0.0e+00
WP_000143458.1|1796304_1796484_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1796524_1796770_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1796847_1797063_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1797067_1797601_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1797871_1798441_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1798440_1798587_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1798814_1799000_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1799517_1799994_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077626.1|1799990_1802114_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|1802110_1802323_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974567.1|1802322_1803825_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
WP_001365078.1|1803814_1805794_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.9	0.0e+00
WP_001097065.1|1805881_1806208_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1806200_1806482_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1806484_1807108_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1807120_1807519_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_137049441.1|1807526_1808279_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.2	8.4e-135
WP_000479062.1|1808292_1808715_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000532073.1|1808741_1809050_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000847298.1|1811735_1812065_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1812064_1812763_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|1812773_1813517_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_071601640.1|1813462_1814092_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_024748476.1|1814332_1817812_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.7	0.0e+00
WP_001230508.1|1817879_1818479_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_088136427.1|1818543_1819713_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001023396.1|1819714_1819984_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_072142879.1|1820144_1820561_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1820642_1821284_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1821445_1821694_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1822208_1823894_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1823890_1824610_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1824656_1825127_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1825168_1825630_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001416817.1|1825754_1827758_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	99.9	0.0e+00
WP_001302810.1|1827754_1828891_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1828883_1829615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1829633_1831163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1831173_1832262_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1833502_1833820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1833881_1837511_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1844467_1846501_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1846632_1847742_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1848003_1848285_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1848576_1849119_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677409.1|1849206_1849881_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1849896_1852377_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1852387_1853422_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1853503_1853842_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134630.1|1854059_1854905_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1855025_1855298_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1855407_1855722_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1855731_1856079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1857129_1857369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1857702_1858491_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1858487_1859288_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1859352_1860171_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1860222_1860969_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1860942_1861908_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1861904_1862909_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1862905_1864183_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1864439_1865492_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1865790_1866645_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000182899.1|1867945_1868398_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1868428_1868713_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490697.1|1868716_1870072_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1870119_1871160_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1871259_1872039_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1872120_1873020_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1873425_1873743_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|1874072_1875434_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 4
NZ_CP038284	Escherichia coli O157:H7 strain YB14-1 chromosome, complete genome	5546361	1961451	2102966	5546361	protease,terminase,head,tail,portal,integrase,capsid,holin,lysis,transposase	Stx2-converting_phage(41.94%)	161	1958069:1958083	2063180:2063194
1958069:1958083	attL	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_001007946.1|1961451_1962630_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|1962610_1962802_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|1962879_1963224_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|1963411_1963762_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001289930.1|1964628_1965576_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|1965572_1965794_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1965892_1966174_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548528.1|1966184_1966376_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|1966348_1966531_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186848.1|1966527_1967208_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_137049443.1|1967204_1967990_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	99.6	1.4e-148
WP_000995486.1|1967995_1968292_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|1968366_1968510_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1968478_1968643_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|1968715_1969084_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|1969266_1969518_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|1969576_1969849_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|1969826_1970009_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|1970577_1971099_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|1971460_1972156_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1972230_1972446_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|1972587_1972884_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|1972916_1973078_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|1973064_1973886_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|1973882_1975259_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001220560.1|1975337_1975949_+	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_000344569.1|1976412_1976745_+	hypothetical protein	NA	A0A0P0ZCF4	Stx2-converting_phage	100.0	3.3e-59
WP_000103678.1|1976877_1977093_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|1977103_1977340_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|1977296_1977743_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|1977739_1978267_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|1978263_1978446_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208500.1|1978720_1979485_+	phage antirepressor Ant	NA	A0A0P0ZB11	Stx2-converting_phage	100.0	1.4e-121
WP_001004016.1|1979559_1980282_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|1980281_1980887_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|1980883_1981555_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|1981545_1982034_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|1982683_1983643_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|1983654_1983924_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|1984220_1984544_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143113.1|1984787_1986725_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	100.0	0.0e+00
WP_000143458.1|1986861_1987041_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1987081_1987354_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|1987430_1987646_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|1987645_1988143_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|1988139_1988577_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|1988779_1989277_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1989273_1989531_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|1989993_1990221_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|1990262_1990628_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958396.1|1990919_1991483_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_162829202.1|1992151_1993365_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000173024.1|1994517_1996455_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.7	0.0e+00
WP_001063023.1|1996499_1996721_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125990.1|1999247_1999574_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|1999583_1999934_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|1999930_2000377_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2000373_2000718_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2000776_2001493_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2001498_2001873_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2001968_2002178_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_015994262.1|2002229_2005472_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2005464_2005806_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_171878410.1|2005805_2006504_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	98.7	4.7e-132
WP_001302649.1|2006520_2006841_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2006948_2007122_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2007192_2008116_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|2008169_2008907_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_050546863.1|2008852_2009485_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000515107.1|2009744_2013224_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	100.0	0.0e+00
WP_001230314.1|2013290_2013890_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	100.0	1.8e-111
WP_137049445.1|2013954_2015268_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.8	2.8e-85
WP_001023452.1|2015269_2015539_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2015679_2016555_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_162829200.1|2016864_2018077_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_137049446.1|2018080_2018743_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.0	5.3e-117
