The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038292	Escherichia coli O157:H7 strain TB21-1 chromosome, complete genome	5498884	1228683	1242120	5498884	holin,tail	Enterobacteria_phage(38.46%)	17	NA	NA
WP_001223948.1|1228683_1229295_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1229291_1229957_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1229953_1230577_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1230829_1231573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1231658_1231826_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143065.1|1232233_1234087_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1234236_1234452_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1234456_1234801_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1235157_1235538_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1235534_1235882_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001023396.1|1236499_1236769_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1236929_1237352_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1237481_1238540_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1238618_1239269_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1239451_1240042_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1240543_1240792_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1241637_1242120_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP038292	Escherichia coli O157:H7 strain TB21-1 chromosome, complete genome	5498884	1521003	1526429	5498884	integrase	Enterobacteria_phage(50.0%)	6	1509991:1510007	1528625:1528641
1509991:1510007	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1521003_1521573_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1521572_1522040_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1522026_1522707_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1522716_1523853_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1524027_1525185_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1525496_1526429_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1528625:1528641	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038292	Escherichia coli O157:H7 strain TB21-1 chromosome, complete genome	5498884	1770710	1871680	5498884	terminase,holin,tRNA,tail,portal,protease	Enterobacteria_phage(51.39%)	109	NA	NA
WP_000569336.1|1770710_1771637_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1771641_1772373_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1772353_1772461_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1772520_1773222_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1773242_1774529_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1774562_1774817_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1774835_1774970_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1774973_1775216_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1775303_1775666_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1775662_1776019_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1776352_1776529_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1776530_1777478_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1777474_1777696_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1777794_1778076_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1778086_1778278_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_032195523.1|1778250_1778433_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	1.6e-28
WP_000186740.1|1778432_1779110_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1779106_1779892_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1779897_1780194_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1780269_1780560_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1781063_1782671_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|1782777_1783470_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182876.1|1783833_1784373_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000147884.1|1784369_1785389_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	9.7e-110
WP_000788906.1|1785385_1786087_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145928.1|1786083_1786368_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_001481254.1|1786595_1786793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|1786836_1787118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141214.1|1787208_1787310_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053021.1|1787306_1787762_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224907.1|1787761_1787932_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1787924_1788215_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|1788211_1788574_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1788570_1788711_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1788796_1789231_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1789479_1789632_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1790435_1792382_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1792519_1792699_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1792739_1792985_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1793062_1793278_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1793282_1793816_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1794086_1794656_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1794655_1794802_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1795029_1795215_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1795732_1796209_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077626.1|1796205_1798329_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|1798325_1798538_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974568.1|1798537_1800040_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_001114421.1|1799984_1802009_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_001097065.1|1802096_1802423_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1802415_1802697_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1802699_1803323_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1803335_1803734_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_024748478.1|1803741_1804494_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	2.9e-135
WP_000479062.1|1804507_1804930_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000532073.1|1804956_1805265_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000847298.1|1807950_1808280_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1808279_1808978_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|1808988_1809732_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_129137391.1|1809677_1810310_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_024748476.1|1810556_1814036_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.7	0.0e+00
WP_001230509.1|1814103_1814703_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_088136427.1|1814767_1815937_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001023396.1|1815938_1816208_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_072142879.1|1816368_1816785_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1816866_1817508_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1817669_1817918_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1818432_1820118_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1820114_1820834_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1820880_1821351_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1821392_1821854_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1821978_1823982_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1823978_1825115_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1825107_1825839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1825857_1827387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1827397_1828486_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1829726_1830044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1830105_1833735_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1840691_1842725_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1842856_1843966_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1844227_1844509_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1844810_1845353_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677409.1|1845440_1846115_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1846130_1848611_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1848621_1849656_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1849737_1850076_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134556.1|1850293_1851151_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1851271_1851544_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1851653_1851968_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1851977_1852325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1853375_1853615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1853948_1854737_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1854733_1855534_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1855598_1856417_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1856468_1857215_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1857188_1858154_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1858150_1859155_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1859151_1860429_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1860685_1861738_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1862036_1862891_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1862919_1864182_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1864191_1864644_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1864674_1864959_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490697.1|1864962_1866318_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1866365_1867406_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1867505_1868285_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1868366_1869266_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1869671_1869989_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|1870318_1871680_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 4
NZ_CP038292	Escherichia coli O157:H7 strain TB21-1 chromosome, complete genome	5498884	1957697	2098067	5498884	terminase,holin,lysis,capsid,integrase,tail,transposase,portal,head,protease	Stx2-converting_phage(44.26%)	159	1954315:1954329	2058263:2058277
1954315:1954329	attL	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_001007946.1|1957697_1958876_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|1958856_1959048_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|1959125_1959470_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|1959657_1960008_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001289930.1|1960874_1961822_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|1961818_1962040_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1962138_1962420_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548528.1|1962430_1962622_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|1962594_1962777_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186848.1|1962773_1963454_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_001302855.1|1963450_1964236_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000995486.1|1964241_1964538_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|1964612_1964756_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1964724_1964889_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|1964961_1965330_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|1965512_1965764_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|1965822_1966095_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|1966072_1966255_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|1966823_1967345_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|1967846_1968542_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1968616_1968832_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|1968973_1969270_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|1969302_1969464_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|1969450_1970272_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|1970268_1971645_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001220560.1|1971723_1972335_+	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_000344569.1|1972798_1973131_+	hypothetical protein	NA	A0A0P0ZCF4	Stx2-converting_phage	100.0	3.3e-59
