The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038290	Escherichia coli O157:H7 strain TX 265-1 chromosome, complete genome	5590682	1229997	1243434	5590682	tail,holin	Enterobacteria_phage(38.46%)	17	NA	NA
WP_001223948.1|1229997_1230609_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1230605_1231271_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1231267_1231891_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1232143_1232887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1232972_1233140_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143068.1|1233547_1235401_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000284517.1|1235550_1235766_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1235770_1236115_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1236471_1236852_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1236848_1237196_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001023396.1|1237813_1238083_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1238243_1238666_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1238795_1239854_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1239932_1240583_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1240765_1241356_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1241857_1242106_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1242951_1243434_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP038290	Escherichia coli O157:H7 strain TX 265-1 chromosome, complete genome	5590682	1524781	1530207	5590682	integrase	Enterobacteria_phage(50.0%)	6	1513769:1513785	1532403:1532419
1513769:1513785	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1524781_1525351_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1525350_1525818_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1525804_1526485_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1526494_1527631_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1527805_1528963_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1529274_1530207_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1532403:1532419	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038290	Escherichia coli O157:H7 strain TX 265-1 chromosome, complete genome	5590682	1774488	1855600	5590682	capsid,tRNA,terminase,head,protease,tail,holin	Enterobacteria_phage(44.19%)	94	NA	NA
WP_000569336.1|1774488_1775415_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1775419_1776151_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1776131_1776239_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1776298_1777000_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063643.1|1777020_1778307_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1778340_1778595_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1778613_1778748_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1778751_1778994_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1779081_1779444_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1779440_1779797_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1780130_1780307_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1780308_1781256_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1781252_1781474_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1781572_1781854_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1781864_1782056_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1782028_1782211_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186785.1|1782210_1782888_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	99.1	2.3e-131
WP_000100847.1|1782884_1783670_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995407.1|1783675_1783972_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	5.2e-48
WP_000361826.1|1784047_1784191_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	97.9	3.5e-18
WP_001198858.1|1784183_1784324_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000065373.1|1784396_1784765_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	7.6e-65
WP_000095081.1|1784945_1785569_-	hypothetical protein	NA	A0A2D1GLY1	Escherichia_phage	96.6	2.8e-107
WP_000198445.1|1785630_1786014_-	hypothetical protein	NA	Q08J47	Stx2-converting_phage	100.0	3.9e-64
WP_000745483.1|1786502_1786667_-	hypothetical protein	NA	G9L672	Escherichia_phage	100.0	5.1e-21
WP_000957426.1|1786669_1787716_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_001221211.1|1787709_1788171_-	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000885203.1|1788238_1788580_-	DUF3024 domain-containing protein	NA	A0A1I9LJN9	Stx_converting_phage	100.0	3.9e-63
WP_000250473.1|1788640_1789348_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001180318.1|1789426_1789654_+	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438524.1|1789792_1790089_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	98.0	4.4e-47
WP_000166961.1|1790121_1790283_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539349.1|1790269_1791091_+	replication protein	NA	B6DZ75	Enterobacteria_phage	100.0	1.5e-153
WP_001248388.1|1791087_1792464_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|1792534_1792813_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103679.1|1792945_1793161_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1793171_1793408_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_001310475.1|1793364_1793811_+	recombination protein NinB	NA	A0A1U9AJ79	Stx1_converting_phage	100.0	2.4e-81
WP_000153268.1|1793807_1794335_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|1794331_1794514_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000290551.1|1794789_1795467_+	phage antirepressor Ant	NA	Q4A1A4	Enterobacteria_phage	97.8	2.2e-126
WP_001004018.1|1795541_1796264_+	phage antirepressor KilAC domain-containing protein	NA	B6DZ83	Enterobacteria_phage	100.0	3.5e-130
WP_001107998.1|1796263_1796869_+	recombination protein NinG	NA	B6DZ84	Enterobacteria_phage	100.0	6.6e-98
WP_000144759.1|1796865_1797060_+	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001204852.1|1797052_1797487_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000691354.1|1797993_1798941_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1798950_1799220_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_064261944.1|1799719_1801570_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.8	0.0e+00
WP_024164617.1|1802008_1802224_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000731236.1|1802228_1802573_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992166.1|1802623_1803157_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	5.6e-101
WP_001056806.1|1803427_1803997_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539794.1|1803996_1804143_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	95.8	1.7e-15
WP_012816791.1|1804370_1804556_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1804980_1805208_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|1805249_1805615_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958400.1|1805906_1806470_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	93.6	4.7e-82
WP_001358824.1|1806466_1808128_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.6	0.0e+00
WP_171876987.1|1808191_1810129_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	99.2	0.0e+00
WP_001063025.1|1810173_1810395_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|1812921_1813248_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|1813258_1813609_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|1813605_1814052_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1814048_1814393_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275464.1|1814458_1815175_+	immunoglobulin domain-containing protein	NA	B6DZA6	Enterobacteria_phage	100.0	1.2e-127
WP_000710952.1|1815189_1815564_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|1815659_1815869_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|1815916_1819159_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|1819151_1819493_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152183.1|1819492_1820191_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	6.6e-134
WP_001302649.1|1820207_1820528_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1820635_1820809_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|1820879_1821803_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_000967271.1|1821856_1822594_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_149025382.1|1822539_1823172_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	99.0	4.9e-104
WP_015994252.1|1823431_1826911_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	100.0	0.0e+00
WP_001230508.1|1826978_1827578_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268879.1|1827642_1828812_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	100.0	4.3e-85
WP_001023396.1|1828813_1829083_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_072142879.1|1829243_1829660_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1829741_1830383_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1830544_1830793_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1831307_1832993_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1832989_1833709_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1833755_1834226_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1834267_1834729_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1834853_1836857_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1836853_1837990_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1837982_1838714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1838732_1840262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1840272_1841361_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1842601_1842919_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1842980_1846610_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1853566_1855600_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 4
NZ_CP038290	Escherichia coli O157:H7 strain TX 265-1 chromosome, complete genome	5590682	1881225	1918476	5590682	capsid,lysis,portal,tRNA,integrase,terminase,head,plate,tail,holin	Escherichia_phage(40.82%)	52	1883006:1883033	1914150:1914177
WP_000807362.1|1881225_1882125_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1882530_1882848_+	hypothetical protein	NA	NA	NA	NA	NA
1883006:1883033	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985261.1|1883112_1884126_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_001306384.1|1884241_1884541_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|1884655_1884931_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001005166.1|1884941_1885112_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	6.7e-24
WP_000217679.1|1885108_1885609_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_000557701.1|1885672_1885897_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_001277943.1|1885896_1886199_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	95.0	1.9e-45
WP_001113260.1|1886198_1886423_+	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	5.5e-34
WP_000027665.1|1886419_1886695_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	98.9	6.6e-45
WP_000268557.1|1886684_1888973_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.6	0.0e+00
WP_001302990.1|1889381_1889537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310277.1|1889573_1889882_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	40.2	1.7e-12
WP_000746343.1|1889859_1890810_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.0	3.8e-39
WP_000042038.1|1890934_1891372_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	92.3	1.6e-69
WP_001177885.1|1891595_1891865_-	hypothetical protein	NA	Q2P9X2	Enterobacteria_phage	89.9	3.8e-29
WP_000038195.1|1892077_1893112_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	96.2	4.5e-195
WP_000156861.1|1893111_1894884_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085969.1|1895057_1895912_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	95.8	5.8e-132
WP_001248573.1|1895966_1897040_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.7	6.7e-202
WP_000203439.1|1897043_1897787_+|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	98.4	8.6e-124
WP_000988633.1|1897886_1898396_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|1898395_1898599_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123125.1|1898602_1898884_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	98.9	6.3e-43
WP_001144113.1|1898883_1899381_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	2.6e-92
WP_000736588.1|1899395_1899821_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	94.3	2.1e-58
WP_000040660.1|1899808_1900234_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	1.8e-65
WP_001300730.1|1900205_1900379_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917172.1|1900341_1900809_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	7.4e-81
WP_001001774.1|1900801_1901254_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	1.4e-76
WP_001093756.1|1901320_1901956_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	4.5e-113