WP_001303036.1|2020067_2021234_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2021352_2021826_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2022024_2023083_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2023254_2023584_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2023684_2023867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2024355_2024469_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2024481_2024676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2025134_2025503_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2025576_2025798_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2025860_2026337_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2026351_2026831_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2026912_2027734_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2027954_2028365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2028380_2029064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2029199_2030270_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2030266_2031172_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_023441891.1|2031168_2031966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000966626.1|2032304_2034452_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2035899_2037438_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2037487_2037835_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2037831_2038212_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|2038573_2039119_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2039115_2039859_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2039870_2040950_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2041011_2041947_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2042403_2043321_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2043422_2044373_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|2044490_2046134_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2046759_2047476_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2047818_2049273_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2049374_2050691_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2051004_2052057_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014714124.1|2052318_2060301_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2060790_2061588_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_046671474.1|2061798_2062833_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.1e-99
WP_000094838.1|2062832_2063036_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2063094_2065566_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
2063180:2063194	attR	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_000199485.1|2065661_2065850_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2065846_2066035_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2066515_2066668_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2066942_2067587_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2067684_2067912_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2067908_2068334_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_137049448.1|2068402_2069446_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	82.8	7.7e-86
WP_072143023.1|2069357_2069900_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2069934_2070633_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2070654_2070879_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2070875_2071232_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2071264_2071417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2071413_2071725_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2071851_2072415_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2072524_2072629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2072815_2073028_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2073195_2073474_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2073475_2074525_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2074537_2074897_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2074893_2075583_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000023257.1|2077122_2078973_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2079054_2080268_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2080578_2080794_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2080798_2081143_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2081193_2081727_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2081882_2082065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2082077_2082209_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2082436_2082622_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2083148_2083463_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2083544_2083769_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2084163_2084673_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2086557_2086764_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2086760_2088353_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2088342_2089848_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2089884_2090232_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2090289_2090556_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_137049450.1|2090537_2091278_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	97.6	6.1e-130
WP_000479117.1|2091291_2091723_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2091749_2092163_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_128484525.1|2092143_2094723_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000847298.1|2094719_2095049_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_024748502.1|2095048_2095747_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	7.6e-130
WP_001303043.1|2095757_2096501_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_129137391.1|2096446_2097079_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_115333685.1|2098280_2100794_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.8	0.0e+00
WP_001230509.1|2100861_2101461_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_088136427.1|2101525_2102695_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001023396.1|2102696_2102966_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
>prophage 5
NZ_CP038284	Escherichia coli O157:H7 strain YB14-1 chromosome, complete genome	5546361	2160550	2180536	5546361	transposase,integrase,tail	Enterobacteria_phage(75.0%)	28	2173672:2173685	2183678:2183691
WP_032161583.1|2160550_2161687_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|2161637_2161961_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2162118_2163303_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2163302_2163815_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2163869_2164235_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2164243_2164399_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2167201_2167690_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2167846_2168419_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2168462_2168993_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2170084_2170399_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2170403_2171363_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2171439_2174262_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2173672:2173685	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2174268_2174634_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2174630_2175248_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2175259_2175559_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2175555_2175822_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2175818_2176022_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2176045_2176462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2176554_2176668_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2176664_2176907_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2176918_2177197_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2177207_2177558_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2177579_2177783_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2177854_2177992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2178081_2178486_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2178501_2179152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2179181_2179529_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001303019.1|2179534_2180536_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
2183678:2183691	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 6
NZ_CP038284	Escherichia coli O157:H7 strain YB14-1 chromosome, complete genome	5546361	2503532	2676538	5546361	terminase,portal,protease,head,integrase,capsid,holin,transposase,tail	Stx2-converting_phage(28.83%)	204	2524759:2524806	2629415:2629462
WP_001260835.1|2503532_2504354_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2504453_2504537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2504629_2504965_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2505361_2506615_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2506721_2507615_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2507749_2508970_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2509094_2509790_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2509742_2511035_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2511192_2511807_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2511849_2512704_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2512705_2513323_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2513333_2515757_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2515817_2518244_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2518442_2518748_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2518855_2519566_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2519568_2520129_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2520163_2520505_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2520639_2520966_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2521954_2522206_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2522278_2524750_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
2524759:2524806	attL	ACCTCATTACAGATTTAAGGGTGAACAAATCCCTGCCATTGCTGGCAT	NA	NA	NA	NA
WP_001090200.1|2524842_2525034_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2525030_2525219_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2525619_2525784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2525787_2526006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2526077_2526377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2526729_2527008_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2527009_2527201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2527221_2527593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2527690_2527993_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2527989_2528415_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095670.1|2528437_2529400_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
WP_000788936.1|2529406_2530147_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_001118159.1|2530957_2531353_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2531409_2531994_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2532109_2532214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2532402_2532615_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2532782_2533061_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2533062_2534112_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2534124_2534484_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2534480_2535170_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2535806_2536235_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_024748470.1|2536713_2538564_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_024180155.1|2539003_2539219_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2539223_2539568_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2539618_2540152_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2540422_2540992_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2540991_2541138_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2541365_2541551_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2541975_2542203_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|2542244_2542610_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_137049461.1|2542899_2543463_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	83.9	3.8e-71
