The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038300	Escherichia coli O157:H7 strain SS TX 754-1 chromosome, complete genome	5546758	1228726	1242163	5546758	holin,tail	Enterobacteria_phage(38.46%)	17	NA	NA
WP_001223948.1|1228726_1229338_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1229334_1230000_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1229996_1230620_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1230872_1231616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1231701_1231869_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143065.1|1232276_1234130_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1234279_1234495_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1234499_1234844_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1235200_1235581_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1235577_1235925_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001023396.1|1236542_1236812_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1236972_1237395_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1237524_1238583_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1238661_1239312_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1239494_1240085_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1240586_1240835_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1241680_1242163_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP038300	Escherichia coli O157:H7 strain SS TX 754-1 chromosome, complete genome	5546758	1521059	1526485	5546758	integrase	Enterobacteria_phage(50.0%)	6	1510047:1510063	1528681:1528697
1510047:1510063	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1521059_1521629_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1521628_1522096_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1522082_1522763_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1522772_1523909_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1524083_1525241_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1525552_1526485_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1528681:1528697	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038300	Escherichia coli O157:H7 strain SS TX 754-1 chromosome, complete genome	5546758	1770767	1871717	5546758	tRNA,protease,portal,holin,tail,terminase	Enterobacteria_phage(52.78%)	110	NA	NA
WP_000569336.1|1770767_1771694_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1771698_1772430_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1772410_1772518_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1772577_1773279_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1773299_1774586_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1774619_1774874_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1774892_1775027_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1775030_1775273_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1775360_1775723_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1775719_1776076_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1776409_1776586_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1776587_1777535_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1777531_1777753_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1777851_1778133_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1778143_1778335_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_032195523.1|1778307_1778490_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	1.6e-28
WP_000186740.1|1778489_1779167_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1779163_1779949_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1779954_1780251_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1780326_1780617_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1781120_1782728_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|1782834_1783527_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182876.1|1783890_1784430_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000147884.1|1784426_1785446_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	9.7e-110
WP_000788906.1|1785442_1786144_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145928.1|1786140_1786425_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_001481254.1|1786652_1786850_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|1786893_1787175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141214.1|1787265_1787367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053021.1|1787363_1787819_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224907.1|1787818_1787989_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1787981_1788272_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|1788268_1788631_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1788627_1788768_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1788853_1789288_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1789536_1789689_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_171888490.1|1790492_1792439_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.3	0.0e+00
WP_000143458.1|1792575_1792755_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1792795_1793041_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072899.1|1793118_1793334_+|holin	class II holin family protein	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_000087728.1|1793338_1793872_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1794142_1794712_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539794.1|1794711_1794858_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	95.8	1.7e-15
WP_012816791.1|1795085_1795271_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|1795482_1795755_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|1795787_1796264_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|1796260_1798384_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102415.1|1798380_1798593_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|1798592_1800095_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1800039_1802064_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1802151_1802478_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1802470_1802752_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1802754_1803378_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1803390_1803789_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1803796_1804549_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1804562_1804985_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|1805011_1805320_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918276.1|1805363_1808009_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.4	0.0e+00
WP_000847298.1|1808005_1808335_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1808334_1809033_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194798.1|1809043_1809787_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_171888508.1|1809732_1810365_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.2	1.0e-101
WP_001230509.1|1814156_1814756_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_000268854.1|1814820_1815990_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	96.9	1.1e-83
WP_001023396.1|1815991_1816261_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_072142879.1|1816421_1816838_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1816919_1817561_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1817722_1817971_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1818485_1820171_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1820167_1820887_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1820933_1821404_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1821445_1821907_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1822031_1824035_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1824031_1825168_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1825160_1825892_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1825910_1827440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1827450_1828539_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1829779_1830097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1830158_1833788_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1840744_1842778_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1842909_1844019_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1844280_1844562_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1844853_1845396_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677409.1|1845483_1846158_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1846173_1848654_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1848664_1849699_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1849780_1850119_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134557.1|1850336_1851188_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1851308_1851581_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1851690_1852005_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1852014_1852362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1853412_1853652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1853985_1854774_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1854770_1855571_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1855635_1856454_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1856505_1857252_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1857225_1858191_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1858187_1859192_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1859188_1860466_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1860722_1861775_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1862073_1862928_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1862956_1864219_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1864228_1864681_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1864711_1864996_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490697.1|1864999_1866355_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1866402_1867443_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1867542_1868322_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1868403_1869303_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1869708_1870026_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|1870355_1871717_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 4
NZ_CP038300	Escherichia coli O157:H7 strain SS TX 754-1 chromosome, complete genome	5546758	1957734	2100718	5546758	integrase,protease,transposase,tail,head,portal,holin,lysis,capsid,terminase	Stx2-converting_phage(42.74%)	160	1954352:1954366	2060929:2060943
1954352:1954366	attL	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_001007946.1|1957734_1958913_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|1958893_1959085_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|1959162_1959507_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|1959694_1960045_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001289930.1|1960911_1961859_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|1961855_1962077_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1962175_1962457_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548528.1|1962467_1962659_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|1962631_1962814_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186848.1|1962810_1963491_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_001302855.1|1963487_1964273_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000995486.1|1964278_1964575_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|1964649_1964793_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1964761_1964926_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|1964998_1965367_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|1965549_1965801_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|1965859_1966132_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|1966109_1966292_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|1966860_1967382_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|1967883_1968579_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1968653_1968869_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|1969010_1969307_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|1969339_1969501_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|1969487_1970309_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|1970305_1971682_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001220560.1|1971760_1972372_+	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_000344569.1|1972835_1973168_+	hypothetical protein	NA	A0A0P0ZCF4	Stx2-converting_phage	100.0	3.3e-59
WP_000103678.1|1973300_1973516_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_171888491.1|1973526_1973763_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	98.7	1.2e-39