WP_000127172.1|1901952_1902300_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_001121492.1|1902304_1903213_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.0	8.3e-161
WP_001285344.1|1903205_1903817_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	4.9e-117
WP_000216996.1|1903813_1905235_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	80.1	1.5e-196
WP_001008242.1|1905255_1905699_+|tail	tail fiber assembly protein	tail	M1SNQ2	Escherichia_phage	97.3	1.6e-80
WP_000368070.1|1905670_1906273_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	98.5	5.9e-107
WP_001145598.1|1906272_1906761_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	99.3	3.7e-83
WP_000905091.1|1906791_1907385_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	1.3e-103
WP_001286714.1|1907444_1908635_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	1.5e-223
WP_001251408.1|1908647_1909166_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031307.1|1909222_1909498_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|1909530_1909650_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069920.1|1909642_1912090_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	95.7	0.0e+00
WP_000978915.1|1912104_1912584_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	1.5e-84
WP_000882987.1|1912583_1913747_+	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	98.7	3.5e-204
WP_000468308.1|1913828_1914047_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1914321_1915683_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
1914150:1914177	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001301848.1|1915830_1916163_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|1916353_1917076_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|1917072_1918476_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 5
NZ_CP038290	Escherichia coli O157:H7 strain TX 265-1 chromosome, complete genome	5590682	2001700	2152791	5590682	transposase,capsid,lysis,portal,integrase,terminase,head,protease,tail,holin	Stx2-converting_phage(45.31%)	169	1998318:1998332	2106046:2106060
1998318:1998332	attL	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_001007946.1|2001700_2002879_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|2002859_2003051_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|2003128_2003473_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|2003660_2004011_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001289930.1|2004877_2005825_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|2005821_2006043_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|2006141_2006423_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548528.1|2006433_2006625_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|2006597_2006780_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186848.1|2006776_2007457_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_001302855.1|2007453_2008239_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000995486.1|2008244_2008541_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|2008616_2008760_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2008728_2008893_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|2008965_2009334_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|2009516_2009768_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|2009826_2010099_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|2010076_2010259_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|2010827_2011349_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|2011850_2012546_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|2012620_2012836_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|2012977_2013274_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|2013306_2013468_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|2013454_2014276_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|2014272_2015649_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001171554.1|2015776_2016157_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2016153_2016501_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2016550_2018089_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001220560.1|2018177_2018789_+	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_000344569.1|2019252_2019585_+	hypothetical protein	NA	A0A0P0ZCF4	Stx2-converting_phage	100.0	3.3e-59
WP_000103678.1|2019717_2019933_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|2019943_2020180_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|2020136_2020583_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|2020579_2021107_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|2021103_2021286_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208500.1|2021560_2022325_+	phage antirepressor Ant	NA	A0A0P0ZB11	Stx2-converting_phage	100.0	1.4e-121
WP_001004016.1|2022399_2023122_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|2023121_2023727_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|2023723_2024395_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|2024385_2024874_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|2025523_2026483_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|2026494_2026764_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|2027060_2027384_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143113.1|2027627_2029565_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	100.0	0.0e+00
WP_000143458.1|2029701_2029881_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2029921_2030194_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|2030270_2030486_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|2030485_2030983_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|2030979_2031417_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|2031619_2032117_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|2032113_2032371_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|2032833_2033061_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|2033102_2033468_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958396.1|2033759_2034323_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_162829202.1|2034991_2036205_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_171876988.1|2037357_2039295_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	98.9	0.0e+00
WP_001063025.1|2039339_2039561_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|2042087_2042414_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|2042424_2042775_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|2042771_2043218_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2043214_2043559_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275464.1|2043624_2044341_+	immunoglobulin domain-containing protein	NA	B6DZA6	Enterobacteria_phage	100.0	1.2e-127
WP_000710952.1|2044355_2044730_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2044825_2045035_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|2045082_2048325_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2048317_2048659_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152183.1|2048658_2049357_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	6.6e-134
WP_001302649.1|2049373_2049694_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2049801_2049975_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2050045_2050969_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|2051022_2051760_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_050546863.1|2051705_2052338_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000515107.1|2052597_2056077_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	100.0	0.0e+00
WP_001230314.1|2056143_2056743_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	100.0	1.8e-111
WP_000268993.1|2056807_2058121_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	100.0	2.8e-85
WP_001023452.1|2058122_2058392_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2058532_2059408_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2059632_2060283_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2061606_2062773_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2062891_2063365_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2063563_2064622_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2064793_2065123_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2065223_2065406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2065894_2066008_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2066020_2066215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2066673_2067042_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2067115_2067337_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2067399_2067876_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2067890_2068370_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2068451_2069273_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2069493_2069904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2069919_2070603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2070738_2071809_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2071805_2072711_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000638172.1|2072707_2073589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829204.1|2073572_2074786_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000966626.1|2075157_2077305_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2078752_2080291_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2080340_2080688_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2080684_2081065_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|2081426_2081972_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2081968_2082712_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2082723_2083803_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2083864_2084800_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2085256_2086174_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2086275_2087226_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|2087343_2088987_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2089612_2090329_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2090671_2092126_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2092227_2093544_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2093857_2094910_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014714124.1|2095171_2103154_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2103643_2104441_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2104676_2105699_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2105698_2105902_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2105960_2108432_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
2106046:2106060	attR	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_000199485.1|2108527_2108716_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2108712_2108901_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2109381_2109534_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2109808_2110453_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2110550_2110778_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2110774_2111200_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2111268_2112306_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2112217_2112760_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2112794_2113493_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2113514_2113739_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2113735_2114092_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2114124_2114277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2114273_2114585_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2114711_2115275_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2115384_2115489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2115675_2115888_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2116055_2116334_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2116335_2117385_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2117397_2117757_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2117753_2118443_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000023257.1|2119982_2121833_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2121914_2123128_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2123438_2123654_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2123658_2124003_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2124053_2124587_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2124742_2124925_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2124937_2125069_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2125296_2125482_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2126008_2126323_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2126404_2126629_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2127023_2127533_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2129417_2129624_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2129620_2131213_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2131202_2132708_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2132744_2133092_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2133149_2133416_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2133397_2134138_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2134151_2134583_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2134609_2135023_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_128484525.1|2135003_2137583_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000847298.1|2137579_2137909_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_171876989.1|2137908_2138607_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.3e-129