WP_001303049.1|2543459_2545121_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_137049462.1|2545184_2547122_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	99.8	0.0e+00
WP_001063099.1|2547166_2547388_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2547333_2549835_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2549914_2550241_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2550250_2550601_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2550597_2551044_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2551040_2551385_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2551443_2552160_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2552165_2552540_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453746.1|2552635_2552845_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|2552892_2556135_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2556127_2556469_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303038.1|2556468_2557167_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_046671488.1|2557177_2557921_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_050439450.1|2557866_2558499_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|2558841_2560017_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_129137390.1|2559968_2562314_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001228304.1|2562381_2562981_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_024748516.1|2563132_2564446_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	7.2e-81
WP_001023474.1|2564447_2564717_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|2565743_2567069_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_000998048.1|2569733_2571272_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2571321_2571669_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2571665_2572046_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2572385_2572664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2573091_2573238_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2573374_2574022_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2574205_2574796_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|2576302_2576953_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_000113671.1|2578252_2579383_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	1.7e-102
WP_000113189.1|2579360_2579609_-	excisionase	NA	NA	NA	NA	NA
WP_000102181.1|2579673_2582118_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
WP_000092782.1|2582210_2582399_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|2582395_2582584_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000380314.1|2583071_2583224_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000367559.1|2583393_2583783_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024213789.1|2583885_2584161_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000693888.1|2584144_2584570_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095667.1|2584592_2585546_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000790456.1|2585552_2586293_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_000450888.1|2586322_2587093_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
WP_001118161.1|2587108_2587504_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_001302146.1|2587560_2587917_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_000063625.1|2587965_2588178_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000137941.1|2588213_2588585_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000610379.1|2588581_2588944_+	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_001278450.1|2589059_2589164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2589352_2589565_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000998188.1|2589861_2590029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304183.1|2590094_2590373_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000904137.1|2591436_2591811_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762904.1|2591807_2592629_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
WP_000917735.1|2592855_2593053_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483497.1|2593203_2594262_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_137049463.1|2594753_2596604_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_024164617.1|2597042_2597258_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075112.1|2597257_2597755_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_001208680.1|2597971_2598157_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|2598684_2598999_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|2599080_2599305_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303046.1|2599346_2599712_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958387.1|2600000_2600564_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2600560_2602222_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|2602285_2604223_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2604267_2604489_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2604434_2606936_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2607015_2607342_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2607351_2607702_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2607698_2608145_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2608141_2608486_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2608544_2609261_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2609266_2609641_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453746.1|2609736_2609946_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|2609993_2613236_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2613228_2613570_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_137049464.1|2613569_2614007_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	99.2	1.1e-62
WP_162829348.1|2614128_2615342_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_012779365.1|2615507_2618768_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.3	0.0e+00
WP_001304111.1|2618770_2618986_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2619053_2619653_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_137049465.1|2619717_2621031_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	7.4e-78
WP_001023362.1|2621032_2621302_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131642.1|2621417_2621993_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121225.1|2622702_2623353_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2623935_2625474_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2625523_2625871_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2625867_2626248_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001120551.1|2627210_2627453_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2628163_2629408_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2629500_2629689_-	DUF1482 family protein	NA	NA	NA	NA	NA
2629415:2629462	attR	ACCTCATTACAGATTTAAGGGTGAACAAATCCCTGCCATTGCTGGCAT	NA	NA	NA	NA
WP_000449175.1|2629685_2629874_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2630438_2630648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2630648_2631287_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2631298_2631451_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2631743_2632082_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2632473_2632716_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2632699_2633125_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2633193_2634237_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|2634229_2634691_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2634724_2635441_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2635473_2635755_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2635751_2635979_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2635971_2636283_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_137049466.1|2636410_2636629_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	73.6	1.1e-21
WP_000104474.1|2636630_2637188_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2637421_2637634_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2637753_2638098_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2638219_2638492_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2638493_2639543_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2639555_2639861_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2639923_2640478_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2640702_2640900_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2641036_2641750_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001303509.1|2642204_2642633_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023185.1|2643110_2644961_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_024180155.1|2645400_2645616_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2645620_2645965_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2646015_2646549_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2646819_2647389_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2647388_2647535_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2647757_2647943_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2648468_2648783_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2648864_2649089_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2649475_2650021_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2649995_2651921_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2651917_2652124_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2652120_2653722_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2653702_2655022_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2655031_2655364_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2655419_2656445_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2656486_2656885_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2656896_2657250_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2657264_2657798_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2657794_2658190_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2658197_2658950_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2658963_2659386_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2659412_2659826_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000847298.1|2662415_2662745_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001303044.1|2662744_2663443_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_001303043.1|2663453_2664197_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_129137391.1|2664142_2664775_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_137049467.1|2665021_2668501_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001230509.1|2668568_2669168_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_024748460.1|2669232_2670546_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
WP_001023407.1|2670547_2670817_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2670930_2671506_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2671578_2672208_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2672289_2672931_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|2673092_2673335_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2673466_2674750_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2674838_2676299_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2676334_2676538_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 7
NZ_CP038284	Escherichia coli O157:H7 strain YB14-1 chromosome, complete genome	5546361	2946809	3058932	5546361	terminase,protease,portal,head,integrase,capsid,holin,lysis,tail	Escherichia_phage(29.79%)	126	2962311:2962338	3059069:3059096