WP_001303571.1|1973719_1974166_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|1974162_1974690_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|1974686_1974869_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208500.1|1975143_1975908_+	phage antirepressor Ant	NA	A0A0P0ZB11	Stx2-converting_phage	100.0	1.4e-121
WP_001004016.1|1975982_1976705_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|1976704_1977310_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|1977306_1977978_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|1977968_1978457_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|1979106_1980066_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|1980077_1980347_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|1980643_1980967_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143115.1|1981210_1983148_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.8	0.0e+00
WP_000143458.1|1983284_1983464_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1983504_1983777_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|1983853_1984069_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|1984068_1984566_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|1984562_1985000_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|1985202_1985700_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1985696_1985954_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|1986416_1986644_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|1986685_1987051_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958396.1|1987342_1987906_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_162829202.1|1988574_1989788_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000173024.1|1990940_1992878_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.7	0.0e+00
WP_001063023.1|1992922_1993144_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125990.1|1995670_1995997_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|1996006_1996357_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|1996353_1996800_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1996796_1997141_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|1997199_1997916_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|1997921_1998296_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|1998391_1998601_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_015994262.1|1998652_2001895_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2001887_2002229_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179515.1|2002228_2002927_+|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	100.0	6.6e-134
WP_001302649.1|2002943_2003264_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2003371_2003545_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2003615_2004539_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|2004592_2005330_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_050546863.1|2005275_2005908_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000515107.1|2006167_2009647_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	100.0	0.0e+00
WP_001230314.1|2009713_2010313_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	100.0	1.8e-111
WP_000268993.1|2010377_2011691_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	100.0	2.8e-85
WP_001023452.1|2011692_2011962_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2012102_2012978_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001303036.1|2015176_2016343_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2016461_2016935_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2017133_2018192_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2018363_2018693_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2018793_2018976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2019464_2019578_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2019590_2019785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2020243_2020612_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2020685_2020907_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2020969_2021446_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2021460_2021940_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2022021_2022843_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2023063_2023474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2023489_2024173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2024308_2025379_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2025375_2026281_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000638172.1|2026277_2027159_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171888492.1|2027142_2028356_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	2.2e-164
WP_000966626.1|2028727_2030875_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2032322_2033861_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2033910_2034258_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2034254_2034635_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|2034996_2035542_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2035538_2036282_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2036293_2037373_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2037434_2038370_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2038826_2039744_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2039845_2040796_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|2040913_2042557_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2043182_2043899_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2044241_2045696_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2045797_2047114_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2047427_2048480_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_162829202.1|2052668_2053881_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001302302.1|2058526_2059324_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2059559_2060582_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2060581_2060785_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2060843_2063315_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
2060929:2060943	attR	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_000199485.1|2063410_2063599_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2063595_2063784_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2064264_2064417_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2064691_2065336_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2065433_2065661_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2065657_2066083_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2066151_2067189_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2067100_2067643_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_171888509.1|2067677_2068376_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.9	5.5e-72
WP_000702797.1|2068397_2068622_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2068618_2068975_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2069007_2069160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2069156_2069468_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2069594_2070158_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2070267_2070372_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2070558_2070771_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2070938_2071217_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2071218_2072268_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2072280_2072640_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2072636_2073326_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000023257.1|2074865_2076716_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2076797_2078011_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2078321_2078537_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2078541_2078886_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2078936_2079470_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2079625_2079808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2079820_2079952_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2080179_2080365_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2080891_2081206_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2081287_2081512_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2081906_2082416_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2084300_2084507_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2084503_2086096_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2086085_2087591_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2087627_2087975_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2088032_2088299_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2088280_2089021_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2089034_2089466_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2089492_2089906_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_088136971.1|2089886_2092466_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.3	0.0e+00
WP_000847298.1|2092462_2092792_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|2092791_2093490_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|2093500_2094244_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_129137391.1|2094189_2094822_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_115333685.1|2096032_2098546_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.8	0.0e+00
WP_001230509.1|2098613_2099213_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_088136427.1|2099277_2100447_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001023396.1|2100448_2100718_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
>prophage 5
NZ_CP038300	Escherichia coli O157:H7 strain SS TX 754-1 chromosome, complete genome	5546758	2158240	2178226	5546758	integrase,transposase,tail	Enterobacteria_phage(75.0%)	28	2171362:2171375	2181368:2181381
WP_032161583.1|2158240_2159377_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|2159327_2159651_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2159808_2160993_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2160992_2161505_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2161559_2161925_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2161933_2162089_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2164891_2165380_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2165536_2166109_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2166152_2166683_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2167774_2168089_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2168093_2169053_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2169129_2171952_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2171362:2171375	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2171958_2172324_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2172320_2172938_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2172949_2173249_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2173245_2173512_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2173508_2173712_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2173735_2174152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2174244_2174358_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2174354_2174597_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2174608_2174887_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2174897_2175248_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2175269_2175473_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2175544_2175682_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2175771_2176176_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2176191_2176842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2176871_2177219_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001303019.1|2177224_2178226_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
2181368:2181381	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 6
NZ_CP038300	Escherichia coli O157:H7 strain SS TX 754-1 chromosome, complete genome	5546758	2454404	2655815	5546758	integrase,protease,transposase,tail,head,portal,holin,tRNA,capsid,terminase	Stx2-converting_phage(35.54%)	212	2542504:2542525	2601909:2601930
WP_001295400.1|2454404_2455679_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
WP_001302086.1|2455740_2456601_+	pyridoxal kinase PdxY	NA	NA	NA	NA	NA
WP_000765749.1|2456644_2457250_-	glutathione transferase GstA	NA	NA	NA	NA	NA
WP_000100942.1|2457355_2458858_-	dipeptide/tripeptide permease DtpA	NA	NA	NA	NA	NA
WP_001030347.1|2459468_2460104_-	endonuclease III	NA	NA	NA	NA	NA
WP_001289657.1|2460103_2460799_-	electron transport complex subunit RsxE	NA	NA	NA	NA	NA
WP_000920789.1|2460802_2461423_-	electron transport complex subunit RsxG	NA	NA	NA	NA	NA
WP_000231928.1|2461426_2462485_-	electron transport complex subunit RsxD	NA	NA	NA	NA	NA
WP_000915707.1|2462485_2464804_-	electron transport complex subunit RsxC	NA	NA	NA	NA	NA