WP_000194760.1|2138617_2139361_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_050546863.1|2139306_2139939_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649827.1|2140129_2140657_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_000515109.1|2140790_2144264_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_001230444.1|2144331_2144931_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000268855.1|2144995_2146309_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001023407.1|2146310_2146580_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001301613.1|2148572_2149691_+	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_000107391.1|2149687_2151481_+	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001186424.1|2151499_2152207_+	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000003653.1|2152203_2152791_+|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
>prophage 6
NZ_CP038290	Escherichia coli O157:H7 strain TX 265-1 chromosome, complete genome	5590682	2403774	2524325	5590682	transposase,capsid,lysis,portal,tRNA,integrase,terminase,head,protease,tail,holin	Enterobacteria_phage(38.32%)	151	2469686:2469701	2497940:2497955
WP_000952736.1|2403774_2404596_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000759316.1|2404751_2405798_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|2405794_2406589_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074985.1|2406755_2407874_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000003742.1|2407842_2408112_-	excisionase	NA	NA	NA	NA	NA
WP_077699040.1|2408173_2408563_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000559928.1|2408695_2409211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|2409325_2409478_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000948454.1|2409793_2410270_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_000711018.1|2410394_2410718_+	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000693962.1|2410701_2411127_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262323.1|2411195_2412233_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_072143019.1|2412144_2412687_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000451012.1|2412720_2413437_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072140318.1|2413469_2413751_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_001310212.1|2413747_2414050_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_001017965.1|2414039_2414357_+	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_000156547.1|2414310_2414628_+	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_000515959.1|2414614_2415052_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_001014296.1|2415053_2415245_+	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000207955.1|2415247_2415835_+	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001278450.1|2415950_2416055_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2416243_2416456_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001341388.1|2416623_2416902_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265159.1|2416903_2417953_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001217410.1|2417965_2418340_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762929.1|2418336_2419158_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_000216629.1|2419754_2419922_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023147.1|2420236_2422174_+	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	76.6	4.8e-291
WP_001213059.1|2422321_2422504_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|2422541_2422811_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|2422886_2423102_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731241.1|2423106_2423451_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992148.1|2423501_2424035_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_001056806.1|2424305_2424875_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2424874_2425021_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|2425248_2425455_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|2425519_2425744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|2426100_2426241_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|2426370_2426556_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000279796.1|2426597_2426963_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958387.1|2427255_2427819_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2427815_2429477_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|2429540_2431478_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2431522_2431744_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2431689_2434191_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2434270_2434597_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2434606_2434957_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2434953_2435400_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2435396_2435741_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2435799_2436516_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2436530_2436905_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2437000_2437210_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|2437257_2440500_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2440492_2440834_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152182.1|2440833_2441532_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|2441548_2441803_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|2441912_2442023_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|2442325_2443204_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|2443257_2443995_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|2443940_2444177_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|2444189_2444279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2444298_2446647_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|2447237_2450639_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001303921.1|2452947_2453223_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|2453283_2454645_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|2455008_2455872_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2455855_2456992_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2457241_2458468_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|2458516_2459638_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_162829200.1|2459999_2461213_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_032174463.1|2461211_2462429_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.8	6.1e-127
WP_000953272.1|2462793_2462982_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000226782.1|2463786_2463984_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|2463976_2464189_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|2464178_2464643_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|2464635_2464869_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|2464874_2465174_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833626.1|2465170_2466571_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.3	3.6e-115
WP_000192401.1|2466771_2467023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|2467019_2467430_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|2467440_2467713_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|2467839_2468064_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|2468315_2468522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|2468521_2469577_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|2469589_2469925_+|head	head decoration protein	head	NA	NA	NA	NA
2469686:2469701	attL	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000224603.1|2469937_2470351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|2470556_2471099_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|2471354_2471636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|2472236_2473697_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|2473696_2474368_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2474536_2475907_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|2475910_2476552_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|2476587_2477694_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2477747_2478209_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|2478218_2478872_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|2479043_2480294_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|2480407_2481550_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088657.1|2481539_2481776_-	excisionase	NA	NA	NA	NA	NA
WP_000788869.1|2482700_2483402_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|2483398_2483701_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|2483768_2484101_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|2484165_2484288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|2484345_2485872_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|2486373_2486829_+	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|2486828_2486999_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|2486991_2487282_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|2487278_2487641_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|2487637_2487778_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|2487774_2488464_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|2488785_2489091_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|2489077_2489554_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|2489770_2489953_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|2490043_2490337_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|2490628_2491039_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|2491324_2491531_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|2491695_2491890_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|2492278_2492824_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|2492798_2494724_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|2494720_2494927_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2494923_2496525_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2496505_2497825_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2497834_2498167_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
2497940:2497955	attR	ACCCCGCTGATGCTGG	NA	NA	NA	NA
WP_000063233.1|2498221_2499247_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_000158906.1|2499288_2499687_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|2499698_2500052_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|2500063_2500642_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|2500638_2501034_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|2501041_2501782_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000479161.1|2501797_2502220_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_000459457.1|2502201_2502636_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|2502628_2505178_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|2505174_2505504_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|2505503_2506202_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|2506207_2506951_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|2506887_2507520_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|2507580_2510979_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|2511045_2511645_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|2511709_2514625_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|2514624_2515206_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|2515325_2516216_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|2516234_2516741_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|2516777_2517278_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|2517356_2517539_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|2518036_2518705_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|2518761_2519010_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|2519085_2519466_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2519462_2519810_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2519859_2521398_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|2521700_2523185_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|2523371_2524325_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