WP_000422055.1|2946809_2947859_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2948078_2948837_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2948833_2949424_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2949463_2950336_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2950548_2952132_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2952159_2952780_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2952776_2953658_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2953795_2953840_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2953931_2955494_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763503.1|2955493_2957089_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983855.1|2957089_2958451_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	7.3e-36
WP_000209521.1|2958462_2959656_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2959655_2960462_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2960842_2961022_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2961107_2961608_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2961653_2962160_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2962311:2962338	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_000251936.1|2962649_2962820_-	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_032243391.1|2963197_2963782_-	protein kinase	NA	NA	NA	NA	NA
WP_001023407.1|2964911_2965181_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268983.1|2965182_2966496_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	8.5e-82
WP_001230517.1|2966560_2967160_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	1.7e-109
WP_171878413.1|2967226_2970703_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.7	0.0e+00
WP_077775224.1|2970943_2971573_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	6.4e-104
WP_001303030.1|2971518_2972262_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	1.3e-148
WP_001303033.1|2972272_2972971_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	7.6e-130
WP_000847298.1|2972970_2973300_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918272.1|2973296_2975942_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.6	0.0e+00
WP_000532075.1|2975985_2976294_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_000479059.1|2976320_2976743_-|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.9	1.3e-71
WP_000235090.1|2976756_2977509_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2977516_2977915_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2977927_2978551_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2978553_2978835_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2978827_2979154_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001365078.1|2979241_2981221_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.9	0.0e+00
WP_000974567.1|2981210_2982713_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
WP_000102415.1|2982712_2982925_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_171878414.1|2982921_2985045_-|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	98.9	0.0e+00
WP_000373407.1|2985041_2985518_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001082574.1|2985931_2986399_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	99.4	2.0e-78
WP_000539792.1|2986406_2986553_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_000087729.1|2987397_2987931_-	lysozyme	NA	A0A2R2Z343	Escherichia_phage	100.0	1.3e-102
WP_001072899.1|2987935_2988151_-|holin	class II holin family protein	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_001290230.1|2988228_2988474_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143462.1|2988514_2988694_-	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_000142957.1|2988829_2990776_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
WP_000935552.1|2991279_2992338_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	1.5e-206
WP_000917735.1|2992488_2992686_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762909.1|2992912_2993734_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.5e-81
WP_000904137.1|2993730_2994105_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_001265167.1|2994117_2995167_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.9e-108
WP_032156506.1|2995168_2995447_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	6.3e-11
WP_077625879.1|2995516_2995777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2995993_2996206_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000373318.1|2996559_2997354_+	protein kinase	NA	A0A1S5V1U4	Saudi_moumouvirus	29.7	7.3e-12
WP_000789359.1|2997337_2998054_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_001224661.1|2998313_2998487_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.2e-25
WP_000403785.1|2998582_2998939_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001118156.1|2999011_2999392_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.5	4.1e-29
WP_000450846.1|2999407_3000178_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.4	1.4e-84
WP_157837342.1|3000211_3000754_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_171878415.1|3000665_3001706_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.7	1.8e-90
WP_000705378.1|3001677_3002229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000476986.1|3002212_3002440_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001003379.1|3002517_3002925_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000379610.1|3003114_3003267_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.7e-07
WP_000449175.1|3003754_3003943_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199474.1|3003939_3004131_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102133.1|3004223_3006668_+	exonuclease	NA	V5UQJ3	Shigella_phage	59.1	4.0e-178
WP_000113189.1|3006732_3006981_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3006958_3008089_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_101972944.1|3014159_3014429_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_137049470.1|3014430_3015744_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	99.8	8.2e-85
WP_001230495.1|3015808_3016408_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	3.7e-109
WP_137049471.1|3016474_3019954_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.0	0.0e+00
WP_137049495.1|3020200_3020833_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	94.7	1.8e-106
WP_001303043.1|3020778_3021522_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_115442178.1|3021532_3022231_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	7.3e-133
WP_000807954.1|3022230_3022572_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|3022564_3025807_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|3025854_3026064_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_001030063.1|3026159_3026534_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3026539_3027256_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|3027314_3027659_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3027655_3028102_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3028098_3028449_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3028458_3028785_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001063023.1|3031310_3031532_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000173024.1|3031576_3033514_-|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.7	0.0e+00
WP_001413036.1|3033577_3035239_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.6	0.0e+00
WP_137049461.1|3035235_3035799_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	83.9	3.8e-71
WP_015994246.1|3036088_3036454_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|3036495_3036723_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3037147_3037333_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3037560_3037707_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3037706_3038276_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3038546_3039080_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3039130_3039475_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3039479_3039695_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|3039844_3041698_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|3042494_3043553_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|3043703_3043901_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3044142_3044673_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3044681_3045041_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3045053_3046100_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|3046101_3046380_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3046449_3046707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|3046927_3047140_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3047418_3048177_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3048875_3049040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3049036_3049618_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|3049804_3050347_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3050258_3051299_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3051270_3051822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3051805_3052033_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3052109_3052517_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3052780_3053080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3053152_3053371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3053393_3053801_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3053778_3054012_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3054005_3054173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3054570_3054759_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3054755_3054947_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048549.1|3055039_3057511_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_000113189.1|3057575_3057824_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3057801_3058932_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
3059069:3059096	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 8
NZ_CP038284	Escherichia coli O157:H7 strain YB14-1 chromosome, complete genome	5546361	3105628	3199320	5546361	protease,head,portal,terminase,integrase,capsid,holin,transposase,lysis,tRNA,tail	Enterobacteria_phage(49.06%)	100	3169887:3169902	3198141:3198156