WP_000991809.1|2464796_2465375_-	electron transport complex subunit RsxB	NA	NA	NA	NA	NA
WP_000133193.1|2465374_2465956_-	electron transport complex subunit RsxA	NA	NA	NA	NA	NA
WP_001302052.1|2466032_2466473_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000217950.1|2466558_2466774_-	transcription modulator YdgT	NA	NA	NA	NA	NA
WP_001296096.1|2467046_2467172_-	division septum protein Blr	NA	NA	NA	NA	NA
WP_001282516.1|2467414_2468455_+	oxidoreductase	NA	NA	NA	NA	NA
WP_000567512.1|2468490_2469492_-	adenosine deaminase	NA	NA	NA	NA	NA
WP_000459374.1|2469595_2470768_-	bifunctional maltose regulon transcriptional repressor/cystathionine beta-lyase MalY	NA	NA	NA	NA	NA
WP_000125634.1|2470777_2472370_-	PTS maltose transporter subunit IICB	NA	NA	NA	NA	NA
WP_000179513.1|2472544_2473573_+	mal regulon transcriptional regulator MalI	NA	NA	NA	NA	NA
WP_000483353.1|2473684_2474452_+	7-alpha-hydroxysteroid dehydrogenase	NA	NA	NA	NA	NA
WP_000969092.1|2474680_2475271_+	DNA-binding transcriptional regulator UidR	NA	NA	NA	NA	NA
WP_001075838.1|2477471_2478845_+	glucuronide transporter	NA	NA	NA	NA	NA
WP_001043324.1|2480192_2481701_-	YdgA family protein	NA	NA	NA	NA	NA
WP_001170658.1|2481801_2482977_-	mannose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_000066619.1|2483175_2484822_+	class I fumarate hydratase	NA	NA	NA	NA	NA
WP_171888493.1|2484964_2486368_+	class II fumarate hydratase	NA	NA	NA	NA	NA
WP_001322334.1|2486364_2487294_-	DNA replication terminus site-binding protein	NA	NA	NA	NA	NA
WP_000732491.1|2487369_2488671_-	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	23.9	3.2e-17
WP_001092494.1|2488674_2489394_-	two-component system response regulator RstA	NA	NA	NA	NA	NA
WP_000524868.1|2489522_2489858_+	GlpM family protein	NA	NA	NA	NA	NA
WP_000520804.1|2489854_2490577_-	dihydromonapterin reductase	NA	NA	NA	NA	NA
WP_000412375.1|2490613_2491996_-	amino acid permease	NA	NA	NA	NA	NA
WP_000769322.1|2492181_2493126_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001302608.1|2493649_2495182_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_000014036.1|2495192_2496581_+	Re/Si-specific NAD(P)(+) transhydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000085279.1|2497687_2498917_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	7.1e-131
WP_000953272.1|2499283_2499472_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_153037810.1|2499521_2499848_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000201456.1|2499972_2500152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001453500.1|2500346_2500544_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000920682.1|2500536_2500722_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000659212.1|2500721_2500913_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	50.0	1.7e-07
WP_000794515.1|2500902_2501145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770147.1|2501150_2501450_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761790.1|2501446_2503579_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	52.6	3.4e-173
WP_000198851.1|2503951_2504203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233312.1|2504622_2504895_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001137341.1|2505182_2506340_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.9	2.1e-137
WP_000987369.1|2506394_2506952_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	3.5e-61
WP_000267608.1|2506953_2508165_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_001020674.1|2508161_2508500_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	52.7	8.7e-31
WP_000134110.1|2508496_2508793_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	64.3	2.6e-31
WP_001145905.1|2508792_2509233_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	72.6	2.5e-62
WP_000174068.1|2509216_2509399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|2509522_2509879_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_000127889.1|2509862_2511524_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.6	1.5e-277
WP_001340366.1|2511537_2511819_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000276149.1|2513093_2513459_+	multidrug/spermidine efflux SMR transporter subunit MdtJ	NA	NA	NA	NA	NA
WP_000046661.1|2513445_2513775_+	multidrug/spermidine efflux SMR transporter subunit MdtI	NA	NA	NA	NA	NA
WP_001260835.1|2513813_2514635_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2514734_2514818_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2514910_2515246_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2515642_2516896_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2517002_2517896_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2518030_2519251_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2519375_2520071_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2520023_2521316_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2521473_2522088_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2522130_2522985_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2522986_2523604_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2523614_2526038_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2526098_2528525_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2528723_2529029_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2529136_2529847_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2529849_2530410_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2530444_2530786_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2530920_2531247_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2532235_2532487_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2532559_2535031_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2535123_2535315_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2535311_2535500_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2535900_2536065_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2536068_2536287_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2536358_2536658_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2537010_2537289_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2537290_2537482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2537502_2537874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2537971_2538274_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2538270_2538696_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095670.1|2538718_2539681_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
WP_000788936.1|2539687_2540428_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_001118159.1|2541238_2541634_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2541690_2542275_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2542390_2542495_+	hypothetical protein	NA	NA	NA	NA	NA
2542504:2542525	attL	CGATATGGGAATTCCCATATCG	NA	NA	NA	NA
WP_000887477.1|2542683_2542896_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2543063_2543342_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2543343_2544393_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2544405_2544765_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2544761_2545451_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2546087_2546516_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_024748470.1|2546994_2548845_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_024180155.1|2549284_2549500_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2549504_2549849_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2549899_2550433_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2550703_2551273_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2551272_2551419_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2551646_2551832_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2552256_2552484_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|2552525_2552891_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_001303051.1|2553180_2553744_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_001413036.1|2553740_2555402_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.6	0.0e+00
WP_000172999.1|2555465_2557403_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2557447_2557669_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2557614_2560116_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2560195_2560522_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2560531_2560882_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2560878_2561325_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2561321_2561666_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2561724_2562441_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2562446_2562821_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2562916_2563126_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2563178_2566421_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2566413_2566755_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303038.1|2566754_2567453_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_046671488.1|2567463_2568207_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_050439450.1|2568152_2568785_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|2569127_2570303_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_153037899.1|2570254_2572600_+	DUF1983 domain-containing protein	NA	Q9EYE7	Enterobacteria_phage	99.6	0.0e+00
WP_171888494.1|2572667_2573267_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.0	5.9e-107
WP_171888495.1|2573418_2574732_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	7.2e-81
WP_001023474.1|2574733_2575003_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|2576029_2577355_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_000998048.1|2580019_2581558_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2581607_2581955_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2581951_2582332_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2582671_2582950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000998048.1|2583119_2584658_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2584707_2585055_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2585051_2585432_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001414184.1|2585827_2585974_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2586110_2586758_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2586941_2587532_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|2589038_2589689_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001500821.1|2590988_2592119_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	50.9	4.9e-102
WP_000113189.1|2592096_2592345_-	excisionase	NA	NA	NA	NA	NA
WP_000102181.1|2592409_2594854_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
WP_000092782.1|2594946_2595135_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|2595131_2595320_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000380314.1|2595807_2595960_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000367559.1|2596129_2596519_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024213789.1|2596621_2596897_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000693888.1|2596880_2597306_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095667.1|2597328_2598282_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000790456.1|2598288_2599029_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_000450888.1|2599058_2599829_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
WP_001118161.1|2599844_2600240_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_001302146.1|2600296_2600653_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_000063625.1|2600701_2600914_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000137941.1|2600949_2601321_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000610379.1|2601317_2601680_+	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_001278450.1|2601795_2601900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2602088_2602301_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
2601909:2601930	attR	CGATATGGGAATTCCCATATCG	NA	NA	NA	NA
WP_000998188.1|2602597_2602765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304183.1|2602830_2603109_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000904137.1|2604172_2604547_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762905.1|2604543_2605365_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.5e-84
WP_000917735.1|2605591_2605789_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483497.1|2605939_2606998_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_024748518.1|2607489_2609340_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_024164617.1|2609778_2609994_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075112.1|2609993_2610491_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_001208680.1|2610707_2610893_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|2611420_2611735_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|2611816_2612041_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303046.1|2612082_2612448_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958387.1|2612736_2613300_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_171888496.1|2613296_2614958_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.5	0.0e+00