WP_000103678.1|1973263_1973479_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|1973489_1973726_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|1973682_1974129_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|1974125_1974653_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|1974649_1974832_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208500.1|1975106_1975871_+	phage antirepressor Ant	NA	A0A0P0ZB11	Stx2-converting_phage	100.0	1.4e-121
WP_001004016.1|1975945_1976668_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|1976667_1977273_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|1977269_1977941_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|1977931_1978420_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|1979069_1980029_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|1980040_1980310_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|1980606_1980930_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143115.1|1981173_1983111_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.8	0.0e+00
WP_000143458.1|1983247_1983427_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1983467_1983740_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|1983816_1984032_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|1984031_1984529_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|1984525_1984963_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|1985165_1985663_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1985659_1985917_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|1986379_1986607_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|1986648_1987014_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958396.1|1987305_1987869_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_162829202.1|1988537_1989751_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000173024.1|1990903_1992841_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.7	0.0e+00
WP_001063023.1|1992885_1993107_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125990.1|1995633_1995960_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|1995969_1996320_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|1996316_1996763_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1996759_1997104_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1997162_1997879_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1997884_1998259_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1998354_1998564_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_015994262.1|1998615_2001858_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2001850_2002192_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179515.1|2002191_2002890_+|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	100.0	6.6e-134
WP_001302649.1|2002906_2003227_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2003334_2003508_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2003578_2004502_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|2004555_2005293_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_050546863.1|2005238_2005871_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000515107.1|2006130_2009610_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	100.0	0.0e+00
WP_001230314.1|2009676_2010276_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	100.0	1.8e-111
WP_000268993.1|2010340_2011654_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	100.0	2.8e-85
WP_001023452.1|2011655_2011925_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2012065_2012941_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001303036.1|2015139_2016306_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2016424_2016898_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2017096_2018155_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2018326_2018656_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2018756_2018939_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2019427_2019541_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2019553_2019748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2020206_2020575_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2020648_2020870_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2020932_2021409_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2021423_2021903_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2021984_2022806_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2023026_2023437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2023452_2024136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2024271_2025342_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2025338_2026244_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_023441891.1|2026240_2027038_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000966626.1|2027374_2029522_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2030969_2032508_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2032557_2032905_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2032901_2033282_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|2033643_2034189_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2034185_2034929_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2034940_2036020_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2036081_2037017_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2037473_2038391_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2038492_2039443_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|2039560_2041204_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2041829_2042546_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2042888_2044343_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2044444_2045761_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2046074_2047127_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014714124.1|2047388_2055371_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2055860_2056658_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2056893_2057916_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2057915_2058119_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2058177_2060649_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
2058263:2058277	attR	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_000199485.1|2060744_2060933_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2060929_2061118_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2061598_2061751_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2062025_2062670_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2062767_2062995_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2062991_2063417_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2063485_2064523_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2064434_2064977_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2065011_2065710_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2065731_2065956_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2065952_2066309_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2066341_2066494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2066490_2066802_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2066928_2067492_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2067601_2067706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2067892_2068105_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2068272_2068551_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2068552_2069602_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2069614_2069974_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2069970_2070660_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_171878092.1|2072199_2074050_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.3	0.0e+00
WP_162829202.1|2074131_2075345_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2075655_2075871_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2075875_2076220_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2076270_2076804_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2076959_2077142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2077154_2077286_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2077513_2077699_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2078225_2078540_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2078621_2078846_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2079240_2079750_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2081634_2081841_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2081837_2083430_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2083419_2084925_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2084961_2085309_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2085366_2085633_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2085614_2086355_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2086368_2086800_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2086826_2087240_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_088136971.1|2087220_2089800_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.3	0.0e+00
WP_000847298.1|2089796_2090126_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2090125_2090824_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|2090834_2091578_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_122997399.1|2091523_2092156_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.7	3.5e-102
WP_171878093.1|2092415_2095895_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.8	0.0e+00
WP_001230509.1|2095962_2096562_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_000268854.1|2096626_2097796_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	96.9	1.1e-83
WP_001023396.1|2097797_2098067_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
>prophage 5
NZ_CP038292	Escherichia coli O157:H7 strain TB21-1 chromosome, complete genome	5498884	2155589	2175575	5498884	transposase,tail,integrase	Enterobacteria_phage(75.0%)	28	2168711:2168724	2178717:2178730
WP_032161583.1|2155589_2156726_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|2156676_2157000_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2157157_2158342_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2158341_2158854_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2158908_2159274_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2159282_2159438_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2162240_2162729_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2162885_2163458_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2163501_2164032_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2165123_2165438_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2165442_2166402_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2166478_2169301_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2168711:2168724	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2169307_2169673_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2169669_2170287_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2170298_2170598_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2170594_2170861_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2170857_2171061_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2171084_2171501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2171593_2171707_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2171703_2171946_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2171957_2172236_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2172246_2172597_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2172618_2172822_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2172893_2173031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2173120_2173525_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2173540_2174191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2174220_2174568_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001303019.1|2174573_2175575_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