WP_001299679.1|3105628_3106885_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3107098_3107722_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3107721_3108573_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3108723_3109671_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3109795_3111475_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3111529_3111808_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3112085_3112670_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3112786_3113878_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|3114721_3117607_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|3117706_3119626_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_001295616.1|3120332_3120944_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3121043_3121958_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3122053_3123790_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_162829348.1|3123947_3125161_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000197859.1|3125498_3126569_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3126578_3127877_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3128239_3129772_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|3129823_3130543_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3130764_3132306_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3132451_3132982_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3133027_3134296_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3134295_3134715_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3135087_3135999_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3136205_3136667_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3136743_3137403_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3137474_3137768_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3137779_3137938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3138008_3138410_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3138512_3138881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3139400_3140096_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3140119_3140932_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3140935_3141202_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3142433_3143018_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3143516_3144470_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3144656_3146141_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3146443_3147982_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3148031_3148379_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3148375_3148756_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3148831_3149080_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3149136_3149805_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3150302_3150485_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3150563_3151064_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3151100_3151607_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3151625_3152516_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3152635_3153217_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3153216_3156132_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3156196_3156796_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3156862_3160261_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3160321_3160954_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3160890_3161634_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3161639_3162338_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3162337_3162667_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3162663_3165213_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3165205_3165640_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3165621_3166044_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3166059_3166800_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3166807_3167203_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3167199_3167778_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3167789_3168143_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3168154_3168553_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3168594_3169620_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3169674_3170007_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
3169887:3169902	attL	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_000123254.1|3170016_3171336_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3171316_3172918_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3172914_3173121_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3173117_3175043_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3175017_3175563_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3175951_3176146_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3176310_3176517_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3176802_3177213_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3177504_3177798_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3177888_3178071_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3178287_3178764_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3178750_3179056_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3179377_3180067_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3180063_3180204_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3180200_3180563_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3180559_3180850_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3180842_3181013_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3181012_3181468_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3181969_3183496_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3183553_3183676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3183740_3184073_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3184140_3184443_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3184439_3185141_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088657.1|3186065_3186302_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3186291_3187434_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3187547_3188798_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3188969_3189623_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3189632_3190094_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3190147_3191254_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3191289_3191931_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3191934_3193305_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265474.1|3193473_3194145_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3194144_3195605_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3196205_3196487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3196742_3197285_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3197490_3197904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3197916_3198252_-|head	head decoration protein	head	NA	NA	NA	NA
3198141:3198156	attR	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_000907465.1|3198264_3199320_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 9
NZ_CP038284	Escherichia coli O157:H7 strain YB14-1 chromosome, complete genome	5546361	3205412	3264065	5546361	tail,portal,head,terminase,integrase,capsid,holin,transposase	Enterobacteria_phage(26.79%)	71	3249632:3249652	3270722:3270742
WP_032174463.1|3205412_3206630_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.8	6.1e-127
WP_162829200.1|3206628_3207841_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001301987.1|3208203_3209325_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3209373_3210600_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3210849_3211986_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3211969_3212833_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3213196_3214558_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3214618_3214894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3217202_3220604_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3221194_3223543_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3223562_3223652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3223664_3223901_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3223846_3224584_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3224637_3225516_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3225818_3225929_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3226038_3226293_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3226309_3227008_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807954.1|3227007_3227349_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|3227341_3230584_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|3230631_3230841_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3230936_3231311_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3231325_3232042_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3232100_3232445_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3232441_3232888_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3232884_3233235_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3233244_3233571_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3233650_3236152_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3236097_3236319_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3236363_3238301_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3238364_3240026_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|3240022_3240586_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|3240877_3241243_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001302977.1|3241284_3241470_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3241599_3241740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3242096_3242321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3242385_3242592_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3242819_3242966_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_000992148.1|3243804_3244338_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3244388_3244733_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3244737_3244953_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3245028_3245298_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3245335_3245518_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023147.1|3245665_3247603_-	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	76.6	4.8e-291
WP_000216629.1|3247917_3248085_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3248681_3249503_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3249499_3249874_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3249632:3249652	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265159.1|3249886_3250936_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001341388.1|3250937_3251216_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3251383_3251596_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3251784_3251889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3252004_3252592_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3252594_3252786_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3252787_3253225_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3253211_3253529_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3253482_3253800_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3253789_3254092_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3254088_3254370_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3254402_3255119_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3255152_3255695_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_137049477.1|3255606_3256644_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	81.4	5.5e-92
WP_000693962.1|3256712_3257138_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3257121_3257445_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3257569_3258046_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3258361_3258514_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3258628_3259144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3259276_3259666_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3259727_3259997_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3259965_3261084_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3261250_3262045_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3262041_3263088_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3263243_3264065_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3270722:3270742	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 10
NZ_CP038284	Escherichia coli O157:H7 strain YB14-1 chromosome, complete genome	5546361	3515056	3570400	5546361	protease,portal,head,terminase,integrase,capsid,holin,transposase,tail	Escherichia_phage(27.27%)	63	3516991:3517006	3572165:3572180
