The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038302	Escherichia coli O157:H7 strain SS TX 313-1 chromosome, complete genome	5643409	1232521	1245958	5643409	tail,holin	Enterobacteria_phage(38.46%)	17	NA	NA
WP_001223948.1|1232521_1233133_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1233129_1233795_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1233791_1234415_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1234667_1235411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1235496_1235664_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_171877027.1|1236071_1237925_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.3	0.0e+00
WP_000284517.1|1238074_1238290_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1238294_1238639_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1238995_1239376_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1239372_1239720_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001023396.1|1240337_1240607_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1240767_1241190_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1241319_1242378_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1242456_1243107_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1243289_1243880_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1244381_1244630_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1245475_1245958_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP038302	Escherichia coli O157:H7 strain SS TX 313-1 chromosome, complete genome	5643409	1527305	1532731	5643409	integrase	Enterobacteria_phage(50.0%)	6	1516293:1516309	1534927:1534943
1516293:1516309	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1527305_1527875_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1527874_1528342_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1528328_1529009_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1529018_1530155_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1530329_1531487_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1531798_1532731_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1534927:1534943	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038302	Escherichia coli O157:H7 strain SS TX 313-1 chromosome, complete genome	5643409	1777012	1877964	5643409	protease,tail,terminase,portal,tRNA,holin	Enterobacteria_phage(50.0%)	108	NA	NA
WP_000569336.1|1777012_1777939_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1777943_1778675_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1778655_1778763_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1778822_1779524_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1779544_1780831_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1780864_1781119_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1781137_1781272_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1781275_1781518_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1781605_1781968_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1781964_1782321_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1782654_1782831_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1782832_1783780_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1783776_1783998_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1784096_1784378_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1784388_1784580_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_032195523.1|1784552_1784735_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	1.6e-28
WP_000186740.1|1784734_1785412_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1785408_1786194_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1786199_1786496_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1786571_1786862_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1787365_1788973_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|1789079_1789772_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182876.1|1790135_1790675_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000147884.1|1790671_1791691_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	9.7e-110
WP_000788906.1|1791687_1792389_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145928.1|1792385_1792670_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_001481254.1|1792897_1793095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|1793138_1793420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141214.1|1793510_1793612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053021.1|1793608_1794064_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224907.1|1794063_1794234_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1794226_1794517_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|1794513_1794876_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1794872_1795013_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1795098_1795533_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1795781_1795934_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1796737_1798684_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1798821_1799001_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1799041_1799287_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1799364_1799580_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1799584_1800118_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1800388_1800958_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1800957_1801104_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1801331_1801517_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1802034_1802511_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077626.1|1802507_1804631_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|1804627_1804840_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974568.1|1804839_1806342_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_001114421.1|1806286_1808311_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.7	0.0e+00
WP_001097065.1|1808398_1808725_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1808717_1808999_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1809001_1809625_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1809637_1810036_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_024748478.1|1810043_1810796_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	99.6	2.9e-135
WP_000479062.1|1810809_1811232_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000532073.1|1811258_1811567_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000847298.1|1814252_1814582_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151105.1|1814581_1815280_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|1815290_1816034_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_071601640.1|1815979_1816609_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_171877033.1|1816849_1820329_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.4	0.0e+00
WP_001230508.1|1820396_1820996_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_088136427.1|1821060_1822230_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_171877034.1|1822231_1822501_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	1.1e-44
WP_072142879.1|1822661_1823078_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1823159_1823801_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1823962_1824211_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1824725_1826411_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1826407_1827127_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1827173_1827644_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1827685_1828147_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001416817.1|1828271_1830275_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	99.9	0.0e+00
WP_001302810.1|1830271_1831408_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1831400_1832132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1832150_1833680_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1833690_1834779_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1836019_1836337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301615.1|1846985_1849019_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1849150_1850260_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1850521_1850803_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1851094_1851637_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677409.1|1851724_1852399_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945391.1|1852414_1854895_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1854905_1855940_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1856021_1856360_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134627.1|1856577_1857435_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1857555_1857828_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1857937_1858252_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1858261_1858609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1859659_1859899_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1860232_1861021_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1861017_1861818_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1861882_1862701_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1862752_1863499_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1863472_1864438_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1864434_1865439_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1865435_1866713_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1866969_1868022_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1868320_1869175_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1869203_1870466_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1870475_1870928_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1870958_1871243_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490697.1|1871246_1872602_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1872649_1873690_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1873789_1874569_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1874650_1875550_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1875955_1876273_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|1876602_1877964_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 4
NZ_CP038302	Escherichia coli O157:H7 strain SS TX 313-1 chromosome, complete genome	5643409	1963981	2105601	5643409	integrase,protease,tail,terminase,portal,capsid,head,lysis,holin,transposase	Stx2-converting_phage(41.13%)	161	1960599:1960613	2065821:2065835
1960599:1960613	attL	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_001007946.1|1963981_1965160_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|1965140_1965332_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|1965409_1965754_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|1965941_1966292_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001289930.1|1967158_1968106_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|1968102_1968324_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1968422_1968704_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548544.1|1968714_1968906_-	DUF1382 family protein	NA	B6ETA2	Enterobacteria_phage	100.0	3.3e-27
WP_000682306.1|1968878_1969061_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_171877035.1|1969057_1969726_-	YqaJ viral recombinase family protein	NA	A0A0P0ZBS3	Stx2-converting_phage	100.0	2.8e-129