WP_000172999.1|2615021_2616959_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2617003_2617225_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2617170_2619672_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2619751_2620078_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2620087_2620438_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2620434_2620881_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2620877_2621222_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2621280_2621997_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2622002_2622377_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2622472_2622682_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2622734_2625977_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2625969_2626311_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303038.1|2626310_2627009_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_001303043.1|2627019_2627763_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_129137391.1|2627708_2628341_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_024748464.1|2628587_2632067_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.1	0.0e+00
WP_001230495.1|2632133_2632733_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	3.7e-109
WP_024748463.1|2632797_2634111_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.6	6.5e-82
WP_001023426.1|2634112_2634382_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	1.6e-43
WP_001079499.1|2640464_2640971_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|2641016_2641517_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2641602_2641782_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2642162_2642969_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2642968_2644162_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983855.1|2644173_2645535_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	7.3e-36
WP_000763503.1|2645535_2647131_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194607.1|2647130_2648693_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2648784_2648829_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2648966_2649848_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2649844_2650465_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|2650492_2652076_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2652288_2653161_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2653200_2653791_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2653787_2654546_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2654765_2655815_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 7
NZ_CP038300	Escherichia coli O157:H7 strain SS TX 754-1 chromosome, complete genome	5546758	2739075	2790424	5546758	protease,tail,portal,holin,tRNA,terminase	Escherichia_phage(39.66%)	63	NA	NA
WP_000628061.1|2739075_2740308_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2740562_2741546_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001625136.1|2741820_2741991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123746.1|2742023_2743397_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157382.1|2743525_2744461_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	5.4e-147
WP_000040845.1|2744512_2745748_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.3	1.1e-237
WP_000079604.1|2745749_2745965_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001356607.1|2746064_2746253_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_042853000.1|2746245_2746440_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_000166315.1|2746496_2747306_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000102194.1|2747298_2749968_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	61.3	4.2e-205
WP_000245534.1|2750048_2750225_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.7	4.1e-24
WP_000560226.1|2750218_2750440_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_000887681.1|2750486_2751335_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
WP_000379547.1|2751746_2751899_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000410105.1|2752205_2752625_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_001033914.1|2752721_2752964_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000702017.1|2752960_2753383_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	5.9e-69
WP_001356605.1|2753460_2754249_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	5.1e-42
WP_000788984.1|2754255_2755002_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	4.8e-114
WP_000450718.1|2755024_2755786_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	1.0e-116
WP_001151116.1|2755801_2756224_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.8e-63
WP_000014164.1|2756220_2756451_+	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	76.8	4.1e-16
WP_001138877.1|2756605_2757256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000418464.1|2757242_2758364_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000902698.1|2758486_2758699_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.2e-17
WP_000940305.1|2759258_2759858_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	1.0e-106
WP_000228017.1|2759857_2760148_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	8.2e-46
WP_000640110.1|2760144_2760687_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.3	3.9e-73
WP_171888490.1|2761387_2763334_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.3	0.0e+00
WP_000143458.1|2763470_2763650_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|2763690_2763936_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072899.1|2764013_2764229_+|holin	class II holin family protein	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_000087728.1|2764233_2764767_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|2765037_2765607_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539794.1|2765606_2765753_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	95.8	1.7e-15
WP_012816791.1|2765980_2766166_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|2766377_2766650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|2766682_2767159_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|2767155_2769279_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102415.1|2769275_2769488_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|2769487_2770990_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|2770934_2772959_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|2773046_2773373_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|2773365_2773647_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|2773649_2774273_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|2774285_2774684_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|2774691_2775444_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|2775457_2775880_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|2775906_2776215_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000918276.1|2776258_2778904_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.4	0.0e+00
WP_000847298.1|2778900_2779230_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001356552.1|2779229_2779928_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	3.6e-132
WP_000194798.1|2779938_2780682_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_096851774.1|2780627_2781257_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	2.3e-101
WP_000514990.1|2781497_2784971_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_001228289.1|2785038_2785638_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000279065.1|2785702_2787025_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q687E6	Enterobacteria_phage	98.6	2.0e-75
WP_001023406.1|2787026_2787296_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_001131659.1|2787408_2787984_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001443810.1|2788056_2788686_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|2788767_2789409_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|2789989_2790424_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
>prophage 8
NZ_CP038300	Escherichia coli O157:H7 strain SS TX 754-1 chromosome, complete genome	5546758	2971073	3069568	5546758	integrase,transposase,head,portal,holin,tail,capsid,terminase	Escherichia_phage(29.91%)	126	3014297:3014310	3070447:3070460
WP_000214712.1|2971073_2971277_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2971312_2972773_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2972861_2974145_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001120551.1|2974276_2974519_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2974680_2975322_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2975403_2976033_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2976105_2976681_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2976794_2977064_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_024748460.1|2977065_2978379_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
WP_001230508.1|2978443_2979043_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_136858502.1|2979110_2981462_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.7	0.0e+00
WP_171888497.1|2981413_2982589_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	97.7	5.7e-231
WP_129137391.1|2982835_2983468_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_001303043.1|2983413_2984157_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_171877044.1|2984167_2984866_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|2984865_2985195_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000081804.1|2985191_2987804_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000533440.1|2987784_2988198_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|2988224_2988647_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|2988660_2989413_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2989420_2989816_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2989812_2990346_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2990360_2990714_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2990725_2991124_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063233.1|2991165_2992191_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_001295978.1|2992246_2992579_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2992588_2993908_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2993888_2995490_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2995486_2995693_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|2995689_2997615_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|2997589_2998135_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2998521_2998746_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2998827_2999142_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|2999667_2999853_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|3000075_3000222_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|3000221_3000791_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3001061_3001595_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731241.1|3001645_3001990_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_024180155.1|3001994_3002210_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_153037812.1|3002649_3004500_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_001302123.1|3004977_3005409_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|3005859_3006573_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|3006708_3006906_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|3007130_3007685_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|3007747_3008053_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000191872.1|3009064_3009337_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|3009458_3009803_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|3009922_3010135_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|3010368_3010926_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|3010927_3011146_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|3011273_3011585_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|3011577_3011805_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|3011801_3012083_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|3012115_3012832_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|3012865_3013327_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_136760546.1|3013319_3014357_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	68.7	2.2e-85
3014297:3014310	attL	TCGTTCGCCACTTG	NA	NA	NA	NA