WP_000003653.1|3515056_3515644_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3515640_3516348_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3516366_3518160_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3516991:3517006	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3518156_3519275_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023407.1|3521267_3521537_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268855.1|3521538_3522852_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001230444.1|3522916_3523516_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515109.1|3523583_3527057_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_000649827.1|3527190_3527718_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_050546863.1|3527908_3528541_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3528486_3529230_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001302968.1|3529240_3529939_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000847298.1|3529938_3530268_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082473.1|3530264_3532844_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|3532824_3533238_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3533264_3533696_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3533709_3534450_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3534431_3534698_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3534755_3535103_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3535139_3536645_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3536634_3538227_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3538223_3538430_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3538413_3540342_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000998048.1|3540605_3542144_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3542193_3542541_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3542537_3542918_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3542993_3543269_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3544019_3544226_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3544481_3544754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3544913_3545447_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3545667_3545781_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3546002_3546188_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3546715_3547030_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3547234_3548448_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|3548623_3550474_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3551240_3551954_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3552574_3553393_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3553544_3553916_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3553905_3554277_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3554289_3555339_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3555340_3555619_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3555786_3555942_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3556043_3556181_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3556546_3557320_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3557671_3558085_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3558100_3558871_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3558892_3559639_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3559645_3560737_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3560815_3561271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3561477_3561903_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3561886_3562159_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3562267_3562669_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3562696_3562888_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3562887_3563175_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3563452_3563608_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3563749_3564139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3564325_3564511_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3565084_3565273_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3565269_3565461_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3565554_3568026_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3568093_3568336_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3568313_3569333_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3569740_3570400_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3572165:3572180	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 11
NZ_CP038284	Escherichia coli O157:H7 strain YB14-1 chromosome, complete genome	5546361	3801328	3839423	5546361	protease,portal,integrase,holin,lysis,tail	Enterobacteria_phage(52.5%)	47	3800913:3800927	3839497:3839511
3800913:3800927	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3801328_3802027_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3802257_3803139_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3803307_3803469_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3803965_3804985_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3805018_3805999_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3806175_3806445_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3806446_3807763_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3807822_3808422_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000090841.1|3811966_3812575_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3812511_3813255_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3813260_3813959_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3813968_3814298_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3814297_3817363_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3817334_3817664_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3817672_3818059_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3818119_3818863_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3818873_3819275_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3819271_3819850_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3819861_3820137_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3820129_3820453_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136598.1|3820539_3822567_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_127446149.1|3822511_3822847_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3822968_3824093_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3824020_3824233_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001139679.1|3827496_3827649_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3827636_3828104_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3828100_3828598_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3828597_3828813_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3828955_3829354_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3829434_3829593_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3829678_3830422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3830605_3831295_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3831309_3831432_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3831769_3832729_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028857.1|3832940_3833606_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_001108055.1|3833602_3834223_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3834215_3834386_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3834382_3834565_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3835262_3835943_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3835939_3836122_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3836094_3836286_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3836296_3836578_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3836676_3836898_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3837108_3837711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3837953_3838121_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3838160_3838379_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3838652_3839423_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3839497:3839511	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 12
NZ_CP038284	Escherichia coli O157:H7 strain YB14-1 chromosome, complete genome	5546361	4382600	4463157	5546361	tail,head,protease,portal,terminase,integrase,capsid,holin,lysis,transposase,plate	Shigella_phage(45.0%)	95	4419719:4419765	4459255:4459301
WP_000998048.1|4382600_4384139_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4384188_4384536_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_054249760.1|4384532_4384913_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	2.1e-65
WP_000803998.1|4385176_4385440_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4385439_4385580_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4385649_4385841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4386665_4387208_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4387282_4387870_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_171878418.1|4387927_4388596_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001265657.1|4391137_4392781_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4392749_4393460_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4393772_4394102_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4394349_4394964_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4395381_4396071_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4396067_4397024_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4397020_4399219_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4399228_4400185_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4400363_4401491_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4401632_4402691_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4402936_4403839_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4404541_4404820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4404986_4405709_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4405807_4406707_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4407382_4408339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4408471_4410805_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4410818_4411142_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4411141_4411363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4411359_4411917_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4411913_4412174_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4413107_4413860_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4413856_4414408_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4414413_4414686_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4415095_4415662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4415661_4416252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4416282_4416915_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4416907_4417366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4417365_4417983_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4417955_4418372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4418375_4419557_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
4419719:4419765	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000246059.1|4420519_4421263_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355484.1|4422087_4422861_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000905124.1|4422921_4423476_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_001145350.1|4423506_4423917_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	97.6	6.5e-65