>prophage 7
NZ_CP038290	Escherichia coli O157:H7 strain TX 265-1 chromosome, complete genome	5590682	2608909	2790093	5590682	transposase,capsid,portal,integrase,terminase,head,plate,protease,tail,holin	Escherichia_phage(24.57%)	229	2608746:2608773	2801267:2801294
2608746:2608773	attL	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
WP_000113674.1|2608909_2610040_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2610017_2610266_-	excisionase	NA	NA	NA	NA	NA
WP_000048549.1|2610330_2612802_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_001090200.1|2612894_2613086_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2613082_2613271_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|2613668_2613836_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2613829_2614063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2614040_2614448_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|2614470_2614689_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2614761_2615061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2615324_2615732_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2615808_2616036_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|2616019_2616571_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2616542_2617583_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|2617494_2618037_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|2618223_2618805_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_001505071.1|2618801_2618966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2619664_2620423_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|2620701_2620914_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|2621134_2621392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2621461_2621740_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|2621741_2622788_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|2622800_2623160_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|2623168_2623699_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2623940_2624138_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|2624288_2625347_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000143067.1|2626143_2627997_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|2628146_2628362_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731259.1|2628366_2628711_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2628761_2629295_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2629565_2630135_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2630134_2630281_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2630508_2630694_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2631118_2631346_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|2631387_2631753_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_001303051.1|2632042_2632606_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_001413036.1|2632602_2634264_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.6	0.0e+00
WP_000172999.1|2634327_2636265_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2636309_2636531_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2636476_2638978_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2639057_2639384_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2639393_2639744_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2639740_2640187_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2640183_2640528_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2640586_2641303_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2641308_2641683_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2641778_2641988_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2642040_2645283_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2645275_2645617_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179515.1|2645616_2646315_+|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	100.0	6.6e-134
WP_046671488.1|2646325_2647069_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_050439450.1|2647014_2647647_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|2647989_2649165_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_129137390.1|2649116_2651462_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001228304.1|2651529_2652129_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_024748516.1|2652280_2653594_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	7.2e-81
WP_001023474.1|2653595_2653865_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|2654891_2656217_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_171876994.1|2658881_2660420_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	4.5e-300
WP_000612591.1|2660469_2660817_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2660813_2661194_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2661533_2661812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2662239_2662386_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2662522_2663170_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2663353_2663944_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|2665450_2666101_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_000113671.1|2667400_2668531_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	1.7e-102
WP_000113189.1|2668508_2668757_-	excisionase	NA	NA	NA	NA	NA
WP_000102168.1|2668821_2671266_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.3	8.4e-176
WP_000092782.1|2671358_2671547_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|2671543_2671732_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001302137.1|2672129_2672294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171938.1|2672297_2672516_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379589.1|2672675_2672831_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	8.8e-07
WP_001003379.1|2673020_2673428_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	45.4	7.2e-24
WP_000476986.1|2673505_2673733_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_171876995.1|2673716_2674268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020565.1|2674239_2675280_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	86.2	6.7e-90
WP_157837342.1|2675191_2675734_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	97.4	2.9e-84
WP_000537579.1|2675768_2676527_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	68.8	1.9e-81
WP_000215514.1|2676586_2676772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211435.1|2677119_2677668_+	ORF6N domain-containing protein	NA	A0A2R2Z302	Escherichia_phage	75.4	1.4e-41
WP_000882662.1|2677882_2678095_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	95.7	2.5e-28
WP_000042395.1|2678197_2678515_-	DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001217944.1|2678507_2678879_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001452497.1|2679102_2679330_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024177817.1|2679383_2679653_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	52.5	2.7e-11
WP_001265189.1|2679654_2680704_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	3.4e-110
WP_000904171.1|2680716_2681091_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	4.2e-34
WP_000762902.1|2681087_2681909_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.9	2.8e-83
WP_000917733.1|2682135_2682333_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	6.8e-28
WP_000483509.1|2682484_2683543_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	98.6	2.6e-206
WP_136858096.1|2684137_2686084_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	97.4	0.0e+00
WP_000143462.1|2686219_2686399_+	DUF1378 family protein	NA	A0A0P0ZCJ7	Stx2-converting_phage	100.0	3.7e-25
WP_001290212.1|2686439_2686712_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000284506.1|2686788_2687004_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001015158.1|2687007_2687565_+	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	80.9	1.5e-48
WP_001092902.1|2687601_2688135_+	lysozyme	NA	G9L6J6	Escherichia_phage	96.6	2.1e-100
WP_012816791.1|2688653_2688839_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000373407.1|2689313_2689790_+	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_001077608.1|2689786_2691910_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|2691906_2692119_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974567.1|2692118_2693621_+|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	99.8	1.2e-289
WP_001365078.1|2693610_2695590_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	98.9	0.0e+00
WP_001097065.1|2695677_2696004_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|2695996_2696278_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|2696280_2696904_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|2696916_2697315_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|2697322_2698075_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479059.1|2698088_2698511_+|tail	phage minor tail protein G	tail	S5MQJ3	Escherichia_phage	97.9	1.3e-71
WP_000532075.1|2698537_2698846_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	99.0	3.0e-54
WP_171876996.1|2698889_2701535_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	93.5	0.0e+00
WP_000847306.1|2701531_2701861_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_117005690.1|2701860_2702559_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.9e-131
WP_122368279.1|2702569_2703313_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	2.3e-148
WP_069905658.1|2703258_2703888_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_171876997.1|2704128_2707605_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	96.1	0.0e+00
WP_001303160.1|2707671_2708271_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.0	4.8e-109
WP_113564072.1|2708335_2709649_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	1.3e-82
WP_001101703.1|2709650_2709920_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	100.0	4.9e-45
WP_032156508.1|2711049_2711634_+	protein kinase	NA	NA	NA	NA	NA
WP_000251936.1|2712011_2712182_+	hypothetical protein	NA	A0A0U2RK60	Escherichia_phage	62.5	9.4e-10
WP_001500821.1|2712657_2713788_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	50.9	4.9e-102
WP_000113189.1|2713765_2714014_-	excisionase	NA	NA	NA	NA	NA
WP_000102181.1|2714078_2716523_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
WP_000092782.1|2716615_2716804_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|2716800_2716989_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000380314.1|2717476_2717629_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000367559.1|2717799_2718189_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024213789.1|2718291_2718567_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000693888.1|2718550_2718976_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095667.1|2718998_2719952_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000790456.1|2719958_2720699_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_000450888.1|2720728_2721499_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
WP_001118161.1|2721514_2721910_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_001302146.1|2721966_2722323_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_000063625.1|2722371_2722584_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000137941.1|2722619_2722991_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000610379.1|2722987_2723350_+	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_001278450.1|2723465_2723570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2723758_2723971_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000998188.1|2724267_2724435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304183.1|2724500_2724779_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000904137.1|2725842_2726217_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762904.1|2726213_2727035_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
WP_000917735.1|2727261_2727459_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483497.1|2727609_2728668_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_024748518.1|2729159_2731010_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_024164617.1|2731448_2731664_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075112.1|2731663_2732161_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_001208680.1|2732377_2732563_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|2733089_2733404_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|2733485_2733710_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303046.1|2733751_2734117_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958387.1|2734405_2734969_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2734965_2736627_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_171876998.1|2736690_2738628_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	99.8	0.0e+00