WP_001302855.1|1969722_1970508_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000995486.1|1970513_1970810_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|1970884_1971028_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|1970996_1971161_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|1971233_1971602_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|1971784_1972036_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|1972094_1972367_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|1972344_1972527_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|1973095_1973617_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|1974118_1974814_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|1974888_1975104_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|1975245_1975542_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|1975574_1975736_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|1975722_1976544_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|1976540_1977917_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001220560.1|1977995_1978607_+	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_000344569.1|1979070_1979403_+	hypothetical protein	NA	A0A0P0ZCF4	Stx2-converting_phage	100.0	3.3e-59
WP_000103678.1|1979535_1979751_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|1979761_1979998_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|1979954_1980401_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|1980397_1980925_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|1980921_1981104_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208495.1|1981378_1982113_+	ORF6N domain-containing protein	NA	A0A0N7C203	Escherichia_phage	98.8	4.7e-122
WP_001004016.1|1982187_1982910_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|1982909_1983515_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|1983511_1984183_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|1984173_1984662_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|1985311_1986271_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|1986282_1986552_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|1986848_1987172_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_171877036.1|1987415_1989353_+	DUF1737 domain-containing protein	NA	A0A0P0ZBP4	Stx2-converting_phage	99.7	0.0e+00
WP_000143458.1|1989489_1989669_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1989709_1989982_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|1990058_1990274_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|1990273_1990771_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|1990767_1991205_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|1991407_1991905_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1991901_1992159_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|1992621_1992849_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|1992890_1993256_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958396.1|1993547_1994111_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_162829202.1|1994779_1995993_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000173024.1|1997145_1999083_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	99.7	0.0e+00
WP_001063023.1|1999127_1999349_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125990.1|2001875_2002202_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|2002211_2002562_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|2002558_2003005_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2003001_2003346_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2003404_2004121_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2004126_2004501_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2004596_2004806_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_015994262.1|2004857_2008100_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2008092_2008434_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179515.1|2008433_2009132_+|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	100.0	6.6e-134
WP_001302649.1|2009148_2009469_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2009576_2009750_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2009820_2010744_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|2010797_2011535_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_050546863.1|2011480_2012113_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000515107.1|2012372_2015852_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	100.0	0.0e+00
WP_001230314.1|2015918_2016518_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	100.0	1.8e-111
WP_000268993.1|2016582_2017896_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	100.0	2.8e-85
WP_001023452.1|2017897_2018167_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2018307_2019183_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2019407_2020058_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2021381_2022548_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2022666_2023140_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2023338_2024397_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2024568_2024898_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2024998_2025181_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2025669_2025783_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2025795_2025990_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2026448_2026817_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2026890_2027112_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2027174_2027651_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2027665_2028145_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2028226_2029048_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2029268_2029679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2029694_2030378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2030513_2031584_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2031580_2032486_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000638172.1|2032482_2033364_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829204.1|2033347_2034561_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000966626.1|2034932_2037080_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2038527_2040066_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2040115_2040463_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2040459_2040840_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|2041201_2041747_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2041743_2042487_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2042498_2043578_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2043639_2044575_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2045031_2045949_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2046050_2047001_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|2047118_2048762_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2049387_2050104_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2050446_2051901_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2052002_2053319_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2053632_2054685_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014714124.1|2054946_2062929_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2063418_2064216_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2064451_2065474_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2065473_2065677_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2065735_2068207_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
2065821:2065835	attR	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_000199485.1|2068302_2068491_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2068487_2068676_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2069156_2069309_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2069583_2070228_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2070325_2070553_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2070549_2070975_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2071043_2072081_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2071992_2072535_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2072569_2073268_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2073289_2073514_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2073510_2073867_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2073899_2074052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2074048_2074360_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2074486_2075050_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2075159_2075264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2075450_2075663_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2075830_2076109_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2076110_2077160_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2077172_2077532_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2077528_2078218_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000023257.1|2079757_2081608_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2081689_2082903_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2083213_2083429_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2083433_2083778_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2083828_2084362_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2084517_2084700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2084712_2084844_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2085071_2085257_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2085783_2086098_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2086179_2086404_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2086798_2087308_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2089192_2089399_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2089395_2090988_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2090977_2092483_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2092519_2092867_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2092924_2093191_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2093172_2093913_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2093926_2094358_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2094384_2094798_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_128484525.1|2094778_2097358_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000847298.1|2097354_2097684_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_024748502.1|2097683_2098382_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	7.6e-130
WP_001303043.1|2098392_2099136_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_129137391.1|2099081_2099714_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_171877069.1|2100915_2103429_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001230508.1|2103496_2104096_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_088136427.1|2104160_2105330_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001023396.1|2105331_2105601_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
>prophage 5
NZ_CP038302	Escherichia coli O157:H7 strain SS TX 313-1 chromosome, complete genome	5643409	2163180	2183166	5643409	integrase,tail,transposase	Enterobacteria_phage(75.0%)	28	2176302:2176315	2186308:2186321