WP_001008234.1|4423937_4424381_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_000368084.1|4424352_4424955_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_000554706.1|4424954_4425725_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000383550.1|4425728_4426313_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000785302.1|4426303_4427362_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000424732.1|4427348_4427774_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259066.1|4427773_4428322_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000999513.1|4428321_4429401_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_000219910.1|4429397_4430726_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000807197.1|4430786_4432622_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000661054.1|4432763_4433033_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090993.1|4433032_4433389_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_000155728.1|4433388_4434885_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000497751.1|4434868_4435039_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779288.1|4435047_4435608_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000224836.1|4435604_4436111_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702395.1|4436085_4436496_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000924828.1|4436492_4436816_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000766100.1|4436894_4438124_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000999805.1|4438134_4438737_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000923141.1|4438729_4439956_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000838374.1|4439945_4440107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128484532.1|4440103_4441600_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000929175.1|4441833_4442328_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_162829202.1|4442730_4443943_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000738423.1|4444642_4444936_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4445026_4445209_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001197766.1|4445425_4445902_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120501.1|4445905_4446241_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001449601.1|4446377_4446671_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001310393.1|4446949_4447183_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484663.1|4447326_4447866_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001008431.1|4448080_4448833_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_001360050.1|4448846_4449836_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061444.1|4449843_4450653_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|4450672_4451062_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210141.1|4451058_4451385_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_001303054.1|4451381_4452035_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_072141203.1|4452034_4452529_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_000104949.1|4452525_4453467_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_001250269.1|4453456_4453636_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|4453811_4454363_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|4454355_4454616_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|4454713_4455406_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000917896.1|4455683_4455980_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000008235.1|4456656_4457193_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_001242749.1|4457183_4457546_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|4457545_4457851_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|4458077_4459241_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893282.1|4459445_4460699_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4459255:4459301	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4460710_4461814_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4462101_4463157_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 13
NZ_CP038284	Escherichia coli O157:H7 strain YB14-1 chromosome, complete genome	5546361	4481943	4555188	5546361	protease,tRNA,transposase,plate	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
WP_000027427.1|4481943_4483116_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4483196_4483382_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4483296_4483560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000509142.1|4483761_4487985_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	2.4e-21
WP_000103335.1|4488060_4490202_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_001142958.1|4490411_4490930_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4491626_4492127_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4492161_4492386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4492436_4493828_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4493918_4494332_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4494335_4496186_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4496149_4497232_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4497256_4498537_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4498533_4499058_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246433.1|4499060_4500392_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343292.1|4500396_4501158_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614377.1|4501166_4503950_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.4	6.2e-82
WP_000088854.1|4503946_4504690_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240517.1|4504694_4506107_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001303798.1|4506243_4509678_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_171878419.1|4509688_4511098_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001284958.1|4511063_4511543_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000002701.1|4511563_4511785_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|4511863_4512460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|4512462_4512912_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001301976.1|4514727_4515459_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_000917883.1|4515523_4515991_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301721.1|4515987_4516710_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|4516743_4517499_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644686.1|4517570_4518929_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211693.1|4518976_4519747_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4519824_4520625_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648586.1|4520865_4521780_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997018.1|4521776_4522580_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_001140187.1|4528339_4528915_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4529102_4530134_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294606.1|4530126_4530780_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874227.1|4530819_4531635_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202328.1|4531752_4532157_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094000.1|4532153_4532861_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260720.1|4532971_4534690_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001302206.1|4534742_4535567_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239181.1|4535766_4536477_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635546.1|4536490_4536901_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185286.1|4536897_4537443_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|4537608_4537809_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|4537795_4538056_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176537.1|4538108_4539404_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|4539468_4539858_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020954.1|4539914_4542056_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|4542154_4543114_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294772.1|4543126_4546609_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000569419.1|4546645_4547242_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_000139661.1|4547238_4548387_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565963.1|4548386_4549175_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4549178_4549634_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139282.1|4549738_4550764_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|4550767_4551253_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|4551373_4553806_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|4553835_4555188_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 14
NZ_CP038284	Escherichia coli O157:H7 strain YB14-1 chromosome, complete genome	5546361	4895155	4907731	5546361	integrase	Enterobacteria_phage(81.82%)	15	4894189:4894204	4912684:4912699
4894189:4894204	attL	TTTCGATGAACAGCAC	NA	NA	NA	NA
WP_001301682.1|4895155_4895983_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
WP_044815386.1|4896200_4896395_-	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_000783684.1|4896750_4899084_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_000856729.1|4899098_4899419_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459287.1|4899554_4900010_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001244670.1|4900002_4900290_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000980224.1|4900282_4900873_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001149160.1|4900869_4901136_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283021.1|4901687_4902422_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_000638634.1|4902418_4902919_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446132.1|4902992_4903565_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000095622.1|4903890_4905135_+	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_001453880.1|4905172_4905907_-	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000936844.1|4905983_4906289_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000772662.1|4906456_4907731_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
4912684:4912699	attR	TTTCGATGAACAGCAC	NA	NA	NA	NA
>prophage 15
NZ_CP038284	Escherichia coli O157:H7 strain YB14-1 chromosome, complete genome	5546361	4940169	4999197	5546361	transposase,protease	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|4940169_4941522_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4941615_4942167_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4942322_4943696_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4943871_4944870_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4944902_4945898_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4945884_4946907_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|4946920_4948423_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4948562_4949519_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4949828_4950359_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4950438_4950789_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4950782_4951034_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4951245_4951587_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|4951589_4955369_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4955365_4957099_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4957304_4957943_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4958265_4959609_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4959704_4959911_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175296.1|4960235_4960790_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|4960852_4961791_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4962002_4962743_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589488.1|4962932_4964876_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_001302935.1|4964993_4965374_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4965462_4966323_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4966430_4967396_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4967503_4968166_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4968210_4969623_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4969931_4970552_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4970769_4971408_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