2178717:2178730	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 6
NZ_CP038292	Escherichia coli O157:H7 strain TB21-1 chromosome, complete genome	5498884	2451772	2704715	5498884	terminase,holin,lysis,capsid,tRNA,integrase,tail,transposase,portal,head,protease	Enterobacteria_phage(29.94%)	282	2577342:2577401	2701766:2704208
WP_001295400.1|2451772_2453047_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_001302086.1|2453108_2453969_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_000765749.1|2454012_2454618_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100942.1|2454723_2456226_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030347.1|2456836_2457472_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289657.1|2457471_2458167_-	electron transport complex subunit RsxE	NA	NA	NA	NA	NA
WP_000920789.1|2458170_2458791_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_000231928.1|2458794_2459853_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000915707.1|2459853_2462172_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991809.1|2462164_2462743_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133193.1|2462742_2463324_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_001302052.1|2463400_2463841_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217950.1|2463926_2464142_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001296096.1|2464414_2464540_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_001282516.1|2464782_2465823_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000567512.1|2465858_2466860_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459374.1|2466963_2468136_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125634.1|2468145_2469738_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_000179513.1|2469912_2470941_+	mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_000483353.1|2471052_2471820_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_000969092.1|2472048_2472639_+	DNA-binding transcriptional regulator UidR	NA	NA	NA	NA	NA
WP_001075838.1|2474839_2476213_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_001043344.1|2477560_2479069_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170658.1|2479169_2480345_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066619.1|2480543_2482190_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_001099102.1|2482332_2483736_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_171878126.1|2483732_2484662_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000732491.1|2484737_2486039_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	3.2e-17
WP_001092494.1|2486042_2486762_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524868.1|2486890_2487226_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000520804.1|2487222_2487945_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412375.1|2487981_2489364_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769322.1|2489549_2490494_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001302608.1|2491017_2492550_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|2492560_2493949_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000085279.1|2495055_2496285_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	7.1e-131
WP_000953272.1|2496651_2496840_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_153037810.1|2496889_2497216_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000201456.1|2497340_2497520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|2497714_2497912_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920682.1|2497904_2498090_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|2498089_2498281_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000794515.1|2498270_2498513_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770147.1|2498518_2498818_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761790.1|2498814_2500947_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	3.4e-173
WP_000198851.1|2501317_2501569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233312.1|2501988_2502261_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001137341.1|2502548_2503706_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.1e-137
WP_000987369.1|2503760_2504318_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	3.5e-61
WP_171878094.1|2504319_2505531_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.2	5.6e-189
WP_001020674.1|2505527_2505866_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
WP_000134110.1|2505862_2506159_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	64.3	2.6e-31
WP_001145905.1|2506158_2506599_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000174068.1|2506582_2506765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|2506888_2507245_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127889.1|2507228_2508890_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	1.5e-277
WP_001340366.1|2508903_2509185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000276149.1|2510459_2510825_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046661.1|2510811_2511141_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260835.1|2511179_2512001_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2512100_2512184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2512276_2512612_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2513008_2514262_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2514368_2515262_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2515396_2516617_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2516741_2517437_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2517389_2518682_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2518839_2519454_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2519496_2520351_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2520352_2520970_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2520980_2523404_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_171878095.1|2523464_2525891_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2526089_2526395_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2526502_2527213_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2527215_2527776_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2527810_2528152_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2528286_2528613_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2529601_2529853_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2529925_2532397_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2532489_2532681_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2532677_2532866_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2533266_2533431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2533434_2533653_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2533724_2534024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2534376_2534655_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2534656_2534848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2534868_2535240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2535337_2535640_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2535636_2536062_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095670.1|2536084_2537047_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
WP_000788936.1|2537053_2537794_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_001118159.1|2538604_2539000_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2539056_2539641_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2539756_2539861_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2540049_2540262_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2540429_2540708_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2540709_2541759_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2541771_2542131_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2542127_2542817_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2543453_2543882_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_024748470.1|2544360_2546211_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_024180155.1|2546650_2546866_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2546870_2547215_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2547265_2547799_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2548069_2548639_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2548638_2548785_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2549012_2549198_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2549622_2549850_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|2549891_2550257_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_001303051.1|2550545_2551109_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_001303049.1|2551105_2552767_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_000172999.1|2552830_2554768_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2554812_2555034_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2554979_2557481_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2557560_2557887_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2557896_2558247_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2558243_2558690_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2558686_2559031_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_171878096.1|2559089_2559806_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	8.6e-129
WP_001030063.1|2559811_2560186_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2560281_2560491_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2560543_2563786_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2563778_2564120_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303038.1|2564119_2564818_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_046671488.1|2564828_2565572_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_050439450.1|2565517_2566150_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|2566492_2567668_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_153037899.1|2567619_2569965_+	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	99.6	0.0e+00
WP_001228304.1|2570032_2570632_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_171878097.1|2570783_2572091_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	8.7e-79
WP_001023474.1|2572092_2572362_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|2573388_2574714_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
2577342:2577401	attL	GTAAGCGTACAGCGAGGGCCGTATTGACGGGGATGTGTTATTCAGCTGGCAGTGCTATGC	NA	NA	NA	NA
WP_000998048.1|2577378_2578917_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2578966_2579314_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2579310_2579691_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2580030_2580309_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2580736_2580883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2581019_2581667_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2581850_2582441_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|2583947_2584598_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001500821.1|2585897_2587028_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	50.9	4.9e-102
WP_000113189.1|2587005_2587254_-	excisionase	NA	NA	NA	NA	NA
WP_000102181.1|2587318_2589763_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
WP_000092782.1|2589855_2590044_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|2590040_2590229_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000380314.1|2590716_2590869_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000367559.1|2591038_2591428_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024213789.1|2591530_2591806_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000693888.1|2591789_2592215_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095667.1|2592237_2593191_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000790456.1|2593197_2593938_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_000450888.1|2593967_2594738_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