WP_000693878.1|3014425_3014851_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|3014834_3015077_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|3015468_3015807_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|3016099_3016252_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|3016263_3016902_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|3016902_3017112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|3017676_3017865_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|3017861_3018050_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|3018142_3019387_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|3020097_3020340_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|3021302_3021683_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3021679_3022027_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3022076_3023615_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|3024197_3024848_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001131642.1|3025557_3026133_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|3026246_3026516_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|3026517_3027741_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|3027805_3028405_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001304111.1|3028472_3028688_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_012779365.1|3028690_3031951_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.3	0.0e+00
WP_024748472.1|3032136_3032574_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	100.0	5.0e-63
WP_000807954.1|3032573_3032915_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064261924.1|3032907_3036150_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|3036202_3036412_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3036507_3036882_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3036887_3037604_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|3037662_3038007_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3038003_3038450_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3038446_3038797_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3038806_3039133_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3039212_3041714_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3041659_3041881_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3041925_3043863_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001303049.1|3043926_3045588_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_001303051.1|3045584_3046148_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_015994246.1|3046437_3046803_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|3046844_3047072_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3047496_3047682_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3047909_3048056_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3048055_3048625_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3048895_3049429_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731241.1|3049479_3049824_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_024180155.1|3049828_3050044_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_171878100.1|3050483_3052334_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.1	0.0e+00
WP_000935548.1|3053130_3054189_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|3054339_3054537_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3054778_3055309_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3055317_3055677_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3055689_3056736_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|3056737_3057016_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3057085_3057343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|3057563_3057776_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3058054_3058813_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3059511_3059676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3059672_3060254_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|3060440_3060983_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3060894_3061935_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3061906_3062458_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3062441_3062669_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3062745_3063153_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3063416_3063716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3063788_3064007_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3064029_3064437_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3064414_3064648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3064641_3064809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3065206_3065395_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3065391_3065583_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048549.1|3065675_3068147_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_000113189.1|3068211_3068460_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3068437_3069568_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
3070447:3070460	attR	TCGTTCGCCACTTG	NA	NA	NA	NA
>prophage 9
NZ_CP038300	Escherichia coli O157:H7 strain SS TX 754-1 chromosome, complete genome	5546758	3116264	3209957	5546758	integrase,tRNA,protease,transposase,head,portal,holin,tail,lysis,capsid,terminase	Enterobacteria_phage(49.06%)	100	3139462:3139477	3203860:3203875
WP_001299679.1|3116264_3117521_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3117734_3118358_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3118357_3119209_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3119359_3120307_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033348.1|3120431_3122111_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.0e-23
WP_000823885.1|3122165_3122444_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3122721_3123306_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3123422_3124514_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|3125357_3128243_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|3128342_3130262_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_001295616.1|3130968_3131580_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3131679_3132594_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3132689_3134426_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_162829348.1|3134583_3135797_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000197859.1|3136134_3137205_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3137214_3138513_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3138875_3140408_+	SpoVR family protein	NA	NA	NA	NA	NA
3139462:3139477	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3140459_3141179_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3141400_3142942_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3143087_3143618_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3143663_3144932_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3144931_3145351_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3145723_3146635_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3146841_3147303_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3147379_3148039_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3148110_3148404_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3148415_3148574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3148644_3149046_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3149148_3149517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3150036_3150732_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3150755_3151568_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3151571_3151838_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3153069_3153654_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3154152_3155106_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3155292_3156777_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3157079_3158618_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3158667_3159015_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3159011_3159392_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3159467_3159716_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3159772_3160441_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3160938_3161121_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3161199_3161700_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3161736_3162243_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3162261_3163152_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3163271_3163853_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3163852_3166768_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3166832_3167432_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3167498_3170897_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3170957_3171590_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3171526_3172270_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3172275_3172974_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3172973_3173303_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3173299_3175849_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3175841_3176276_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3176257_3176680_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3176695_3177436_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3177443_3177839_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3177835_3178414_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3178425_3178779_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3178790_3179189_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063233.1|3179230_3180256_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_001295978.1|3180311_3180644_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3180653_3181973_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3181953_3183555_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3183551_3183758_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_024251565.1|3183754_3185680_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3185654_3186200_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3186588_3186783_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3186947_3187154_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3187439_3187850_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3188141_3188435_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3188525_3188708_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3188924_3189401_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3189387_3189693_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3190014_3190704_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3190700_3190841_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3190837_3191200_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3191196_3191487_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3191479_3191650_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3191649_3192105_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3192606_3194133_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3194190_3194313_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3194377_3194710_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3194777_3195080_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3195076_3195778_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088657.1|3196702_3196939_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3196928_3198071_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3198184_3199435_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3199606_3200260_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3200269_3200731_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3200784_3201891_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3201926_3202568_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3202571_3203942_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3203860:3203875	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3204110_3204782_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3204781_3206242_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3206842_3207124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3207379_3207922_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3208127_3208541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3208553_3208889_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3208901_3209957_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 10
NZ_CP038300	Escherichia coli O157:H7 strain SS TX 754-1 chromosome, complete genome	5546758	3216049	3273393	5546758	integrase,head,portal,holin,tail,capsid,terminase	Stx2-converting_phage(26.79%)	71	3258954:3258974	3280050:3280070
WP_000085270.1|3216049_3217276_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	5.4e-131