WP_032161583.1|2163180_2164317_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|2164267_2164591_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2164748_2165933_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2165932_2166445_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2166499_2166865_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2166873_2167029_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2169831_2170320_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2170476_2171049_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2171092_2171623_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2172714_2173029_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2173033_2173993_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2174069_2176892_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2176302:2176315	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2176898_2177264_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2177260_2177878_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2177889_2178189_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2178185_2178452_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2178448_2178652_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2178675_2179092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2179184_2179298_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2179294_2179537_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2179548_2179827_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2179837_2180188_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2180209_2180413_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2180484_2180622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2180711_2181116_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2181131_2181782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2181811_2182159_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001303019.1|2182164_2183166_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
2186308:2186321	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 6
NZ_CP038302	Escherichia coli O157:H7 strain SS TX 313-1 chromosome, complete genome	5643409	2429998	2499386	5643409	protease,tail,head,tRNA,plate,transposase	Shigella_phage(47.83%)	85	NA	NA
WP_000077537.1|2429998_2430529_-	hypothetical protein	NA	A0A2D1GNR8	Pseudomonas_phage	62.4	3.7e-36
WP_001310454.1|2430719_2430968_+	helix-turn-helix domain-containing protein	NA	A0A2D1GNH1	Pseudomonas_phage	73.2	1.3e-28
WP_000289290.1|2430969_2433060_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	45.4	8.8e-166
WP_000129790.1|2433130_2434063_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.3	1.2e-69
WP_000268103.1|2434065_2434287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|2434299_2434554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|2434555_2434837_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|2434833_2435106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049304.1|2435110_2435404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|2435415_2435946_+	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_000323222.1|2436043_2436586_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	40.0	4.9e-28
WP_000564283.1|2436589_2437123_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	1.1e-67
WP_000465563.1|2437122_2437638_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	53.0	2.7e-44
WP_000977060.1|2437641_2438193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000621195.1|2438189_2438375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000021235.1|2438413_2438746_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086887.1|2438738_2438936_+	hypothetical protein	NA	A0A291AXE7	Shigella_phage	34.5	1.2e-05
WP_000370523.1|2438925_2439222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214362.1|2439218_2439728_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	42.4	6.7e-27
WP_000852377.1|2439797_2440223_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|2440294_2440795_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|2440829_2441258_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122256.1|2441241_2441460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342746.1|2441469_2441697_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|2441677_2441986_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279084.1|2441982_2442273_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	62.1	1.0e-24
WP_000360581.1|2442275_2442857_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	57.0	1.9e-49
WP_001057672.1|2442856_2444521_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
WP_000532593.1|2444520_2446110_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.9	1.9e-168
WP_000046893.1|2446093_2447419_+|head	phage head morphogenesis protein	head	A0A0C4UQY9	Shigella_phage	59.7	6.4e-154
WP_000094804.1|2447537_2448011_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	5.1e-37
WP_000850811.1|2448187_2449312_+|protease	protease	protease	A0A0C4UQU6	Shigella_phage	47.6	2.2e-78
WP_001142982.1|2449311_2450259_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	67.2	1.2e-122
WP_001691380.1|2450302_2450695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|2450691_2451111_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|2451107_2451668_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|2451668_2451914_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|2451910_2453413_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015473.1|2453421_2453787_+|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	2.0e-25
WP_000213225.1|2453801_2454278_+|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_000113525.1|2454404_2456480_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.7	2.1e-71
WP_000146116.1|2456466_2457816_+	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	7.7e-54
WP_000098807.1|2457799_2458924_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980532.1|2458913_2459528_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	4.7e-51
WP_000763330.1|2459520_2459958_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|2459957_2461040_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301577.1|2461030_2461591_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	48.1	2.3e-44
WP_000469162.1|2461590_2462502_+|tail	tail fiber protein	tail	C9DGQ8	Escherichia_phage	47.5	2.9e-36
WP_000420351.1|2462536_2463058_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	2.1e-47
WP_010917875.1|2463137_2463341_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|2463563_2464124_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_010917876.1|2464223_2466263_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.4	4.3e-274
WP_000144787.1|2466409_2466592_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114104.1|2466627_2466873_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_115801860.1|2466911_2467376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310452.1|2467490_2467691_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000528251.1|2467644_2468382_+	protein mom	NA	A0A0C4UQZ7	Shigella_phage	79.0	1.7e-103
WP_000534283.1|2469222_2470479_+	AIDA repeat-containing protein	NA	NA	NA	NA	NA
WP_001174945.1|2470519_2471893_-	multidrug efflux MATE transporter MdtK	NA	NA	NA	NA	NA
WP_000493947.1|2472107_2472749_+	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
WP_000098902.1|2472788_2473937_-	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	7.2e-85
WP_001182346.1|2474227_2475439_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000269501.1|2475551_2476484_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000190982.1|2476480_2477506_-	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000102278.1|2477804_2477894_+	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000701046.1|2478059_2479229_+	MFS transporter	NA	NA	NA	NA	NA
WP_000007283.1|2479374_2479956_-	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000101201.1|2480083_2480899_-	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000108172.1|2481233_2481581_+	monothiol glutaredoxin 4	NA	NA	NA	NA	NA
WP_001302074.1|2481631_2486248_-	ATP-dependent helicase	NA	NA	NA	NA	NA
WP_001282281.1|2486340_2486988_-	ribonuclease T	NA	NA	NA	NA	NA
WP_001237796.1|2487090_2487498_-	lactoylglutathione lyase	NA	NA	NA	NA	NA
WP_000093602.1|2487578_2488676_-	N-ethylmaleimide reductase	NA	NA	NA	NA	NA
WP_001032947.1|2488712_2489312_-	DNA-binding transcriptional regulator NemR	NA	NA	NA	NA	NA
WP_000840481.1|2489414_2489654_+	DUF1289 domain-containing protein	NA	NA	NA	NA	NA
WP_001296937.1|2490679_2491201_+	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000994327.1|2491201_2493214_-	FUSC family protein	NA	NA	NA	NA	NA
WP_001302065.1|2493213_2494071_-	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_000670998.1|2494073_2494310_-	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_001296943.1|2494510_2494945_+	transcriptional regulator SlyA	NA	NA	NA	NA	NA
WP_000597196.1|2494991_2495459_-	outer membrane lipoprotein SlyB	NA	NA	NA	NA	NA
WP_000835042.1|2495731_2496841_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_000178045.1|2496938_2497268_+	C-type lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001282321.1|2497326_2497983_+	pyridoxamine 5'-phosphate oxidase	NA	NA	NA	NA	NA
WP_001295400.1|2498111_2499386_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 7
NZ_CP038302	Escherichia coli O157:H7 strain SS TX 313-1 chromosome, complete genome	5643409	2542478	2683017	5643409	integrase,protease,tail,terminase,portal,capsid,head,holin,transposase	Stx2-converting_phage(37.14%)	151	2571169:2571190	2629271:2629292
WP_001260835.1|2542478_2543300_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2543399_2543483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2543575_2543911_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2544307_2545561_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2545667_2546561_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2546695_2547916_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2548040_2548736_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2548688_2549981_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2550138_2550753_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2550795_2551650_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2551651_2552269_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_171877070.1|2552279_2554703_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	9.8e-209
WP_000041704.1|2554763_2557190_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2557388_2557694_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2557801_2558512_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2558514_2559075_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2559109_2559451_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2559585_2559912_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2560900_2561152_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2561224_2563696_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2563788_2563980_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2563976_2564165_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2564565_2564730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2564733_2564952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2565023_2565323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2565675_2565954_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2565955_2566147_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2566167_2566539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2566636_2566939_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2566935_2567361_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095670.1|2567383_2568346_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
WP_000788936.1|2568352_2569093_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_001118159.1|2569903_2570299_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2570355_2570940_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2571055_2571160_+	hypothetical protein	NA	NA	NA	NA	NA
2571169:2571190	attL	CGATATGGGAATTCCCATATCG	NA	NA	NA	NA
WP_000887477.1|2571348_2571561_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2571728_2572007_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2572008_2573058_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_069556580.1|2573070_2573430_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	8.6e-37