WP_001118161.1|2594753_2595149_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_001302146.1|2595205_2595562_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_000063625.1|2595610_2595823_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000137941.1|2595858_2596230_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000610379.1|2596226_2596589_+	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_001278450.1|2596704_2596809_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2596997_2597210_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_000998188.1|2597506_2597674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304183.1|2597739_2598018_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000904137.1|2599081_2599456_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762905.1|2599452_2600274_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.5e-84
WP_000917735.1|2600500_2600698_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483497.1|2600848_2601907_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_024748518.1|2602398_2604249_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_024164617.1|2604687_2604903_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075112.1|2604902_2605400_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_001208680.1|2605616_2605802_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|2606329_2606644_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|2606725_2606950_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303046.1|2606991_2607357_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958387.1|2607645_2608209_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2608205_2609867_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|2609930_2611868_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2611912_2612134_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2612079_2614581_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2614660_2614987_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2614996_2615347_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2615343_2615790_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2615786_2616131_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275499.1|2616189_2616906_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	8.0e-127
WP_000710952.1|2616920_2617295_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2617390_2617600_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|2617647_2620890_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2620882_2621224_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152182.1|2621223_2621922_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000170104.1|2621938_2622193_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|2622302_2622413_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|2622715_2623594_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967271.1|2623647_2624385_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_071526731.1|2624330_2624567_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|2624579_2624669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2624688_2627037_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|2627627_2631029_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001303921.1|2633337_2633613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|2633673_2635035_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|2635398_2636262_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2636245_2637382_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2637631_2638858_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|2638906_2640028_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_162829200.1|2640389_2641603_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_032174463.1|2641601_2642819_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.8	6.1e-127
WP_000953272.1|2643183_2643372_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000226782.1|2644176_2644374_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000609225.1|2644366_2644579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|2644568_2645033_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204985.1|2645025_2645259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770178.1|2645264_2645564_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833626.1|2645560_2646961_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.3	3.6e-115
WP_000192401.1|2647161_2647413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126695.1|2647409_2647820_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233304.1|2647830_2648103_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132079.1|2648229_2648454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000796968.1|2648705_2648912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000907465.1|2648911_2649967_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
WP_000380883.1|2649979_2650315_+|head	head decoration protein	head	NA	NA	NA	NA
WP_000224603.1|2650327_2650741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|2650946_2651489_+|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000133424.1|2651744_2652026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|2652626_2654087_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|2654086_2654758_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2654926_2656297_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|2656300_2656942_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|2656977_2658084_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2658137_2658599_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|2658608_2659262_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|2659433_2660684_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|2660797_2661940_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088657.1|2661929_2662166_-	excisionase	NA	NA	NA	NA	NA
WP_000788869.1|2663090_2663792_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000145915.1|2663788_2664091_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|2664158_2664491_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|2664555_2664678_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|2664735_2666262_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|2666763_2667219_+	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|2667218_2667389_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|2667381_2667672_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|2667668_2668031_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|2668027_2668168_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|2668164_2668854_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000544528.1|2669175_2669481_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|2669467_2669944_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|2670160_2670343_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|2670433_2670727_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|2671018_2671429_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|2671714_2671921_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|2672085_2672280_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|2672668_2673214_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001027365.1|2673188_2675114_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|2675110_2675317_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2675313_2676915_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2676895_2678215_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2678224_2678557_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063233.1|2678611_2679637_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_000158906.1|2679678_2680077_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000752995.1|2680088_2680442_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000975100.1|2680453_2681032_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000683105.1|2681028_2681424_+|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_001143002.1|2681431_2682172_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_171878098.1|2682187_2682610_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	95.7	2.6e-69
WP_000459457.1|2682591_2683026_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840323.1|2683018_2685568_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000847331.1|2685564_2685894_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_001152612.1|2685893_2686592_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194779.1|2686597_2687341_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_000090920.1|2687277_2687910_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000515612.1|2687970_2691369_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_001230336.1|2691435_2692035_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000279120.1|2692099_2695015_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_000885630.1|2695014_2695596_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000488340.1|2695715_2696606_-	manganese catalase family protein	NA	NA	NA	NA	NA
WP_001079482.1|2696624_2697131_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001166090.1|2697167_2697668_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000134810.1|2697746_2697929_-	general stress protein	NA	NA	NA	NA	NA
WP_000239881.1|2698426_2699095_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937476.1|2699151_2699400_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_001171554.1|2699475_2699856_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2699852_2700200_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2700249_2701788_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001226373.1|2702090_2703575_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201843.1|2703761_2704715_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
2701766:2704208	attR	GCATAGCACTGCCAGCTGAATAACACATCCCCGTCAATACGGCCCTCGCTGTACGCTTACAGTAGCTCTGGGTATGAAGCTGTTTGTAACTCATGTTACAGTAATGGCTATTACTATCTCGAAGGTGCAAAATGTATATTGATTTGATATTTTATAAATTTACTTCGAATCTGGCACGTCAACTTTTGATTAAAGTAATATCAGTTTTCGGCGAAAAAAGGACCGTGTACATGAGACGATTTCATACAAGAATAACAAAAATATGAATATGCTCCCAATGCAATATATGTTTTGCATTGGGAGCAAATAGCGGAATATTTTGAAATTATTGTATTTCTGCTTCAGAATTTCCTGGGCAGTATATATTTTCTATTTTTTGTGGAGTGATCAGGTGATGTACAACTGCTTTATCTACACATAAATTAACTCCGGTGAGAGCTAATGTATGCCCATCACCATTTATTGTTAGTAACGGGCTGGAAAATTTCTCTGCCATCTTACGGGCATTAATCCAGGGCGTTGTTGGGTCGTATTTGTGTGCTACAAACAGTAAACCAGAGGGCAGAACAGTATTTTTCAGGCGAGTTTTGTTCAGGTCGCTATGTATTGGCCATAATTCACAAAAATCAGGTGAATCGGAACGTCCATTGTCAAAGTTAATAGCCGGGAAGGCATTCGCAAGAGCCTCTTTTCGGAATTTTCGCTCTTCTGGTGTTAATTGCTCATCCCCCTGATCTACACAAAGGATTACCCCCGAAGCATCACTTGACTCTTCTGAGGCTATCGGAGCACTGAGCGCAGTTTCAATTTCATTACTGACAATCCCCTGAGAGAACTGGCGTATGGCAGTTGCAAGGGTTGGCCATGATGAACGCCATAGCAGAAGGTCTGTTGTTAATGATATGAGTTCATCTGAAGATATATTTTCTCCCTTACTGTCTAATAAAGGTTTGTGATGTAATTTTGATAATAGCTCATGGAACTGAGTTATTGCCTTATCTCTGTCTGAAGAAAGCGGGCAACTTTTTGTACGCGCACACCAGGATGCAAAGCGATCAAACGTTTCCTGATAACTCTGTGCCTGTTTGAGTTGCCATGTGAAGTTGTCCTCCAGGTCATCGATATCGACGACTCCATCAAGAACGATAGATCTTACGTTGTAGGGAAAACGTTCTGCATATAAGGCTGCAATTTGAGTTCCATACGAATACGCCACGGCTGTCAGTTGTTTATCCCCCAAGGCTTGCCTAATACGATCAATATCGTATACAGCCTCGTTAGAGCCGATATGGCGAATGACTTCGGCTCCGGTATTATGGATACAGGCATTAATTTTATTTAATACTTGTTGCTTTTCGGTTATGTTTTCCTGAGTCTCTGTATCTGATTGCCGGCAGTTTATTGTCGGAGTGGACTGCCCGACGCCTCGAGGATCAAATCCAATAATATCCCATGACTCACGAAGATTTGTGACTGGCCAGTCAAAGTTAATATAAGGATTTATGCCTGGTAACCCGGGACCACCACTTATTATCAGGATACTTCCTTTATGCTTGCTTTTTGCCGGCAATTTTGTCAACGCTAGTTTGACTTGTGATTTTTTTTCATAAGAAGCATCTCCGCCTGTGTCTGTATATTTTAATGGAACAGACAAATAACCACATAGTAAGTCAGGAGACGGTTTTTCCTCACCAAACCAGTGGTTGAATTGACTGGCCATACAGGATTGCCACTGTATCTGCTGGGCAGATACGGTTACTGGTAGAAGTAACGTTAAAACAACTTTGAAATGAGTAATTATTTTTCGCATTGTGTCTCTGAATATCGGAATAAAGATAAAATTTGAATATATTGAGGTCTTGTGTTGCGGTAAGAGATTACACGTTATGACATAGGTTAAATGCTTACAAAATTAGTGGATATTGTCTACTTGTAACTGTAAACAAATTCCCCGGGGTTATACAATACCACCGGGGAGAAAATCTGGTTAACTTCGTTAAAAGGTGTACTTAAGACCAGCAGTAGTGATGAAGTTATAGTTTTCTATGCCTGCACCATTTTTGCTGTAGTCTGAAGTGTTATCATTGTGATCATAAAGTGAAGTATTACCTTTTTTATTCGTAACCCGATTCCATGTGCCTTCAACATAAACTTTTGCGTTAGGTGTTACGTAATAACCTGCATTGACTGAAACAGAATAGTAATTTTGGTCTTTGACTTTACTGCGATAAGTGATTCTTTTTCCTGGGTCATAGTGCTCATCGTTATCAGATGCTTCCACCCAGCCGCTGTATTTAAATGTGCCACCTAGCTCAAAATCTTCATAACGATAACTTCCAGTCAAGCCAATGTAGGGCATTTTAAAACGTTGTTTGTAGCCGATTGCTCTTTCTCCATTCGGAAAGGAGCCGATATCATCTCTGAATCCCTCCTCAGAACTGTA	NA	NA	NA	NA