WP_001301987.1|3217524_3218646_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3218694_3219921_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3220170_3221307_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3221290_3222154_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3222517_3223879_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3223939_3224215_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3226523_3229925_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3230515_3232864_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3232883_3232973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3232985_3233222_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_171888498.1|3233167_3233905_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	98.8	4.5e-149
WP_000835336.1|3233958_3234837_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3235139_3235250_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3235359_3235614_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001303038.1|3235630_3236329_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_000807954.1|3236328_3236670_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064261924.1|3236662_3239905_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_001453746.1|3239952_3240162_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3240257_3240632_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275499.1|3240646_3241363_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	8.0e-127
WP_000133388.1|3241421_3241766_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3241762_3242209_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3242205_3242556_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3242565_3242892_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3242971_3245473_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3245418_3245640_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3245684_3247622_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3247685_3249347_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|3249343_3249907_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|3250198_3250564_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001302977.1|3250605_3250791_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3250920_3251061_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3251417_3251642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3251706_3251913_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3252140_3252287_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3252286_3252856_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3253126_3253660_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3253710_3254055_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3254059_3254275_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3254350_3254620_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3254657_3254840_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023167.1|3254987_3256925_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3257239_3257407_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3258003_3258825_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3258821_3259196_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3258954:3258974	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265159.1|3259208_3260258_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001341388.1|3260259_3260538_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3260705_3260918_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3261106_3261211_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3261326_3261914_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3261916_3262108_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3262109_3262547_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3262533_3262851_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3262804_3263122_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3263111_3263414_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3263410_3263692_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3263724_3264441_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3264474_3265017_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_070081046.1|3264928_3265972_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	78.8	1.4e-87
WP_000693962.1|3266040_3266466_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3266449_3266773_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3266897_3267374_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3267689_3267842_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3267956_3268472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3268604_3268994_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3269055_3269325_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3269293_3270412_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3270578_3271373_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3271369_3272416_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3272571_3273393_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3280050:3280070	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 11
NZ_CP038300	Escherichia coli O157:H7 strain SS TX 754-1 chromosome, complete genome	5546758	3524364	3579708	5546758	integrase,protease,transposase,head,portal,holin,tail,capsid,terminase	Escherichia_phage(27.27%)	63	3526299:3526314	3581473:3581488
WP_000003653.1|3524364_3524952_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3524948_3525656_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3525674_3527468_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3526299:3526314	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3527464_3528583_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023407.1|3530575_3530845_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268855.1|3530846_3532160_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001230444.1|3532224_3532824_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515109.1|3532891_3536365_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_000649827.1|3536498_3537026_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_050546863.1|3537216_3537849_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_088136431.1|3537794_3538538_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	1.2e-149
WP_001302968.1|3538548_3539247_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000847298.1|3539246_3539576_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082473.1|3539572_3542152_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|3542132_3542546_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3542572_3543004_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3543017_3543758_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3543739_3544006_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3544063_3544411_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3544447_3545953_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3545942_3547535_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3547531_3547738_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3547721_3549650_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000998048.1|3549913_3551452_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3551501_3551849_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3551845_3552226_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3552301_3552577_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3553327_3553534_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3553789_3554062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3554221_3554755_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3554975_3555089_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3555310_3555496_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3556023_3556338_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3556542_3557756_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|3557931_3559782_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3560548_3561262_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3561882_3562701_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3562852_3563224_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3563213_3563585_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3563597_3564647_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3564648_3564927_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3565094_3565250_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3565351_3565489_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3565854_3566628_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3566979_3567393_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3567408_3568179_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3568200_3568947_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3568953_3570045_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3570123_3570579_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3570785_3571211_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3571194_3571467_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3571575_3571977_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3572004_3572196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3572195_3572483_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3572760_3572916_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3573057_3573447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3573633_3573819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3574392_3574581_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3574577_3574769_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3574862_3577334_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3577401_3577644_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3577621_3578641_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3579048_3579708_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3581473:3581488	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 12
NZ_CP038300	Escherichia coli O157:H7 strain SS TX 754-1 chromosome, complete genome	5546758	3592167	3715821	5546758	integrase,tRNA,protease,tail,head,portal,holin,lysis,capsid,terminase,plate	Escherichia_phage(41.27%)	112	3665129:3665146	3707210:3707227
WP_000156526.1|3592167_3593928_+|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_000227927.1|3593996_3594515_+	bifunctional 3-hydroxydecanoyl-ACP dehydratase/trans-2-decenoyl-ACP isomerase	NA	NA	NA	NA	NA
WP_000828648.1|3594584_3594752_-	ribosome modulation factor	NA	NA	NA	NA	NA
WP_000759107.1|3595007_3595571_-	membrane integrity-associated transporter subunit PqiC	NA	NA	NA	NA	NA
WP_000445550.1|3595567_3597208_-	intermembrane transport protein PqiB	NA	NA	NA	NA	NA
WP_000333170.1|3597212_3598466_-	membrane integrity-associated transporter subunit PqiA	NA	NA	NA	NA	NA
WP_000053083.1|3598595_3600503_-	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.1e-53
WP_171888500.1|3600514_3602623_-	bifunctional 23S rRNA (guanine(2069)-N(7))-methyltransferase RlmK/23S rRNA (guanine(2445)-N(2))-methyltransferase RlmL	NA	NA	NA	NA	NA
WP_000224291.1|3602866_3603976_+	6-N-hydroxylaminopurine resistance protein YcbX	NA	NA	NA	NA	NA
WP_001301917.1|3603972_3604515_-	cell division protein ZapC	NA	NA	NA	NA	NA
WP_001295352.1|3604688_3605699_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_000919496.1|3606511_3607027_-	fimbrial protein	NA	NA	NA	NA	NA
WP_077626202.1|3607034_3607562_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001165679.1|3607589_3608660_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001303867.1|3611274_3611976_-	molecular chaperone	NA	NA	NA	NA	NA
WP_000750295.1|3612058_3612598_-	fimbrial protein	NA	NA	NA	NA	NA
WP_001263919.1|3612953_3613529_+	NADPH-dependent FMN reductase	NA	NA	NA	NA	NA
WP_001244347.1|3613521_3614481_+	aliphatic sulfonate ABC transporter substrate-binding protein SsuA	NA	NA	NA	NA	NA
WP_000055981.1|3614477_3615623_+	FMNH2-dependent alkanesulfonate monooxygenase	NA	NA	NA	NA	NA
WP_000235210.1|3615634_3616426_+	aliphatic sulfonate ABC transporter permease SsuC	NA	NA	NA	NA	NA
WP_001090506.1|3616422_3617190_+	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
WP_000193803.1|3617232_3619845_-	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001301736.1|3620110_3621313_+	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000117895.1|3621481_3622882_+|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	35.7	4.5e-81
WP_000977914.1|3623484_3624573_+	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.0	1.1e-98
WP_000462673.1|3624757_3625948_+	aspartate transaminase	NA	NA	NA	NA	NA