WP_001063099.1|2738672_2738894_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2738839_2741341_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2741420_2741747_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2741756_2742107_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2742103_2742550_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2742546_2742891_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2742949_2743666_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2743671_2744046_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2744141_2744351_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2744403_2747646_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2747638_2747980_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303038.1|2747979_2748678_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_001303043.1|2748688_2749432_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_129137391.1|2749377_2750010_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_000528251.1|2751189_2751927_-	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_001310452.1|2751880_2752081_-	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_115801860.1|2752195_2752660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001114104.1|2752698_2752944_-	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000144787.1|2752979_2753162_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_010917876.1|2753308_2755348_-	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000904930.1|2755447_2756008_-	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917875.1|2756229_2756433_+|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000420351.1|2756512_2757034_+|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_000469162.1|2757068_2757980_-|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000301577.1|2757979_2758540_-	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_001146835.1|2758530_2759613_-|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000763330.1|2759612_2760050_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_000980532.1|2760042_2760657_-|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000098807.1|2760646_2761771_-|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000146116.1|2761754_2763104_-	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000113525.1|2763090_2765166_-	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_000213225.1|2765292_2765769_-|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000015473.1|2765783_2766149_-|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000606747.1|2766157_2767660_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000848437.1|2767656_2767902_-	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000627431.1|2767902_2768463_-	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_001104956.1|2768459_2768879_-	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_001002054.1|2768875_2769280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001142982.1|2769323_2770271_-|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_171876999.1|2770270_2771395_-|protease	protease	protease	A0A0C4UQU6	Shigella_phage	48.1	9.8e-79
WP_000094808.1|2771571_2772045_-	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	54.6	2.7e-38
WP_000046901.1|2772166_2773498_-|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	58.8	3.9e-151
WP_000532592.1|2773481_2775071_-	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	1.4e-168
WP_001057665.1|2775070_2776735_-	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	8.1e-231
WP_000360581.1|2776734_2777316_-	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001279082.1|2777318_2777609_-	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	4.7e-25
WP_000270159.1|2777605_2777914_-	DUF2730 family protein	NA	NA	NA	NA	NA
WP_000342747.1|2777894_2778122_-	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_001122256.1|2778131_2778350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801859.1|2778333_2778762_-	endopeptidase	NA	NA	NA	NA	NA
WP_001125304.1|2778796_2779297_-	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_000852377.1|2779368_2779794_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_001214366.1|2779863_2780373_-	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	41.9	1.1e-26
WP_000378480.1|2780369_2780666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001086886.1|2780655_2780853_-	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_001310453.1|2780845_2781178_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310341.1|2781193_2781544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000633440.1|2781558_2781870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973023.1|2781866_2782418_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000465562.1|2782421_2782937_-	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_171877000.1|2782936_2783470_-	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	66.1	3.8e-65
WP_000323221.1|2783473_2784016_-	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	2.9e-28
WP_001129553.1|2784113_2784644_-	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000049306.1|2784655_2784949_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049432.1|2784953_2785226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|2785222_2785504_-	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_001057199.1|2785505_2785760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000257930.1|2785772_2785994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000129790.1|2785996_2786929_-	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000289295.1|2787000_2789091_-|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	47.4	6.8e-166
WP_001310454.1|2789092_2789341_-	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_001056416.1|2789508_2790093_+	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	39.8	4.2e-17
2801267:2801294	attR	CAGTGTGGTACATGGATATCGATACCAC	NA	NA	NA	NA
>prophage 8
NZ_CP038290	Escherichia coli O157:H7 strain TX 265-1 chromosome, complete genome	5590682	3086107	3177762	5590682	transposase,capsid,portal,terminase,head,tail,holin	Enterobacteria_phage(31.07%)	112	NA	NA
WP_000214712.1|3086107_3086311_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|3086346_3087807_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|3087895_3089179_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001120551.1|3089310_3089553_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|3089714_3090356_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|3090437_3091067_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|3091139_3091715_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|3091828_3092098_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_046671432.1|3092099_3093413_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.6	3.8e-82
WP_001230509.1|3093477_3094077_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_000514788.1|3094144_3097624_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_129137391.1|3097870_3098503_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_001303043.1|3098448_3099192_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_001303044.1|3099202_3099901_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|3099900_3100230_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000533440.1|3102819_3103233_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|3103259_3103682_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|3103695_3104448_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|3104455_3104851_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|3104847_3105381_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|3105395_3105749_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|3105760_3106159_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3106200_3107226_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3107281_3107614_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3107623_3108943_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3108923_3110525_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3110521_3110728_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|3110724_3112650_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|3112624_3113170_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|3113556_3113781_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|3113862_3114177_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3114701_3114887_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|3115109_3115256_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_171877003.1|3115255_3115825_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	99.5	9.0e-105
WP_000992137.1|3116095_3116629_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3116679_3117024_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024180155.1|3117028_3117244_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023184.1|3117683_3119534_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|3120011_3120443_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|3120893_3121607_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|3121742_3121940_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|3122164_3122719_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|3122781_3123087_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|3123099_3124149_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|3124150_3124423_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|3124544_3124889_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|3125008_3125221_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|3125454_3126012_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|3126013_3126232_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|3126359_3126671_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|3126663_3126891_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|3126887_3127169_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|3127201_3127918_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|3127951_3128413_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|3128405_3129449_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|3129517_3129943_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|3129926_3130169_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|3130560_3130899_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|3131191_3131344_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|3131355_3131994_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|3131994_3132204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|3132768_3132957_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|3132953_3133142_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|3133234_3134479_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|3135189_3135432_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|3136394_3136775_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3136771_3137119_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3137168_3138707_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|3139289_3139940_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001131642.1|3140649_3141225_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|3141338_3141608_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|3141609_3142833_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230509.1|3142897_3143497_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_171877004.1|3143564_3147041_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.5	0.0e+00
WP_162829348.1|3147206_3148419_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_024748472.1|3148541_3148979_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	100.0	5.0e-63
WP_000807954.1|3148978_3149320_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064261924.1|3149312_3152555_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|3152607_3152817_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3152912_3153287_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3153292_3154009_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|3154067_3154412_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3154408_3154855_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3154851_3155202_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3155211_3155538_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3155617_3158119_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3158064_3158286_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3158330_3160268_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001303049.1|3160331_3161993_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_001303051.1|3161989_3162553_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_015994246.1|3162842_3163208_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|3163249_3163477_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3163901_3164087_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3164314_3164461_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3164460_3165030_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3165300_3165834_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3165884_3166229_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024180155.1|3166233_3166449_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_024748470.1|3166888_3168739_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_001303509.1|3169217_3169646_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_001059381.1|3170282_3170972_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001217455.1|3170968_3171328_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001265161.1|3171340_3172390_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_012779366.1|3172391_3172670_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3172837_3173050_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3173238_3173343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000206793.1|3173458_3174043_-	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001118159.1|3174099_3174495_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000788936.1|3175305_3176046_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_000095670.1|3176052_3177015_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