>prophage 7
NZ_CP038292	Escherichia coli O157:H7 strain TB21-1 chromosome, complete genome	5498884	2789299	2887847	5498884	terminase,holin,capsid,integrase,tail,transposase,portal,head	Escherichia_phage(29.91%)	126	2782025:2782038	2798846:2798859
2782025:2782038	attL	TGGTATGCAGTAAC	NA	NA	NA	NA
WP_000113674.1|2789299_2790430_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2790407_2790656_-	excisionase	NA	NA	NA	NA	NA
WP_000048549.1|2790720_2793192_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_001090200.1|2793284_2793476_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2793472_2793661_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|2794058_2794226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2794219_2794453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2794430_2794838_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|2794860_2795079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2795151_2795451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2795714_2796122_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2796198_2796426_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705621.1|2796409_2796961_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2796932_2797973_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|2797884_2798427_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000774808.1|2798613_2799195_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
2798846:2798859	attR	GTTACTGCATACCA	NA	NA	NA	NA
WP_001505071.1|2799191_2799356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2800054_2800813_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961820.1|2801091_2801304_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001217394.1|2801524_2801782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2801851_2802130_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001302148.1|2802131_2803178_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_000904166.1|2803190_2803550_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_000640048.1|2803558_2804089_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2804330_2804528_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935548.1|2804678_2805737_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_171878100.1|2806533_2808384_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.1	0.0e+00
WP_024180155.1|2808823_2809039_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2809043_2809388_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2809438_2809972_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2810242_2810812_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2810811_2810958_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2811185_2811371_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2811795_2812023_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|2812064_2812430_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_001303051.1|2812719_2813283_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_001303049.1|2813279_2814941_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_000172999.1|2815004_2816942_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2816986_2817208_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2817153_2819655_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2819734_2820061_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2820070_2820421_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2820417_2820864_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2820860_2821205_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_171878096.1|2821263_2821980_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	8.6e-129
WP_001030063.1|2821985_2822360_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2822455_2822665_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2822717_2825960_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2825952_2826294_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_024748472.1|2826293_2826731_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	100.0	5.0e-63
WP_012779365.1|2826916_2830177_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.3	0.0e+00
WP_001304111.1|2830179_2830395_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2830462_2831062_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2831126_2832350_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2832351_2832621_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131642.1|2832734_2833310_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121225.1|2834019_2834670_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2835252_2836791_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2836840_2837188_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2837184_2837565_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001120551.1|2838527_2838770_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2839480_2840725_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2840817_2841006_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2841002_2841191_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2841755_2841965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2841965_2842604_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2842615_2842768_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2843060_2843399_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2843790_2844033_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2844016_2844442_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_136760546.1|2844510_2845548_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	68.7	2.2e-85
WP_000139447.1|2845540_2846002_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2846035_2846752_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2846784_2847066_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2847062_2847290_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2847282_2847594_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2847721_2847940_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2847941_2848499_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2848732_2848945_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2849064_2849409_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2849530_2849803_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2849804_2850854_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2850866_2851172_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2851234_2851789_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2852013_2852211_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2852346_2853060_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2853510_2853942_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_171878101.1|2854419_2856270_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_024180155.1|2856709_2856925_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2856929_2857274_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2857324_2857858_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2858128_2858698_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2858697_2858844_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2859066_2859252_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2859777_2860092_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2860173_2860398_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2860784_2861330_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2861304_2863230_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2863226_2863433_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2863429_2865031_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2865011_2866331_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2866340_2866673_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2866728_2867754_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2867795_2868194_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2868205_2868559_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2868573_2869107_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2869103_2869499_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2869506_2870259_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479062.1|2870272_2870695_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000533440.1|2870721_2871135_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|2871115_2873728_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|2873724_2874054_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_171877044.1|2874053_2874752_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_171878102.1|2874762_2875506_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.0	4.4e-144
WP_129137391.1|2875451_2876084_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_171878103.1|2876330_2879810_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.7	0.0e+00
WP_001230508.1|2879877_2880477_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_024748460.1|2880541_2881855_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
WP_001023407.1|2881856_2882126_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2882239_2882815_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2882887_2883517_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2883598_2884240_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|2884401_2884644_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2884775_2886059_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2886147_2887608_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2887643_2887847_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 8
NZ_CP038292	Escherichia coli O157:H7 strain TB21-1 chromosome, complete genome	5498884	3157792	3224351	5498884	terminase,holin,capsid,tail,integrase,portal,head,protease	Stx2-converting_phage(29.31%)	78	3209918:3209938	3231008:3231028
WP_000422055.1|3157792_3158842_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|3159061_3159820_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|3159816_3160407_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|3160446_3161319_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|3161531_3163115_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|3163142_3163763_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|3163759_3164641_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|3164778_3164823_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|3164914_3166477_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763503.1|3166476_3168072_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983855.1|3168072_3169434_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	7.3e-36
WP_000209521.1|3169445_3170639_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|3170638_3171445_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|3171825_3172005_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|3172090_3172591_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|3172636_3173143_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001023426.1|3179225_3179495_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	1.6e-43
WP_024748463.1|3179496_3180810_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	6.5e-82
WP_001230495.1|3180874_3181474_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	3.7e-109
WP_024748464.1|3181540_3185020_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.1	0.0e+00
WP_050439450.1|3185266_3185899_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_046671488.1|3185844_3186588_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_001303038.1|3186598_3187297_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_000807954.1|3187296_3187638_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064261924.1|3187630_3190873_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|3190925_3191135_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3191230_3191605_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_171878096.1|3191610_3192327_-|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	8.6e-129