WP_001059381.1|2573426_2574116_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001302123.1|2574745_2575177_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_171877037.1|2575655_2577365_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_162829202.1|2577367_2578581_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024180155.1|2579258_2579474_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2579478_2579823_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2579873_2580407_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2580677_2581247_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2581246_2581393_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2581620_2581806_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2582230_2582458_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|2582499_2582865_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_001303051.1|2583154_2583718_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_171877038.1|2583714_2585376_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.6	0.0e+00
WP_000172999.1|2585439_2587377_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2587421_2587643_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_115456303.1|2587588_2589928_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	92.6	0.0e+00
WP_000126019.1|2590007_2590334_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2590343_2590694_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2590690_2591137_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2591133_2591478_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2591536_2592253_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2592258_2592633_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2592728_2592938_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2592990_2596233_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2596225_2596567_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303038.1|2596566_2597265_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_046671488.1|2597275_2598019_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_050439450.1|2597964_2598597_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|2598939_2600115_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_129137390.1|2600066_2602412_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001228304.1|2602479_2603079_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_024748516.1|2603230_2604544_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	7.2e-81
WP_001023474.1|2604545_2604815_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|2605841_2607167_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_171877030.1|2609831_2611370_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|2611419_2611767_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2611763_2612144_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2612483_2612762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2613189_2613336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2613472_2614120_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2614303_2614894_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|2616400_2617051_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001500821.1|2618350_2619481_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	50.9	4.9e-102
WP_000113189.1|2619458_2619707_-	excisionase	NA	NA	NA	NA	NA
WP_087682689.1|2619771_2622216_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
WP_000092782.1|2622308_2622497_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|2622493_2622682_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000380314.1|2623169_2623322_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000367559.1|2623491_2623881_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024213789.1|2623983_2624259_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000693888.1|2624242_2624668_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095667.1|2624690_2625644_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000790456.1|2625650_2626391_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_000450888.1|2626420_2627191_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
WP_001118161.1|2627206_2627602_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_001302146.1|2627658_2628015_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_000063625.1|2628063_2628276_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000137941.1|2628311_2628683_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000610379.1|2628679_2629042_+	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_001278450.1|2629157_2629262_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2629450_2629663_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
2629271:2629292	attR	CGATATGGGAATTCCCATATCG	NA	NA	NA	NA
WP_000998188.1|2629959_2630127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304183.1|2630192_2630471_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000904137.1|2631534_2631909_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762904.1|2631905_2632727_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
WP_000917735.1|2632953_2633151_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483497.1|2633301_2634360_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_171877039.1|2634851_2636702_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	99.0	0.0e+00
WP_024164617.1|2637140_2637356_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075112.1|2637355_2637853_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_001208680.1|2638069_2638255_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|2638782_2639097_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|2639178_2639403_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303046.1|2639444_2639810_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958387.1|2640098_2640662_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2640658_2642320_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|2642383_2644321_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2644365_2644587_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_115456303.1|2644532_2646872_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	92.6	0.0e+00
WP_000126019.1|2646951_2647278_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2647287_2647638_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2647634_2648081_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2648077_2648422_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2648480_2649197_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2649202_2649577_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2649672_2649882_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2649934_2653177_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2653169_2653511_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303038.1|2653510_2654209_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_001303043.1|2654219_2654963_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_129137391.1|2654908_2655541_+|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_171877040.1|2655787_2659267_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	96.0	0.0e+00
WP_001230495.1|2659333_2659933_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	98.0	3.7e-109
WP_171877041.1|2659997_2661311_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001023426.1|2661312_2661582_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	1.6e-43
WP_001079499.1|2667666_2668173_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|2668218_2668719_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2668804_2668984_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2669364_2670171_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2670170_2671364_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983855.1|2671375_2672737_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	7.3e-36
WP_000763503.1|2672737_2674333_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194607.1|2674332_2675895_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2675986_2676031_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2676168_2677050_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2677046_2677667_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|2677694_2679278_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2679490_2680363_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2680402_2680993_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2680989_2681748_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2681967_2683017_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 8
NZ_CP038302	Escherichia coli O157:H7 strain SS TX 313-1 chromosome, complete genome	5643409	2764810	2826589	5643409	integrase,protease,tail,terminase,portal,tRNA,holin	Escherichia_phage(38.71%)	76	2770147:2770172	2825930:2825955
WP_000628061.1|2764810_2766043_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2766297_2767281_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001625136.1|2767555_2767726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123746.1|2767758_2769132_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001157382.1|2769260_2770196_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	5.4e-147
2770147:2770172	attL	TTGTTCAGGTTGTATTGTTCTTTCTT	NA	NA	NA	NA
WP_000040845.1|2770247_2771483_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.3	1.1e-237
WP_000079604.1|2771484_2771700_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001356607.1|2771799_2771988_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_042853000.1|2771980_2772175_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_000166315.1|2772231_2773041_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_000102194.1|2773033_2775703_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	61.3	4.2e-205
WP_000245534.1|2775783_2775960_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.7	4.1e-24
WP_000560226.1|2775953_2776175_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_000887681.1|2776221_2777070_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
WP_000379547.1|2777481_2777634_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000410105.1|2777940_2778360_-	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_001033914.1|2778456_2778699_+	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000702017.1|2778695_2779118_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	5.9e-69
WP_001356605.1|2779195_2779984_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	5.1e-42
WP_000788984.1|2779990_2780737_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	4.8e-114
WP_000450718.1|2780759_2781521_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	1.0e-116
WP_001151116.1|2781536_2781959_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.8e-63
WP_000014164.1|2781955_2782186_+	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	76.8	4.1e-16
WP_001138877.1|2782340_2782991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000418464.1|2782977_2784099_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000902698.1|2784221_2784434_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.2e-17
WP_000940305.1|2784993_2785593_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	1.0e-106
WP_000228017.1|2785592_2785883_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	8.2e-46
WP_000640110.1|2785879_2786422_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.3	3.9e-73
WP_000142932.1|2787122_2789069_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|2789205_2789385_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|2789425_2789671_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_001072899.1|2789748_2789964_+|holin	class II holin family protein	holin	A0A0P0ZFW5	Escherichia_phage	100.0	9.0e-34