WP_001109453.1|3625998_3626646_-	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_001295932.1|3626672_3627221_-	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_000925977.1|3627401_3629249_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000572668.1|3629509_3633970_-	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_001302273.1|3633969_3634674_-	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_001288845.1|3634654_3635977_-	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001301572.1|3635973_3636759_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|3636894_3637674_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436922.1|3637650_3638544_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011613.1|3638697_3639444_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|3639440_3639623_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056545.1|3639674_3640907_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570541.1|3640943_3641930_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|3641926_3643675_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000705685.1|3643711_3645976_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3646182_3646467_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3646626_3648300_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3648410_3649094_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000799175.1|3649266_3650031_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000445231.1|3650199_3651483_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057165.1|3651553_3652642_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	4.5e-81
WP_000642854.1|3652840_3653533_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001301741.1|3653662_3655423_+	YcaO-like family protein	NA	NA	NA	NA	NA
WP_000642546.1|3655828_3656686_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292812.1|3656740_3659023_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000468308.1|3659341_3659560_-	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000882928.1|3659641_3660805_-	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.7	6.6e-203
WP_000978907.1|3660804_3661284_-|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	99.4	1.5e-84
WP_000069918.1|3661298_3663746_-|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	91.7	0.0e+00
WP_000785970.1|3663738_3663858_-|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_001031303.1|3663890_3664166_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001251408.1|3664222_3664741_-|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001286688.1|3664753_3665944_-|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.5	2.8e-225
3665129:3665146	attL	GCGGAAACCGTCACGGCG	NA	NA	NA	NA
WP_000905107.1|3666003_3666597_-	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	3.9e-103
WP_001127577.1|3666627_3667032_+	hypothetical protein	NA	M1FN94	Enterobacteria_phage	43.1	5.5e-16
WP_000639074.1|3667040_3667436_+|tail	tail fiber assembly protein	tail	A0A0M4S6V4	Salmonella_phage	43.5	3.5e-15
WP_001008235.1|3667407_3667851_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	98.6	1.2e-80
WP_024214860.1|3667871_3669071_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	96.2	1.3e-214
WP_001285340.1|3669067_3669679_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	100.0	1.7e-117
WP_001121474.1|3669671_3670580_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	100.0	1.2e-162
WP_000127145.1|3670584_3670932_-	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	98.3	5.5e-57
WP_001093691.1|3670928_3671564_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	1.9e-111
WP_001001773.1|3671630_3672083_-	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.7	1.5e-75
WP_000917149.1|3672075_3672543_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.1	5.7e-81
WP_001440152.1|3672505_3672679_-	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_000040640.1|3672650_3673076_-|lysis	LysB family phage lysis regulatory protein	lysis	U5N3W5	Enterobacteria_phage	96.5	2.1e-66
WP_000736606.1|3673063_3673489_-	hypothetical protein	NA	M1SV74	Escherichia_phage	95.0	1.2e-56
WP_001144101.1|3673503_3674001_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|3674000_3674282_-|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|3674285_3674489_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988633.1|3674488_3674998_-|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000203428.1|3675097_3675841_-|terminase	terminase endonuclease subunit	terminase	Q858W5	Yersinia_virus	98.8	2.7e-125
WP_001248570.1|3675844_3676918_-|capsid	phage major capsid protein, P2 family	capsid	Q94MH9	Enterobacteria_phage	99.4	2.5e-201
WP_001085975.1|3676976_3677831_-|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	98.6	3.5e-137
WP_000156847.1|3678004_3679777_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_000038152.1|3679776_3680811_+|portal	phage portal protein	portal	M1SV64	Escherichia_phage	99.1	2.1e-200
WP_000997853.1|3681150_3682983_-	hypothetical protein	NA	Q2P9X5	Enterobacteria_phage	32.3	6.9e-90
WP_000268620.1|3683099_3685382_-	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	98.0	0.0e+00
WP_000027664.1|3685371_3685647_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_001153795.1|3685643_3685868_-	TraR/DksA C4-type zinc finger protein	NA	A0A0F7LDG9	Escherichia_phage	98.6	4.2e-34
WP_001277959.1|3685867_3686170_-	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	98.0	2.9e-46
WP_000557703.1|3686169_3686394_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_000217677.1|3686457_3686958_-	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_001005162.1|3686954_3687125_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000022051.1|3687135_3687492_-	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_000072552.1|3687596_3687908_+	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000023391.1|3688001_3688997_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000067977.1|3689028_3689826_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000918514.1|3690035_3691466_-	amino acid permease	NA	NA	NA	NA	NA
WP_000109295.1|3691675_3692824_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|3693138_3693765_+	hydrolase	NA	NA	NA	NA	NA
WP_000534648.1|3693800_3694664_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213047.1|3694665_3695283_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	6.6e-77
WP_000850325.1|3695293_3697738_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	3.9e-221
WP_000886683.1|3697976_3699269_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067749.1|3699359_3700703_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_001295343.1|3700713_3701325_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000076999.1|3701479_3705508_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3705642_3706137_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537418.1|3706681_3707647_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
3707210:3707227	attR	CGCCGTGACGGTTTCCGC	NA	NA	NA	NA
WP_001043606.1|3707769_3709536_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	5.4e-23
WP_001202230.1|3709536_3711258_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	1.1e-20
WP_001241680.1|3711299_3712004_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3712288_3712507_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3713193_3715470_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3715500_3715821_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 13
NZ_CP038300	Escherichia coli O157:H7 strain SS TX 754-1 chromosome, complete genome	5546758	3840498	3878593	5546758	integrase,protease,tail,portal,holin,lysis,terminase	Enterobacteria_phage(51.22%)	48	3840083:3840097	3878667:3878681
3840083:3840097	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3840498_3841197_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3841427_3842309_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3842477_3842639_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3843135_3844155_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3844188_3845169_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3845345_3845615_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3845616_3846933_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3846992_3847592_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000090841.1|3851136_3851745_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3851681_3852425_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3852430_3853129_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3853138_3853468_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3853467_3856533_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3856504_3856834_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3856842_3857229_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3857289_3858033_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3858043_3858445_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3858441_3859020_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3859031_3859307_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3859299_3859623_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136598.1|3859709_3861737_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_127446149.1|3861681_3862017_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3862138_3863263_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3863190_3863403_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3863399_3865502_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_001139679.1|3866666_3866819_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3866806_3867274_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3867270_3867768_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3867767_3867983_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3868125_3868524_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3868604_3868763_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3868848_3869592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3869775_3870465_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3870479_3870602_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3870939_3871899_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028857.1|3872110_3872776_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_001108055.1|3872772_3873393_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3873385_3873556_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3873552_3873735_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3874432_3875113_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3875109_3875292_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3875264_3875456_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3875466_3875748_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3875846_3876068_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3876278_3876881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3877123_3877291_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3877330_3877549_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3877822_3878593_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3878667:3878681	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 14
NZ_CP038300	Escherichia coli O157:H7 strain SS TX 754-1 chromosome, complete genome	5546758	4421759	4502315	5546758	integrase,protease,transposase,head,portal,holin,tail,lysis,capsid,terminase,plate	Shigella_phage(43.33%)	96	4458877:4458923	4498413:4498459
WP_000998048.1|4421759_4423298_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4423347_4423695_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4423691_4424072_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4424335_4424599_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4424598_4424739_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4424808_4425000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4425824_4426367_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4426441_4427029_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4427086_4427755_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4427780_4430306_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4430295_4431939_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_115449534.1|4431907_4432618_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4432930_4433260_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4433507_4434122_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4434539_4435229_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_115449533.1|4435225_4436182_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4436178_4438377_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4438386_4439343_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4439521_4440649_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4440790_4441849_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4442094_4442997_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4443699_4443978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4444144_4444867_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4444965_4445865_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4446540_4447497_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4447629_4449963_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4449976_4450300_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4450299_4450521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4450517_4451075_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4451071_4451332_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4452265_4453018_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4453014_4453566_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4453571_4453844_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4454253_4454820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4454819_4455410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4455440_4456073_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4456065_4456524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4456523_4457141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4457113_4457530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4457533_4458715_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