WP_000133388.1|3192385_3192730_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3192726_3193173_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3193169_3193520_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3193529_3193856_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3193935_3196437_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3196382_3196604_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3196648_3198586_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3198649_3200311_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|3200307_3200871_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|3201162_3201528_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001302977.1|3201569_3201755_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3201884_3202025_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3202381_3202606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3202670_3202877_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3203104_3203251_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3203250_3203820_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3204090_3204624_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3204674_3205019_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3205023_3205239_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3205314_3205584_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3205621_3205804_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023167.1|3205951_3207889_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3208203_3208371_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_171878108.1|3208967_3209789_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.2	2.4e-82
WP_001217410.1|3209785_3210160_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3209918:3209938	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265159.1|3210172_3211222_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001341388.1|3211223_3211502_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3211669_3211882_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3212070_3212175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3212290_3212878_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3212880_3213072_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3213073_3213511_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3213497_3213815_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3213768_3214086_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3214075_3214378_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3214374_3214656_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3214688_3215405_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3215438_3215981_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3215892_3216930_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693962.1|3216998_3217424_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3217407_3217731_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3217855_3218332_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3218647_3218800_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3218914_3219430_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3219562_3219952_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3220013_3220283_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3220251_3221370_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3221536_3222331_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3222327_3223374_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3223529_3224351_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3231008:3231028	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 9
NZ_CP038292	Escherichia coli O157:H7 strain TB21-1 chromosome, complete genome	5498884	3475328	3530674	5498884	holin,capsid,tail,integrase,transposase,portal,head,protease	Escherichia_phage(27.91%)	62	3477263:3477278	3532439:3532454
WP_000003653.1|3475328_3475916_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3475912_3476620_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3476638_3478432_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3477263:3477278	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3478428_3479547_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023407.1|3481539_3481809_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268855.1|3481810_3483124_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001230444.1|3483188_3483788_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515109.1|3483855_3487329_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_000649827.1|3487462_3487990_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_050546863.1|3488180_3488813_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_088136431.1|3488758_3489502_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	1.2e-149
WP_001302968.1|3489512_3490211_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000847298.1|3490210_3490540_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082473.1|3490536_3493116_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|3493096_3493510_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3493536_3493968_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3493981_3494722_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3494703_3494970_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3495027_3495375_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3495411_3496917_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3496906_3498499_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3498495_3498702_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3500879_3502418_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3502467_3502815_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3502811_3503192_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3503267_3503543_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3504293_3504500_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3504755_3505028_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3505187_3505721_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3505941_3506055_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3506276_3506462_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3506989_3507304_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_171878111.1|3507508_3508722_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|3508897_3510748_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3511514_3512228_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171878112.1|3512848_3513667_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3513818_3514190_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3514179_3514551_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3514563_3515613_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3515614_3515893_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3516060_3516216_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3516317_3516455_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3516820_3517594_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3517945_3518359_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3518374_3519145_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3519166_3519913_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3519919_3521011_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3521089_3521545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3521751_3522177_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3522160_3522433_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3522541_3522943_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3522970_3523162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3523161_3523449_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3523726_3523882_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3524023_3524413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3524599_3524785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3525358_3525547_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3525543_3525735_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3525828_3528300_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3528367_3528610_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3528587_3529607_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3530014_3530674_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3532439:3532454	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 10
NZ_CP038292	Escherichia coli O157:H7 strain TB21-1 chromosome, complete genome	5498884	3543133	3666787	5498884	terminase,holin,lysis,capsid,tRNA,tail,integrase,plate,portal,head,protease	Escherichia_phage(42.86%)	112	3616095:3616112	3658176:3658193
WP_000156526.1|3543133_3544894_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227927.1|3544962_3545481_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000828648.1|3545550_3545718_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759107.1|3545973_3546537_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000445550.1|3546533_3548174_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333170.1|3548178_3549432_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053083.1|3549561_3551469_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
WP_001086511.1|3551480_3553589_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224291.1|3553832_3554942_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_001301917.1|3554938_3555481_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_001295352.1|3555654_3556665_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000919496.1|3557477_3557993_-	fimbrial protein	NA	NA	NA	NA	NA
WP_077626202.1|3558000_3558528_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001165679.1|3558555_3559626_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001303867.1|3562240_3562942_-	molecular chaperone	NA	NA	NA	NA	NA
WP_000750295.1|3563024_3563564_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001263919.1|3563919_3564495_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_001244347.1|3564487_3565447_+	aliphatic sulfonate ABC transporter substrate-binding protein SsuA	NA	NA	NA	NA	NA
WP_000055981.1|3565443_3566589_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_000235210.1|3566600_3567392_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_001090506.1|3567388_3568156_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193803.1|3568198_3570811_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001301736.1|3571076_3572279_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117895.1|3572447_3573848_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.7	4.5e-81
WP_000977914.1|3574450_3575539_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.0	1.1e-98
WP_000462673.1|3575723_3576914_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109453.1|3576964_3577612_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|3577638_3578187_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925977.1|3578367_3580215_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572668.1|3580475_3584936_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001302273.1|3584935_3585640_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288845.1|3585620_3586943_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001301572.1|3586939_3587725_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|3587860_3588640_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436922.1|3588616_3589510_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011613.1|3589663_3590410_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|3590406_3590589_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056545.1|3590640_3591873_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570541.1|3591909_3592896_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|3592892_3594641_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705685.1|3594677_3596942_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3597148_3597433_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3597592_3599266_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3599376_3600060_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000799175.1|3600232_3600997_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000445231.1|3601165_3602449_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057165.1|3602519_3603608_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