4971542_4972751_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4972758_4973190_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4973812_4974607_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4974677_4975127_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4975168_4975396_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4975400_4975715_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4975721_4976117_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4976443_4976719_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4976847_4977534_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|4977533_4978388_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4978397_4979048_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4979061_4979526_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4979535_4979841_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|4979856_4981254_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|4982780_4983536_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|4983532_4984282_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4984463_4984793_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4984941_4985217_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4985333_4986959_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4987042_4988206_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4988208_4988847_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4988856_4989255_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|4989272_4989932_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4989982_4990681_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4990699_4991101_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4991227_4991959_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|4992139_4994581_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|4994619_4995045_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4995249_4996548_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4996651_4996849_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4996930_4997935_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4997937_4999197_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 16
NZ_CP038284	Escherichia coli O157:H7 strain YB14-1 chromosome, complete genome	5546361	5136076	5150741	5546361	tRNA,integrase,tail	Enterobacteria_phage(43.75%)	19	5131917:5131932	5149446:5149461
5131917:5131932	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5136076_5137492_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5137574_5138558_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5138723_5138966_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5139099_5140137_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5140225_5141323_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5141384_5141633_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5141793_5142435_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5142516_5143146_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5143218_5143791_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5143902_5144172_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5144173_5145487_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5145551_5146151_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5147472_5148009_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5147999_5148350_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5148346_5148631_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5148966_5149164_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5149508_5149790_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5149446:5149461	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5149837_5150011_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5150207_5150741_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 17
NZ_CP038284	Escherichia coli O157:H7 strain YB14-1 chromosome, complete genome	5546361	5172107	5210467	5546361	protease,tail,head,transposase,plate	Shigella_phage(56.41%)	57	NA	NA
WP_000077537.1|5172107_5172638_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_001310454.1|5172828_5173077_+	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289290.1|5173078_5175169_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
WP_000129790.1|5175239_5176172_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000268103.1|5176174_5176396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|5176408_5176663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|5176664_5176946_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|5176942_5177215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049304.1|5177219_5177513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|5177524_5178055_+	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323222.1|5178152_5178695_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_000564283.1|5178698_5179232_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
WP_000465559.1|5179231_5179747_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.6	5.5e-45
WP_000977060.1|5179750_5180302_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621195.1|5180298_5180484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000021235.1|5180522_5180855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|5180847_5181045_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000370523.1|5181034_5181331_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214362.1|5181327_5181837_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000852377.1|5181906_5182332_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|5182403_5182904_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|5182938_5183367_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122256.1|5183350_5183569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342746.1|5183578_5183806_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|5183786_5184095_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279084.1|5184091_5184382_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
WP_000360581.1|5184384_5184966_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057672.1|5184965_5186630_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
WP_000532593.1|5186629_5188219_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
WP_000046893.1|5188202_5189528_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
WP_000094804.1|5189646_5190120_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
WP_000850811.1|5190296_5191421_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
WP_001142982.1|5191420_5192368_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_001002060.1|5192411_5192780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|5192776_5193196_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|5193192_5193753_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|5193753_5193999_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|5193995_5195498_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|5195506_5195872_+|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|5195886_5196363_+|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113525.1|5196489_5198565_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_000146116.1|5198551_5199901_+	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000098807.1|5199884_5201009_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|5200998_5201613_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|5201605_5202043_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|5202042_5203125_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301577.1|5203115_5203676_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_000469162.1|5203675_5204587_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|5204621_5205143_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|5205222_5205426_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|5205648_5206209_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|5206308_5208348_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|5208494_5208677_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|5208712_5208958_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|5208996_5209461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310452.1|5209575_5209776_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528251.1|5209729_5210467_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
>prophage 1
NZ_CP038286	Escherichia coli O157:H7 strain YB14-1 plasmid pYB14-1, complete sequence	100480	8213	59432	100480	integrase,protease,transposase	Stx2-converting_phage(60.0%)	42	44007:44021	65293:65307
WP_001034097.1|8213_12116_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
WP_001302199.1|14293_15115_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|15114_16221_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|16310_18032_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|18105_19104_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001110622.1|19368_19800_-|transposase	transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	5.4e-78
WP_000612591.1|21437_21785_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_054249760.1|21781_22162_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	2.1e-65
WP_171878422.1|22237_23209_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.8e-185
WP_000998048.1|23350_24889_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|24938_25286_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_054249760.1|25282_25663_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	2.1e-65
WP_000612591.1|25855_26203_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_054249760.1|26199_26580_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	2.1e-65
WP_072141201.1|27287_29984_+|protease	metalloprotease StcE	protease	NA	NA	NA	NA
WP_001302175.1|30070_30946_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001302177.1|30946_32914_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|32913_34419_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173152.1|34420_35644_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|35674_36109_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_000082929.1|36105_36660_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000173396.1|36674_37022_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082782.1|37018_37618_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000776550.1|37614_38592_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_071525076.1|38630_39803_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|39789_40302_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|40359_41193_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|41284_41686_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000839950.1|43576_44092_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
44007:44021	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000217739.1|44093_47090_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|47139_49260_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|49263_50703_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_010891288.1|51446_51677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|51797_52538_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|52822_53800_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|54207_54408_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|54404_55025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|55021_55705_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|56163_56382_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|56383_56689_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|56689_57496_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829202.1|58218_59432_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
65293:65307	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