WP_000693943.1|3177037_3177463_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000172738.1|3177459_3177762_-	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
>prophage 9
NZ_CP038290	Escherichia coli O157:H7 strain TX 265-1 chromosome, complete genome	5590682	3491330	3542989	5590682	tail,transposase,tRNA,integrase	Enterobacteria_phage(60.0%)	59	3484554:3484569	3543844:3543859
3484554:3484569	attL	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
WP_001025318.1|3491330_3493064_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.7	4.0e-87
WP_001302043.1|3493240_3493729_+	lysozyme inhibitor LprI family protein	NA	NA	NA	NA	NA
WP_001259575.1|3493848_3494241_-	flagellar protein FlhE	NA	NA	NA	NA	NA
WP_000067016.1|3494240_3496319_-	flagellar biosynthesis protein FlhA	NA	NA	NA	NA	NA
WP_001278932.1|3496311_3497460_-	flagellar type III secretion system protein FlhB	NA	NA	NA	NA	NA
WP_000983602.1|3497661_3498306_-	protein phosphatase CheZ	NA	NA	NA	NA	NA
WP_000763867.1|3498316_3498706_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036370.1|3498720_3499770_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204340.1|3499772_3500633_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_000483251.1|3500651_3502253_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.8	5.4e-14
WP_001302081.1|3502298_3503960_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.4	5.8e-11
WP_000147302.1|3504102_3504606_-	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_001322280.1|3504626_3506591_-	chemotaxis protein CheA	NA	NA	NA	NA	NA
WP_000795630.1|3506595_3507522_-	flagellar motor protein MotB	NA	NA	NA	NA	NA
WP_000906325.1|3507518_3508406_-	flagellar motor stator protein MotA	NA	NA	NA	NA	NA
WP_001291603.1|3508532_3509111_-	flagellar transcriptional regulator FlhC	NA	NA	NA	NA	NA
WP_001302091.1|3509113_3509464_-	flagellar transcriptional regulator FlhD	NA	NA	NA	NA	NA
WP_000122432.1|3510243_3510672_+	universal stress protein UspC	NA	NA	NA	NA	NA
WP_001295646.1|3510678_3512103_-	alpha,alpha-trehalose-phosphate synthase	NA	NA	NA	NA	NA
WP_001302045.1|3512077_3512878_-	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_001302082.1|3513044_3514031_-	arabinose ABC transporter permease AraH	NA	NA	NA	NA	NA
WP_001187819.1|3514045_3515560_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A2H4PQG7	Staphylococcus_phage	27.1	4.3e-13
WP_000548680.1|3515629_3516619_-	arabinose ABC transporter substrate-binding protein AraF	NA	NA	NA	NA	NA
WP_000179469.1|3517415_3517919_+	non-heme ferritin-like protein	NA	NA	NA	NA	NA
WP_000084172.1|3517998_3518250_-	DUF2766 domain-containing protein	NA	NA	NA	NA	NA
WP_010723106.1|3518364_3518451_-	stress response protein AzuC	NA	NA	NA	NA	NA
WP_001237873.1|3518712_3519036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917208.1|3519206_3519704_+	non-heme ferritin	NA	NA	NA	NA	NA
WP_000377224.1|3519740_3519980_-	YecH family protein	NA	NA	NA	NA	NA
WP_000797566.1|3520171_3521383_+	tyrosine transporter TyrP	NA	NA	NA	NA	NA
WP_000847882.1|3521444_3522110_-	UPF0149 family protein YecA	NA	NA	NA	NA	NA
WP_001303019.1|3522466_3523468_-|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
WP_000865208.1|3523473_3523821_-	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_000290345.1|3523850_3524501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|3524516_3524921_-	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_001673482.1|3525010_3525148_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014504.1|3525219_3525423_+	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_000739029.1|3525444_3525795_+	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000159449.1|3525805_3526084_+	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000514287.1|3526095_3526338_+	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000021655.1|3526334_3526448_+	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000991913.1|3526540_3526957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985157.1|3526980_3527184_+	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000153707.1|3527180_3527447_+	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000104305.1|3527443_3527743_+	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_171877006.1|3527754_3528372_+	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000599379.1|3528368_3528734_+	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_000123463.1|3528740_3531563_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000686523.1|3531639_3532599_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000211280.1|3532603_3532918_+	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_001310336.1|3534009_3534540_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000954203.1|3534583_3535156_-	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_000979955.1|3535312_3535801_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000333495.1|3538603_3538759_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000665314.1|3538767_3539133_-|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000290456.1|3539187_3539700_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000005444.1|3539699_3540884_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000132765.1|3541041_3541365_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_162829202.1|3541776_3542989_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
3543844:3543859	attR	TCAGCCAGAAGCGCAG	NA	NA	NA	NA
>prophage 10
NZ_CP038290	Escherichia coli O157:H7 strain TX 265-1 chromosome, complete genome	5590682	3601349	3649729	5590682	transposase,capsid,portal,integrase,head,protease,tail,holin	Enterobacteria_phage(29.27%)	56	3591324:3591340	3651538:3651554
3591324:3591340	attL	TTCCGGTCTGATGACCA	NA	NA	NA	NA
WP_001023396.1|3601349_3601619_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_171877007.1|3601620_3602790_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001230509.1|3602854_3603454_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_140406277.1|3607236_3607869_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	99.0	4.9e-104
WP_000194760.1|3607814_3608558_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_171876989.1|3608568_3609267_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.3e-129
WP_000847298.1|3609266_3609596_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_128484525.1|3609592_3612172_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000533402.1|3612152_3612566_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3612592_3613024_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3613037_3613778_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3613759_3614026_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3614083_3614431_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3614467_3615973_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3615962_3617555_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3617551_3617758_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3619934_3621473_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3621522_3621870_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3621866_3622247_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3622322_3622598_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3623348_3623555_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3623810_3624083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3624242_3624776_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3624996_3625110_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3625331_3625517_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3626044_3626359_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3626563_3627777_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|3627952_3629803_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3630569_3631283_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3631903_3632722_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3632873_3633245_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3633234_3633606_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3633618_3634668_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3634669_3634948_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3635115_3635271_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3635372_3635510_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3635875_3636649_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3637000_3637414_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3637429_3638200_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3638221_3638968_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3638974_3640066_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3640144_3640600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3640806_3641232_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3641215_3641488_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3641596_3641998_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3642025_3642217_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3642216_3642504_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3642781_3642937_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3643078_3643468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3643654_3643840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3644413_3644602_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3644598_3644790_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3644883_3647355_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3647422_3647665_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3647642_3648662_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3649069_3649729_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3651538:3651554	attR	TTCCGGTCTGATGACCA	NA	NA	NA	NA
>prophage 11
NZ_CP038290	Escherichia coli O157:H7 strain TX 265-1 chromosome, complete genome	5590682	3880657	3920065	5590682	transposase,lysis,portal,integrase,protease,tail,holin	Enterobacteria_phage(52.5%)	47	3880242:3880256	3920139:3920153
3880242:3880256	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3880657_3881356_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3881586_3882468_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3882636_3882798_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3883294_3884314_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3884347_3885328_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3885504_3885774_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_162829200.1|3886221_3887434_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001233141.1|3888464_3889064_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000090841.1|3892608_3893217_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3893153_3893897_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3893902_3894601_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3894610_3894940_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3894939_3898005_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3897976_3898306_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3898314_3898701_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3898761_3899505_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3899515_3899917_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3899913_3900492_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3900503_3900779_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3900771_3901095_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136598.1|3901181_3903209_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_127446149.1|3903153_3903489_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3903610_3904735_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3904662_3904875_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001139679.1|3908138_3908291_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3908278_3908746_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3908742_3909240_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3909239_3909455_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3909597_3909996_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3910076_3910235_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3910320_3911064_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3911247_3911937_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3911951_3912074_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3912411_3913371_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028857.1|3913582_3914248_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_001108055.1|3914244_3914865_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3914857_3915028_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3915024_3915207_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3915904_3916585_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3916581_3916764_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3916736_3916928_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3916938_3917220_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3917318_3917540_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3917750_3918353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3918595_3918763_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3918802_3919021_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3919294_3920065_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3920139:3920153	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 12