WP_000642854.1|3603806_3604499_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001301741.1|3604628_3606389_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_000642546.1|3606794_3607652_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292812.1|3607706_3609989_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000468308.1|3610307_3610526_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882928.1|3610607_3611771_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.7	6.6e-203
WP_000978907.1|3611770_3612250_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069918.1|3612264_3614712_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	91.7	0.0e+00
WP_000785970.1|3614704_3614824_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|3614856_3615132_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|3615188_3615707_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286688.1|3615719_3616910_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	2.8e-225
3616095:3616112	attL	GCGGAAACCGTCACGGCG	NA	NA	NA	NA
WP_000905107.1|3616969_3617563_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	3.9e-103
WP_001127579.1|3617593_3618004_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	95.2	3.2e-64
WP_001008235.1|3618024_3618468_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	98.6	1.2e-80
WP_000639074.1|3618439_3618835_-|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	3.5e-15
WP_000216974.1|3618843_3620037_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	87.2	1.0e-158
WP_001285340.1|3620033_3620645_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_001121474.1|3620637_3621546_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_000127145.1|3621550_3621898_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	98.3	5.5e-57
WP_001093691.1|3621894_3622530_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	1.9e-111
WP_001001773.1|3622596_3623049_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	1.5e-75
WP_000917149.1|3623041_3623509_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.1	5.7e-81
WP_001440152.1|3623471_3623645_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000040640.1|3623616_3624042_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	2.1e-66
WP_000736606.1|3624029_3624455_-	hypothetical protein	NA	M1SV74	Escherichia_phage	95.0	1.2e-56
WP_001144101.1|3624469_3624967_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|3624966_3625248_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|3625251_3625455_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|3625454_3625964_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203428.1|3626063_3626807_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	2.7e-125
WP_001248570.1|3626810_3627884_-|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.4	2.5e-201
WP_001085975.1|3627942_3628797_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	98.6	3.5e-137
WP_000156847.1|3628970_3630743_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_000038152.1|3630742_3631777_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.1	2.1e-200
WP_000997853.1|3632116_3633949_-	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	32.3	6.9e-90
WP_000268620.1|3634065_3636348_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.0	0.0e+00
WP_000027664.1|3636337_3636613_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001153795.1|3636609_3636834_-	TraR/DksA C4-type zinc finger protein	NA	A0A0F7LDG9	Escherichia_phage	98.6	4.2e-34
WP_001277959.1|3636833_3637136_-	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	2.9e-46
WP_000557703.1|3637135_3637360_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217677.1|3637423_3637924_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001005162.1|3637920_3638091_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000022051.1|3638101_3638458_-	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_000072552.1|3638562_3638874_+	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000023391.1|3638967_3639963_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000067977.1|3639994_3640792_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000918514.1|3641001_3642432_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109295.1|3642641_3643790_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|3644104_3644731_+	hydrolase	NA	NA	NA	NA	NA
WP_000534648.1|3644766_3645630_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213047.1|3645631_3646249_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	6.6e-77
WP_000850325.1|3646259_3648704_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	3.9e-221
WP_000886683.1|3648942_3650235_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067749.1|3650325_3651669_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3651679_3652291_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000076999.1|3652445_3656474_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3656608_3657103_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3657647_3658613_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
3658176:3658193	attR	CGCCGTGACGGTTTCCGC	NA	NA	NA	NA
WP_001043606.1|3658735_3660502_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202230.1|3660502_3662224_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	1.1e-20
WP_001241680.1|3662265_3662970_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3663254_3663473_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3664159_3666436_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3666466_3666787_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 11
NZ_CP038292	Escherichia coli O157:H7 strain TB21-1 chromosome, complete genome	5498884	3791479	3829574	5498884	terminase,holin,lysis,tail,integrase,portal,protease	Enterobacteria_phage(51.22%)	48	3791064:3791078	3829648:3829662
3791064:3791078	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3791479_3792178_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3792408_3793290_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3793458_3793620_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3794116_3795136_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3795169_3796150_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3796326_3796596_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3796597_3797914_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3797973_3798573_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000090841.1|3802117_3802726_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3802662_3803406_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3803411_3804110_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3804119_3804449_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3804448_3807514_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3807485_3807815_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3807823_3808210_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3808270_3809014_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3809024_3809426_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3809422_3810001_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3810012_3810288_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3810280_3810604_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136598.1|3810690_3812718_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_127446149.1|3812662_3812998_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3813119_3814244_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3814171_3814384_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3814380_3816483_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001139679.1|3817647_3817800_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3817787_3818255_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3818251_3818749_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3818748_3818964_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3819106_3819505_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3819585_3819744_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3819829_3820573_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3820756_3821446_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3821460_3821583_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3821920_3822880_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028857.1|3823091_3823757_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_001108055.1|3823753_3824374_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3824366_3824537_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3824533_3824716_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3825413_3826094_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3826090_3826273_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3826245_3826437_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3826447_3826729_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3826827_3827049_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3827259_3827862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3828104_3828272_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3828311_3828530_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3828803_3829574_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3829648:3829662	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 12
NZ_CP038292	Escherichia coli O157:H7 strain TB21-1 chromosome, complete genome	5498884	4372739	4454608	5498884	terminase,holin,lysis,capsid,tail,integrase,transposase,plate,portal,head,protease	Shigella_phage(43.33%)	96	4409857:4409903	4450706:4450752
WP_000998048.1|4372739_4374278_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4374327_4374675_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4374671_4375052_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4375315_4375579_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4375578_4375719_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4375788_4375980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4376804_4377347_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4377421_4378009_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4378066_4378735_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4378760_4381286_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4381275_4382919_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4382887_4383598_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4383910_4384240_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4384487_4385102_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4385519_4386209_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4386205_4387162_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4387158_4389357_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4389366_4390323_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4390501_4391629_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4391770_4392829_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4393074_4393977_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4394679_4394958_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4395124_4395847_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4395945_4396845_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4397520_4398477_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4398609_4400943_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4400956_4401280_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4401279_4401501_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4401497_4402055_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4402051_4402312_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4403245_4403998_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4403994_4404546_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4404551_4404824_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4405233_4405800_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4405799_4406390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4406420_4407053_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4407045_4407504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4407503_4408121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4408093_4408510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4408513_4409695_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