WP_000087728.1|2789968_2790502_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|2790772_2791342_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539794.1|2791341_2791488_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	95.8	1.7e-15
WP_012816791.1|2791715_2791901_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|2792112_2792385_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|2792417_2792894_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077621.1|2792890_2793898_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	1.8e-201
WP_000114064.1|2794059_2795298_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	35.1	6.6e-60
WP_000229066.1|2795290_2795515_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038670.1|2795574_2796156_+	hypothetical protein	NA	A0A1W6JPH8	Morganella_phage	61.3	1.5e-51
WP_088136225.1|2796136_2796856_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000335965.1|2796848_2797073_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551748.1|2797065_2797659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551487.1|2797651_2797852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000728901.1|2797856_2798099_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000761774.1|2798095_2799910_+	DNA primase	NA	Q7M2A8	Enterobacteria_phage	49.9	5.7e-129
WP_001399692.1|2800197_2800443_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126660.1|2800439_2800862_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000860403.1|2801519_2803409_+|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	51.5	9.4e-183
WP_000133409.1|2803666_2803948_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000102415.1|2805440_2805653_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974564.1|2805652_2807155_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|2807099_2809124_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|2809211_2809538_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|2809530_2809812_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|2809814_2810438_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|2810450_2810849_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|2810856_2811609_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|2811622_2812045_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000532073.1|2812071_2812380_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_046671471.1|2812423_2815069_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.7	0.0e+00
WP_000847298.1|2815065_2815395_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_171877044.1|2815394_2816093_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_001303043.1|2816103_2816847_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_123007081.1|2816792_2817422_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	3.9e-101
WP_000514990.1|2817662_2821136_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_001228289.1|2821203_2821803_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000279065.1|2821867_2823190_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q687E6	Enterobacteria_phage	98.6	2.0e-75
WP_001023406.1|2823191_2823461_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_001131659.1|2823573_2824149_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001443810.1|2824221_2824851_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|2824932_2825574_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|2826154_2826589_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
2825930:2825955	attR	TTGTTCAGGTTGTATTGTTCTTTCTT	NA	NA	NA	NA
>prophage 9
NZ_CP038302	Escherichia coli O157:H7 strain SS TX 313-1 chromosome, complete genome	5643409	3006448	3108468	5643409	integrase,tail,terminase,portal,capsid,head,holin,transposase	Escherichia_phage(30.56%)	127	3049719:3049732	3109347:3109360
WP_000214712.1|3006448_3006652_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|3006687_3008148_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|3008236_3009520_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001120551.1|3009651_3009894_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|3010055_3010697_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|3010778_3011408_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|3011480_3012056_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|3012169_3012439_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_024748460.1|3012440_3013754_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
WP_001230508.1|3013818_3014418_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_171877069.1|3014485_3016999_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_129137391.1|3018200_3018833_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_001303043.1|3018778_3019522_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_001303044.1|3019532_3020231_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|3020230_3020560_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000533440.1|3023150_3023564_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|3023590_3024013_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|3024026_3024779_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|3024786_3025182_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|3025178_3025712_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|3025726_3026080_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|3026091_3026490_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3026531_3027557_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3027612_3027945_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3027954_3029274_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3029254_3030856_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3030852_3031059_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|3031055_3032981_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|3032955_3033501_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|3033887_3034112_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|3034193_3034508_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3035033_3035219_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|3035441_3035588_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|3035587_3036157_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3036427_3036961_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3037011_3037356_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024180155.1|3037360_3037576_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_171877047.1|3038013_3039864_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_001302123.1|3040341_3040773_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|3041223_3041937_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|3042072_3042270_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|3042494_3043049_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|3043111_3043417_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|3043429_3044479_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|3044480_3044753_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|3044874_3045219_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|3045338_3045551_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|3045784_3046342_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|3046343_3046562_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|3046689_3047001_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|3046993_3047221_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|3047217_3047499_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|3047531_3048248_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|3048281_3048743_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|3048735_3049779_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
3049719:3049732	attL	TCGTTCGCCACTTG	NA	NA	NA	NA
WP_000693878.1|3049847_3050273_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|3050256_3050499_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|3050890_3051229_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|3051521_3051674_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|3051685_3052324_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|3052324_3052534_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|3053098_3053287_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|3053283_3053472_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|3053564_3054809_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|3055519_3055762_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|3056724_3057105_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3057101_3057449_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3058722_3059103_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3059099_3059447_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_171877030.1|3059496_3061035_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000838195.1|3061106_3061487_+|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	9.0e-69
WP_001121225.1|3062069_3062720_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001131642.1|3063429_3064005_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001023362.1|3064118_3064388_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_000268860.1|3064389_3065613_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|3065677_3066277_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_001304111.1|3066344_3066560_-	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_012779365.1|3066562_3069823_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.3	0.0e+00
WP_162829348.1|3069988_3071201_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_024748472.1|3071323_3071761_-|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	100.0	5.0e-63
WP_000807954.1|3071760_3072102_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_171877048.1|3072094_3075337_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.3	0.0e+00
WP_001453698.1|3075389_3075599_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3075694_3076069_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3076074_3076791_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|3076849_3077194_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3077190_3077637_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3077633_3077984_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3077993_3078320_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3078399_3080901_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3080846_3081068_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3081112_3083050_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3083113_3084775_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|3084771_3085335_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_015994246.1|3085624_3085990_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|3086031_3086259_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3086683_3086869_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3087096_3087243_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3087242_3087812_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000731241.1|3088666_3089011_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284517.1|3089015_3089231_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|3089380_3091234_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000917750.1|3093239_3093437_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3093678_3094209_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3094217_3094577_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3094589_3095636_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|3095637_3095916_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3095985_3096243_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|3096463_3096676_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3096954_3097713_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3098411_3098576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3098572_3099154_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|3099340_3099883_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3099794_3100835_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3100806_3101358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3101341_3101569_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3101645_3102053_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3102316_3102616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3102688_3102907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3102929_3103337_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3103314_3103548_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3103541_3103709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3104106_3104295_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3104291_3104483_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048549.1|3104575_3107047_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