NZ_CP038290	Escherichia coli O157:H7 strain TX 265-1 chromosome, complete genome	5590682	4464542	4543784	5590682	transposase,capsid,lysis,portal,integrase,terminase,head,plate,protease,tail,holin	Shigella_phage(45.0%)	96	4501660:4501706	4539882:4539928
WP_000998048.1|4464542_4466081_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4466130_4466478_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4466474_4466855_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4467118_4467382_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4467381_4467522_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4467591_4467783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4468607_4469150_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4469224_4469812_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4469869_4470538_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4470563_4473089_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_171877011.1|4473078_4474722_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4474690_4475401_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4475713_4476043_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4476290_4476905_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4477322_4478012_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4478008_4478965_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4478961_4481160_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4481169_4482126_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4482304_4483432_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4483573_4484632_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4484877_4485780_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4486482_4486761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4486927_4487650_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4487748_4488648_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4489323_4490280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4490412_4492746_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4492759_4493083_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4493082_4493304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4493300_4493858_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4493854_4494115_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4495048_4495801_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4495797_4496349_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4496354_4496627_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4497036_4497603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4497602_4498193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4498223_4498856_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4498848_4499307_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4499306_4499924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4499896_4500313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4500316_4501498_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
4501660:4501706	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000246059.1|4502460_4503204_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355484.1|4504028_4504802_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000905124.1|4504862_4505417_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_001145350.1|4505447_4505858_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	97.6	6.5e-65
WP_001008234.1|4505878_4506322_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_000368084.1|4506293_4506896_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_000554706.1|4506895_4507666_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000383550.1|4507669_4508254_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000785302.1|4508244_4509303_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000424732.1|4509289_4509715_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259066.1|4509714_4510263_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000999513.1|4510262_4511342_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_000219910.1|4511338_4512667_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000807197.1|4512727_4514563_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000661054.1|4514704_4514974_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090993.1|4514973_4515330_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_000155728.1|4515329_4516826_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000497751.1|4516809_4516980_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779288.1|4516988_4517549_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000224836.1|4517545_4518052_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702395.1|4518026_4518437_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000924828.1|4518433_4518757_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000766100.1|4518835_4520065_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000999805.1|4520075_4520678_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000923141.1|4520670_4521897_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000838374.1|4521886_4522048_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128484532.1|4522044_4523541_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000929189.1|4523774_4524269_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	1.9e-87
WP_001135207.1|4524394_4524745_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	98.3	2.1e-64
WP_000738423.1|4525270_4525564_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4525654_4525837_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001197766.1|4526053_4526530_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120501.1|4526533_4526869_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001449601.1|4527005_4527299_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001310393.1|4527577_4527811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484663.1|4527954_4528494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001008431.1|4528707_4529460_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_001360050.1|4529473_4530463_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061444.1|4530470_4531280_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|4531299_4531689_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210141.1|4531685_4532012_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_001303054.1|4532008_4532662_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_072141203.1|4532661_4533156_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_000104949.1|4533152_4534094_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_001250269.1|4534083_4534263_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|4534438_4534990_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|4534982_4535243_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|4535340_4536033_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000917896.1|4536310_4536607_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000008235.1|4537283_4537820_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_001242749.1|4537810_4538173_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|4538172_4538478_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|4538704_4539868_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893282.1|4540072_4541326_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4539882:4539928	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4541337_4542441_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4542728_4543784_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 13
NZ_CP038290	Escherichia coli O157:H7 strain TX 265-1 chromosome, complete genome	5590682	4562570	4635814	5590682	tRNA,transposase,plate,protease	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
WP_000027427.1|4562570_4563743_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4563823_4564009_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4563923_4564187_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171877012.1|4564388_4568612_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	2.4e-21
WP_000103335.1|4568687_4570829_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_001142958.1|4571038_4571557_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4572253_4572754_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4572788_4573013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4573063_4574455_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4574545_4574959_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4574962_4576813_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4576776_4577859_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4577883_4579164_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4579160_4579685_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246433.1|4579687_4581019_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343292.1|4581023_4581785_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614377.1|4581793_4584577_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.4	6.2e-82
WP_000088854.1|4584573_4585317_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240517.1|4585321_4586734_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001303798.1|4586870_4590305_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087743.1|4590315_4591725_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001284958.1|4591690_4592170_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000002701.1|4592190_4592412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|4592490_4593087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|4593089_4593539_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001301976.1|4595353_4596085_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_000917883.1|4596149_4596617_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301721.1|4596613_4597336_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|4597369_4598125_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644686.1|4598196_4599555_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211693.1|4599602_4600373_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4600450_4601251_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648586.1|4601491_4602406_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997018.1|4602402_4603206_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_001140187.1|4608965_4609541_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4609728_4610760_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294606.1|4610752_4611406_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874227.1|4611445_4612261_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202328.1|4612378_4612783_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094000.1|4612779_4613487_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260720.1|4613597_4615316_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001302206.1|4615368_4616193_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239181.1|4616392_4617103_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635546.1|4617116_4617527_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185286.1|4617523_4618069_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|4618234_4618435_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|4618421_4618682_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176537.1|4618734_4620030_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|4620094_4620484_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020954.1|4620540_4622682_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|4622780_4623740_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294772.1|4623752_4627235_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000569419.1|4627271_4627868_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_000139661.1|4627864_4629013_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565963.1|4629012_4629801_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4629804_4630260_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139282.1|4630364_4631390_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|4631393_4631879_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|4631999_4634432_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|4634461_4635814_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 14