4409857:4409903	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000246059.1|4410657_4411401_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355484.1|4412225_4412999_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000905124.1|4413059_4413614_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_001145352.1|4413644_4414163_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.0	1.2e-55
WP_000368084.1|4414162_4414765_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_001008234.1|4414736_4415180_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_032195359.1|4415200_4415596_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.9	4.8e-65
WP_000383550.1|4415866_4416451_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000785302.1|4416441_4417500_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000424732.1|4417486_4417912_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259066.1|4417911_4418460_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000999513.1|4418459_4419539_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_000219910.1|4419535_4420864_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000807197.1|4420924_4422760_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000661054.1|4422901_4423171_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090993.1|4423170_4423527_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_000155728.1|4423526_4425023_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000497751.1|4425006_4425177_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779288.1|4425185_4425746_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000224836.1|4425742_4426249_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702395.1|4426223_4426634_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000924828.1|4426630_4426954_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000766100.1|4427032_4428262_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000999805.1|4428272_4428875_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000923141.1|4428867_4430094_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000838374.1|4430083_4430245_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128484532.1|4430241_4431738_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000929175.1|4431971_4432466_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_162829202.1|4432868_4434081_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000738423.1|4434780_4435074_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4435164_4435347_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001197766.1|4435563_4436040_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120501.1|4436043_4436379_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001449601.1|4436515_4436809_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001310393.1|4437087_4437321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484664.1|4437464_4438004_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001008431.1|4438218_4438971_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_001360050.1|4438984_4439974_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061444.1|4439981_4440791_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|4440810_4441200_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210141.1|4441196_4441523_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_001303054.1|4441519_4442173_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_072141203.1|4442172_4442667_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_000104949.1|4442663_4443605_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_001250269.1|4443594_4443774_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|4443949_4444501_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|4444493_4444754_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|4444851_4445544_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000917896.1|4445821_4446118_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_162829200.1|4447280_4448493_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001242749.1|4448634_4448997_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|4448996_4449302_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|4449528_4450692_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893282.1|4450896_4452150_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4450706:4450752	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4452161_4453265_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4453552_4454608_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 13
NZ_CP038292	Escherichia coli O157:H7 strain TB21-1 chromosome, complete genome	5498884	4886449	4899025	5498884	integrase	Enterobacteria_phage(81.82%)	15	4885483:4885498	4903978:4903993
4885483:4885498	attL	TTTCGATGAACAGCAC	NA	NA	NA	NA
WP_001301682.1|4886449_4887277_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
WP_044815386.1|4887494_4887689_-	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_000783684.1|4888044_4890378_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_000856729.1|4890392_4890713_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459287.1|4890848_4891304_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001244670.1|4891296_4891584_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000980224.1|4891576_4892167_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001149160.1|4892163_4892430_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283021.1|4892981_4893716_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_000638634.1|4893712_4894213_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446132.1|4894286_4894859_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000095622.1|4895184_4896429_+	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_001453880.1|4896466_4897201_-	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000936844.1|4897277_4897583_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000772662.1|4897750_4899025_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
4903978:4903993	attR	TTTCGATGAACAGCAC	NA	NA	NA	NA
>prophage 14
NZ_CP038292	Escherichia coli O157:H7 strain TB21-1 chromosome, complete genome	5498884	4931445	4990473	5498884	transposase,protease	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|4931445_4932798_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4932891_4933443_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4933598_4934972_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4935147_4936146_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4936178_4937174_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4937160_4938183_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|4938196_4939699_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4939838_4940795_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4941104_4941635_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4941714_4942065_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4942058_4942310_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4942521_4942863_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|4942865_4946645_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4946641_4948375_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4948580_4949219_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4949541_4950885_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4950980_4951187_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175296.1|4951511_4952066_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|4952128_4953067_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4953278_4954019_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589488.1|4954208_4956152_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_001302935.1|4956269_4956650_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4956738_4957599_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4957706_4958672_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4958779_4959442_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4959486_4960899_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4961207_4961828_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4962045_4962684_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4962818_4964027_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4964034_4964466_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4965088_4965883_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4965953_4966403_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4966444_4966672_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4966676_4966991_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4966997_4967393_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4967719_4967995_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4968123_4968810_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|4968809_4969664_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4969673_4970324_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4970337_4970802_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4970811_4971117_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|4971132_4972530_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|4974056_4974812_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|4974808_4975558_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4975739_4976069_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4976217_4976493_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4976609_4978235_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4978318_4979482_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4979484_4980123_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4980132_4980531_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|4980548_4981208_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4981258_4981957_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4981975_4982377_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4982503_4983235_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|4983415_4985857_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|4985895_4986321_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4986525_4987824_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4987927_4988125_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4988206_4989211_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4989213_4990473_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 15
NZ_CP038292	Escherichia coli O157:H7 strain TB21-1 chromosome, complete genome	5498884	5127353	5142018	5498884	tail,tRNA,integrase	Enterobacteria_phage(43.75%)	19	5123194:5123209	5140723:5140738
5123194:5123209	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5127353_5128769_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5128851_5129835_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5130000_5130243_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5130376_5131414_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5131502_5132600_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5132661_5132910_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5133070_5133712_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5133793_5134423_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5134495_5135068_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5135179_5135449_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5135450_5136764_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5136828_5137428_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5138749_5139286_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5139276_5139627_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5139623_5139908_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5140243_5140441_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5140785_5141067_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5140723:5140738	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5141114_5141288_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5141484_5142018_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