WP_000113189.1|3107111_3107360_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3107337_3108468_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
3109347:3109360	attR	TCGTTCGCCACTTG	NA	NA	NA	NA
>prophage 10
NZ_CP038302	Escherichia coli O157:H7 strain SS TX 313-1 chromosome, complete genome	5643409	3155164	3248856	5643409	integrase,protease,tail,terminase,portal,capsid,head,lysis,tRNA,holin,transposase	Enterobacteria_phage(49.06%)	100	3178362:3178377	3242759:3242774
WP_001299679.1|3155164_3156421_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3156634_3157258_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3157257_3158109_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3158259_3159207_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3159331_3161011_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3161065_3161344_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3161621_3162206_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3162322_3163414_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|3164257_3167143_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|3167242_3169162_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_001295616.1|3169868_3170480_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3170579_3171494_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3171589_3173326_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_162829348.1|3173483_3174697_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000197859.1|3175034_3176105_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3176114_3177413_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3177775_3179308_+	SpoVR family protein	NA	NA	NA	NA	NA
3178362:3178377	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3179359_3180079_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3180300_3181842_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3181987_3182518_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3182563_3183832_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3183831_3184251_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3184623_3185535_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3185741_3186203_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3186279_3186939_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3187010_3187304_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3187315_3187474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3187544_3187946_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3188048_3188417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3188936_3189632_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3189655_3190468_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3190471_3190738_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3191969_3192554_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3193052_3194006_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3194192_3195677_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3195979_3197518_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3197567_3197915_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3197911_3198292_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3198367_3198616_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3198672_3199341_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3199838_3200021_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3200099_3200600_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3200636_3201143_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3201161_3202052_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_097223427.1|3202171_3202753_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	5.2e-100
WP_000279120.1|3202752_3205668_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3205732_3206332_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3206398_3209797_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3209857_3210490_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3210426_3211170_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3211175_3211874_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3211873_3212203_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3212199_3214749_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3214741_3215176_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3215157_3215580_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3215595_3216336_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3216343_3216739_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3216735_3217314_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3217325_3217679_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3217690_3218089_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3218130_3219156_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3219210_3219543_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3219552_3220872_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3220852_3222454_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3222450_3222657_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3222653_3224579_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3224553_3225099_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3225487_3225682_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3225846_3226053_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3226338_3226749_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3227040_3227334_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3227424_3227607_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3227823_3228300_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3228286_3228592_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3228913_3229603_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3229599_3229740_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3229736_3230099_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3230095_3230386_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3230378_3230549_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3230548_3231004_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3231505_3233032_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3233089_3233212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3233276_3233609_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3233676_3233979_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3233975_3234677_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088657.1|3235601_3235838_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3235827_3236970_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3237083_3238334_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3238505_3239159_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3239168_3239630_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3239683_3240790_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3240825_3241467_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3241470_3242841_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3242759:3242774	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3243009_3243681_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3243680_3245141_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3245741_3246023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3246278_3246821_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3247026_3247440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3247452_3247788_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3247800_3248856_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 11
NZ_CP038302	Escherichia coli O157:H7 strain SS TX 313-1 chromosome, complete genome	5643409	3254948	3312299	5643409	integrase,tail,terminase,portal,capsid,head,holin	Stx2-converting_phage(27.27%)	70	3297856:3297876	3318956:3318976
WP_000085256.1|3254948_3256178_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3256426_3257548_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3257596_3258823_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3259072_3260209_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3260192_3261056_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3261419_3262781_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3262841_3263117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3265425_3268827_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3269417_3271766_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3271785_3271875_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3271887_3272124_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3272069_3272807_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3272860_3273739_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3274041_3274152_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3274261_3274516_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3274532_3275231_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807954.1|3275230_3275572_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212827.1|3275564_3278807_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_001453746.1|3278854_3279064_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3279159_3279534_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3279548_3280265_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3280323_3280668_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3280664_3281111_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3281107_3281458_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3281467_3281794_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3281873_3284375_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3284320_3284542_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3284586_3286524_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3286587_3288249_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|3288245_3288809_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|3289100_3289466_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001302977.1|3289507_3289693_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3289822_3289963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3290319_3290544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3290608_3290815_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3291042_3291189_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3291188_3291758_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3292028_3292562_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3292612_3292957_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3292961_3293177_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3293252_3293522_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3293559_3293742_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023147.1|3293889_3295827_-	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	76.6	4.8e-291