4458877:4458923	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000246059.1|4459677_4460421_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355484.1|4461245_4462019_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000905124.1|4462079_4462634_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_001145352.1|4462664_4463183_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.0	1.2e-55
WP_000368084.1|4463182_4463785_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_001008234.1|4463756_4464200_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_032195359.1|4464220_4464616_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.9	4.8e-65
WP_000383550.1|4464886_4465471_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000785302.1|4465461_4466520_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000424732.1|4466506_4466932_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259066.1|4466931_4467480_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000999513.1|4467479_4468559_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_000219910.1|4468555_4469884_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000807197.1|4469944_4471780_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000661054.1|4471921_4472191_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090993.1|4472190_4472547_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_000155728.1|4472546_4474043_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000497751.1|4474026_4474197_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779288.1|4474205_4474766_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000224836.1|4474762_4475269_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702395.1|4475243_4475654_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000924828.1|4475650_4475974_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000766100.1|4476052_4477282_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000999805.1|4477292_4477895_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000923141.1|4477887_4479114_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000838374.1|4479103_4479265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128484532.1|4479261_4480758_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000929175.1|4480991_4481486_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_162829202.1|4481888_4483101_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000738423.1|4483800_4484094_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4484184_4484367_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001197766.1|4484583_4485060_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120501.1|4485063_4485399_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001449601.1|4485535_4485829_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001310393.1|4486107_4486341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484664.1|4486484_4487024_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001008431.1|4487238_4487991_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_001360050.1|4488004_4488994_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061444.1|4489001_4489811_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|4489830_4490220_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210141.1|4490216_4490543_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_001303054.1|4490539_4491193_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_072141203.1|4491192_4491687_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_000104949.1|4491683_4492625_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_001250269.1|4492614_4492794_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|4492969_4493521_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|4493513_4493774_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|4493871_4494564_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000917896.1|4494841_4495138_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000008235.1|4495814_4496351_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_001242749.1|4496341_4496704_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|4496703_4497009_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|4497235_4498399_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893282.1|4498603_4499857_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4498413:4498459	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4499868_4500972_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4501259_4502315_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 15
NZ_CP038300	Escherichia coli O157:H7 strain SS TX 754-1 chromosome, complete genome	5546758	4934313	4946889	5546758	integrase	Enterobacteria_phage(81.82%)	15	4933347:4933362	4951842:4951857
4933347:4933362	attL	TTTCGATGAACAGCAC	NA	NA	NA	NA
WP_001301682.1|4934313_4935141_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
WP_044815386.1|4935358_4935553_-	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_000783684.1|4935908_4938242_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_000856729.1|4938256_4938577_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459287.1|4938712_4939168_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001244670.1|4939160_4939448_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000980224.1|4939440_4940031_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001149160.1|4940027_4940294_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283021.1|4940845_4941580_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_000638634.1|4941576_4942077_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446132.1|4942150_4942723_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000095622.1|4943048_4944293_+	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_001453880.1|4944330_4945065_-	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000936844.1|4945141_4945447_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000772662.1|4945614_4946889_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
4951842:4951857	attR	TTTCGATGAACAGCAC	NA	NA	NA	NA
>prophage 16
NZ_CP038300	Escherichia coli O157:H7 strain SS TX 754-1 chromosome, complete genome	5546758	4979309	5038337	5546758	protease,transposase	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|4979309_4980662_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4980755_4981307_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4981462_4982836_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4983011_4984010_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4984042_4985038_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4985024_4986047_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|4986060_4987563_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4987702_4988659_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4988968_4989499_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4989578_4989929_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4989922_4990174_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4990385_4990727_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|4990729_4994509_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4994505_4996239_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4996444_4997083_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4997405_4998749_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4998844_4999051_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175296.1|4999375_4999930_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|4999992_5000931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|5001142_5001883_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589488.1|5002072_5004016_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_001302935.1|5004133_5004514_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|5004602_5005463_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|5005570_5006536_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|5006643_5007306_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|5007350_5008763_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|5009071_5009692_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|5009909_5010548_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|5010682_5011891_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|5011898_5012330_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|5012952_5013747_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|5013817_5014267_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|5014308_5014536_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|5014540_5014855_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|5014861_5015257_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|5015583_5015859_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|5015987_5016674_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|5016673_5017528_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|5017537_5018188_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|5018201_5018666_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|5018675_5018981_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|5018996_5020394_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|5021920_5022676_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|5022672_5023422_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|5023603_5023933_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|5024081_5024357_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|5024473_5026099_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|5026182_5027346_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|5027348_5027987_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|5027996_5028395_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|5028412_5029072_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|5029122_5029821_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|5029839_5030241_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|5030367_5031099_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|5031279_5033721_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|5033759_5034185_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|5034389_5035688_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|5035791_5035989_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|5036070_5037075_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|5037077_5038337_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 17
NZ_CP038300	Escherichia coli O157:H7 strain SS TX 754-1 chromosome, complete genome	5546758	5175217	5189882	5546758	integrase,tail,tRNA	Enterobacteria_phage(43.75%)	19	5171058:5171073	5188587:5188602
5171058:5171073	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5175217_5176633_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5176715_5177699_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5177864_5178107_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5178240_5179278_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5179366_5180464_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5180525_5180774_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5180934_5181576_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5181657_5182287_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5182359_5182932_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5183043_5183313_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5183314_5184628_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5184692_5185292_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5186613_5187150_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5187140_5187491_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5187487_5187772_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5188107_5188305_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5188649_5188931_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5188587:5188602	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5188978_5189152_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5189348_5189882_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