NZ_CP038290	Escherichia coli O157:H7 strain TX 265-1 chromosome, complete genome	5590682	4975781	4988357	5590682	integrase	Enterobacteria_phage(81.82%)	15	4974815:4974830	4993310:4993325
4974815:4974830	attL	TTTCGATGAACAGCAC	NA	NA	NA	NA
WP_001301682.1|4975781_4976609_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
WP_044815386.1|4976826_4977021_-	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_000783684.1|4977376_4979710_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_000856729.1|4979724_4980045_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459287.1|4980180_4980636_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001244670.1|4980628_4980916_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000980224.1|4980908_4981499_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001149160.1|4981495_4981762_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283021.1|4982313_4983048_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_000638634.1|4983044_4983545_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446132.1|4983618_4984191_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000095622.1|4984516_4985761_+	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_001453880.1|4985798_4986533_-	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000936844.1|4986609_4986915_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000772662.1|4987082_4988357_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
4993310:4993325	attR	TTTCGATGAACAGCAC	NA	NA	NA	NA
>prophage 15
NZ_CP038290	Escherichia coli O157:H7 strain TX 265-1 chromosome, complete genome	5590682	5020777	5079805	5590682	transposase,protease	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|5020777_5022130_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|5022223_5022775_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|5022930_5024304_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|5024479_5025478_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|5025510_5026506_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|5026492_5027515_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|5027528_5029031_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|5029170_5030127_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|5030436_5030967_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|5031046_5031397_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|5031390_5031642_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|5031853_5032195_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|5032197_5035977_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|5035973_5037707_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|5037912_5038551_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|5038873_5040217_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|5040312_5040519_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175296.1|5040843_5041398_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|5041460_5042399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|5042610_5043351_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589488.1|5043540_5045484_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_001302935.1|5045601_5045982_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|5046070_5046931_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|5047038_5048004_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|5048111_5048774_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|5048818_5050231_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|5050539_5051160_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|5051377_5052016_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|5052150_5053359_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|5053366_5053798_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|5054420_5055215_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|5055285_5055735_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|5055776_5056004_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|5056008_5056323_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|5056329_5056725_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|5057051_5057327_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|5057455_5058142_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|5058141_5058996_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|5059005_5059656_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|5059669_5060134_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|5060143_5060449_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|5060464_5061862_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|5063388_5064144_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|5064140_5064890_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|5065071_5065401_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|5065549_5065825_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|5065941_5067567_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|5067650_5068814_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|5068816_5069455_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|5069464_5069863_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|5069880_5070540_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|5070590_5071289_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|5071307_5071709_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|5071835_5072567_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|5072747_5075189_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|5075227_5075653_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|5075857_5077156_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|5077259_5077457_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|5077538_5078543_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|5078545_5079805_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 16
NZ_CP038290	Escherichia coli O157:H7 strain TX 265-1 chromosome, complete genome	5590682	5216685	5231350	5590682	tail,tRNA,integrase	Enterobacteria_phage(43.75%)	19	5212526:5212541	5230055:5230070
5212526:5212541	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5216685_5218101_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5218183_5219167_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5219332_5219575_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5219708_5220746_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5220834_5221932_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5221993_5222242_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5222402_5223044_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5223125_5223755_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5223827_5224400_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5224511_5224781_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5224782_5226096_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5226160_5226760_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5228081_5228618_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5228608_5228959_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5228955_5229240_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5229575_5229773_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5230117_5230399_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5230055:5230070	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5230446_5230620_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5230816_5231350_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP038291	Escherichia coli O157:H7 strain TX 265-1 plasmid pTX265-1, complete sequence	98061	0	72313	98061	transposase,integrase	Stx2-converting_phage(30.0%)	61	8752:8770	65499:65517
WP_001302175.1|2588_3464_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001302177.1|3464_5432_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|5431_6937_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173152.1|6938_8162_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|8192_8627_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_000082929.1|8623_9178_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
8752:8770	attL	TCTGCAGGCGCAGCTGGAT	NA	NA	NA	NA
WP_000173396.1|9192_9540_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082782.1|9536_10136_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000776550.1|10132_11110_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_071525076.1|11148_12321_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|12307_12820_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|12877_13711_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|13802_14204_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000839950.1|16094_16610_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
WP_000217739.1|16611_19608_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|19657_21778_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|21781_23221_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_010891288.1|23964_24195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|24315_25056_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|25340_26318_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|26725_26926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|26922_27543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|27539_28223_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|28681_28900_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|28901_29207_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|29207_30014_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829202.1|30736_31950_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000852148.1|32025_32781_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|33368_34535_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|34534_35506_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|36114_37017_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|37020_37326_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|37402_38086_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
WP_001104869.1|38086_38308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358893.1|38201_38756_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001310284.1|39450_40023_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_010891293.1|40118_40421_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271685.1|40467_40890_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027495.1|40886_41078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303399.1|41196_41586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|42073_42304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199442.1|42355_43717_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001302171.1|43763_44327_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
WP_001451816.1|44412_44862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547965.1|44931_45138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290823.1|45163_45616_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_000005995.1|45672_45906_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117168.1|45971_47930_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000845908.1|47984_48419_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276250.1|48415_49177_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001302184.1|49408_49567_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001453090.1|51789_52221_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581719.1|53979_63489_+	toxin B	NA	NA	NA	NA	NA
WP_001171554.1|64608_64989_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|64985_65333_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|65382_66921_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
65499:65517	attR	TCTGCAGGCGCAGCTGGAT	NA	NA	NA	NA
WP_171877020.1|66924_67314_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-61
WP_000612591.1|67310_67658_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|67707_69246_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000205762.1|70647_71394_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
WP_000704522.1|71452_72313_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