WP_000216629.1|3296141_3296309_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3296905_3297727_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3297723_3298098_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3297856:3297876	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265159.1|3298110_3299160_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001341388.1|3299161_3299440_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3299607_3299820_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3300008_3300113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3300228_3300816_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3300818_3301010_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3301011_3301449_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3301435_3301753_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3301706_3302024_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3302013_3302316_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3302312_3302594_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3302626_3303343_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3303376_3303919_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_000693962.1|3304946_3305372_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3305355_3305679_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3305803_3306280_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3306595_3306748_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3306862_3307378_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3307510_3307900_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3307961_3308231_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3308199_3309318_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3309484_3310279_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_171877049.1|3310275_3311322_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3311477_3312299_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3318956:3318976	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 12
NZ_CP038302	Escherichia coli O157:H7 strain SS TX 313-1 chromosome, complete genome	5643409	3563279	3618524	5643409	integrase,protease,tail,terminase,portal,capsid,head,holin,transposase	Escherichia_phage(27.27%)	63	3565214:3565229	3620289:3620304
WP_000003653.1|3563279_3563867_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3563863_3564571_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3564589_3566383_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3565214:3565229	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3566379_3567498_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023407.1|3569490_3569760_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_171877053.1|3569761_3570976_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	91.8	3.5e-82
WP_001230444.1|3571040_3571640_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515109.1|3571707_3575181_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_000649827.1|3575314_3575842_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_050546863.1|3576032_3576665_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3576610_3577354_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001302968.1|3577364_3578063_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000847298.1|3578062_3578392_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082473.1|3578388_3580968_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|3580948_3581362_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3581388_3581820_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3581833_3582574_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3582555_3582822_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3582879_3583227_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3583263_3584769_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3584758_3586351_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3586347_3586554_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3586537_3588466_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_171877030.1|3588729_3590268_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|3590317_3590665_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3590661_3591042_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3591117_3591393_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3592143_3592350_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3592605_3592878_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3593037_3593571_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3593791_3593905_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3594126_3594312_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3594839_3595154_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3595358_3596572_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|3596747_3598598_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3599364_3600078_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3600698_3601517_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3601668_3602040_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3602029_3602401_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_171877054.1|3602413_3603463_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	9.1e-111
WP_001341388.1|3603464_3603743_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3603910_3604066_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3604167_3604305_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3604670_3605444_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3605795_3606209_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3606224_3606995_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3607016_3607763_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3607769_3608861_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3608939_3609395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3609601_3610027_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3610010_3610283_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3610391_3610793_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3610820_3611012_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3611011_3611299_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3611576_3611732_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3611873_3612263_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3612449_3612635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3613208_3613397_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3613393_3613585_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3613678_3616150_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3616217_3616460_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3616437_3617457_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3617864_3618524_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3620289:3620304	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 13
NZ_CP038302	Escherichia coli O157:H7 strain SS TX 313-1 chromosome, complete genome	5643409	3741287	3812743	5643409	integrase,protease,terminase,capsid,transposase	Moraxella_phage(16.67%)	66	3747074:3747089	3827020:3827035
WP_000998072.1|3741287_3742826_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	2.7e-297
WP_000333617.1|3743331_3743559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000885242.1|3743593_3744097_-	CdiI family contact-dependent growth inhibition immunity protein	NA	NA	NA	NA	NA
WP_000017595.1|3745264_3745786_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000767171.1|3746049_3746325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410312.1|3746293_3746902_-	hypothetical protein	NA	NA	NA	NA	NA
3747074:3747089	attL	CTCAATGGCTTTATCC	NA	NA	NA	NA
WP_000792318.1|3747132_3747387_-	hypothetical protein	NA	NA	NA	NA	NA
3747074:3747089	attL	CTCAATGGCTTTATCC	NA	NA	NA	NA
WP_001043260.1|3749249_3750065_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|3750151_3750454_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|3750347_3750599_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000480968.1|3750837_3751674_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|3751673_3752477_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001303007.1|3752762_3753971_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.5	1.5e-234
WP_000599533.1|3754336_3755542_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|3755985_3756306_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460649.1|3756298_3756685_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|3756692_3757379_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|3757356_3757980_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089072.1|3758061_3759267_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000428546.1|3759379_3759973_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001303003.1|3760486_3761695_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.8	2.0e-234
WP_000015617.1|3761798_3761936_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000765181.1|3761974_3762205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000266539.1|3762201_3762690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000990243.1|3762921_3763377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303001.1|3763381_3763891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000877779.1|3763913_3764171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000118523.1|3765548_3765812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001258566.1|3765808_3766663_-	VENN motif pre-toxin domain-containing protein	NA	NA	NA	NA	NA
WP_000832132.1|3766732_3767146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912479.1|3767155_3767605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003689.1|3767787_3768165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001477171.1|3768216_3768870_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_001449592.1|3769379_3769823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310368.1|3770235_3771093_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001449593.1|3771089_3771290_-	VENN motif pre-toxin domain-containing protein	NA	NA	NA	NA	NA
WP_000779468.1|3771522_3772062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171877056.1|3772061_3781691_-	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	33.8	3.2e-29
WP_001200020.1|3781703_3783470_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.5	6.0e-22
WP_000090034.1|3783930_3784860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081278.1|3784849_3785590_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000273844.1|3786996_3789417_+	NTPase	NA	NA	NA	NA	NA
WP_000282071.1|3789721_3790285_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335694.1|3791259_3792693_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|3792911_3793109_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_014639577.1|3793335_3793632_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000271854.1|3794744_3796562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279872.1|3796749_3797952_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_000934041.1|3798471_3800748_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
3799345:3799360	attR	CTCAATGGCTTTATCC	NA	NA	NA	NA
WP_000520781.1|3800778_3801099_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
3799345:3799360	attR	CTCAATGGCTTTATCC	NA	NA	NA	NA
WP_000562896.1|3802077_3803001_-|capsid	phage major capsid protein	capsid	A0A0R6PHC6	Moraxella_phage	24.1	3.4e-13
WP_000006076.1|3802990_3803152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001229493.1|3803163_3803652_-|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	42.3	3.5e-25
WP_001018605.1|3803781_3803943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000391152.1|3803946_3804141_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000164427.1|3804271_3804517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021501101.1|3804867_3806616_-	phage/plasmid primase P4 family C-terminal domain protein	NA	Q7M2A8	Enterobacteria_phage	39.6	2.5e-89
WP_000770151.1|3806612_3806912_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000659213.1|3807149_3807341_-	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	52.8	2.2e-07
WP_000920689.1|3807340_3807526_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000931911.1|3807518_3807722_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000190549.1|3807921_3808101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001443418.1|3808236_3808446_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.1	1.8e-15
WP_032362418.1|3808856_3810095_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	52.7	1.3e-124
WP_000410785.1|3810499_3810724_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000188174.1|3810796_3812743_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
3827020:3827035	attR	ACACTGCGCAGCATCG	NA	NA	NA	NA
>prophage 14
NZ_CP038302	Escherichia coli O157:H7 strain SS TX 313-1 chromosome, complete genome	5643409	3934863	3972958	5643409	integrase,protease,tail,portal,lysis,holin	Enterobacteria_phage(52.5%)	47	3934448:3934462	3973032:3973046
3934448:3934462	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3934863_3935562_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3935792_3936674_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3936842_3937004_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3937500_3938520_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3938553_3939534_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3939710_3939980_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3939981_3941298_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3941357_3941957_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000090841.1|3945501_3946110_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3946046_3946790_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3946795_3947494_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3947503_3947833_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3947832_3950898_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3950869_3951199_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3951207_3951594_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3951654_3952398_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3952408_3952810_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3952806_3953385_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3953396_3953672_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3953664_3953988_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136598.1|3954074_3956102_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_127446149.1|3956046_3956382_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3956503_3957628_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3957555_3957768_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001139679.1|3961031_3961184_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3961171_3961639_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3961635_3962133_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3962132_3962348_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3962490_3962889_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3962969_3963128_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3963213_3963957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3964140_3964830_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3964844_3964967_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3965304_3966264_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028857.1|3966475_3967141_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_001108055.1|3967137_3967758_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3967750_3967921_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3967917_3968100_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3968797_3969478_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3969474_3969657_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3969629_3969821_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3969831_3970113_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3970211_3970433_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3970643_3971246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3971488_3971656_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3971695_3971914_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3972187_3972958_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3973032:3973046	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 15
NZ_CP038302	Escherichia coli O157:H7 strain SS TX 313-1 chromosome, complete genome	5643409	4516124	4596681	5643409	integrase,protease,tail,holin,terminase,capsid,head,lysis,plate,transposase	Shigella_phage(42.37%)	95	4553242:4553288	4592779:4592825
WP_171877030.1|4516124_4517663_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|4517712_4518060_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4518056_4518437_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4518700_4518964_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4518963_4519104_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4519173_4519365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4520189_4520732_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4520806_4521394_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4521451_4522120_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4522145_4524671_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4524660_4526304_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4526272_4526983_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4527295_4527625_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4527872_4528487_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4528904_4529594_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4529590_4530547_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4530543_4532742_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4532751_4533708_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4533886_4535014_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4535155_4536214_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4536459_4537362_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4538064_4538343_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4538509_4539232_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4539330_4540230_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4540905_4541862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4541994_4544328_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4544341_4544665_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4544664_4544886_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4544882_4545440_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4545436_4545697_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4546630_4547383_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4547379_4547931_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4547936_4548209_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4548618_4549185_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4549184_4549775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4549805_4550438_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4550430_4550889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4550888_4551506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4551478_4551895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4551898_4553080_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
4553242:4553288	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000246059.1|4554042_4554786_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355484.1|4555610_4556384_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000905124.1|4556444_4556999_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_001145352.1|4557029_4557548_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	62.0	1.2e-55
WP_000368084.1|4557547_4558150_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_001008234.1|4558121_4558565_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_032195359.1|4558585_4558981_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.9	4.8e-65
WP_000383550.1|4559251_4559836_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000785302.1|4559826_4560885_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000424732.1|4560871_4561297_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259066.1|4561296_4561845_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000999513.1|4561844_4562924_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_000219910.1|4562920_4564249_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000807197.1|4564309_4566145_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000661054.1|4566286_4566556_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090993.1|4566555_4566912_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_000155728.1|4566911_4568408_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.8	1.1e-271
WP_000497751.1|4568391_4568562_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779288.1|4568570_4569131_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000224836.1|4569127_4569634_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702395.1|4569608_4570019_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000924828.1|4570015_4570339_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000766100.1|4570417_4571647_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000999805.1|4571657_4572260_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_162829202.1|4572471_4573684_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000838374.1|4574781_4574943_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128484532.1|4574939_4576436_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000929175.1|4576669_4577164_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_000738423.1|4578166_4578460_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4578550_4578733_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001197766.1|4578949_4579426_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120501.1|4579429_4579765_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001449601.1|4579901_4580195_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001310393.1|4580473_4580707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484663.1|4580850_4581390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001008431.1|4581604_4582357_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_001360050.1|4582370_4583360_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061444.1|4583367_4584177_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|4584196_4584586_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210141.1|4584582_4584909_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_001303054.1|4584905_4585559_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_072141203.1|4585558_4586053_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_000104949.1|4586049_4586991_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_001250269.1|4586980_4587160_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|4587335_4587887_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|4587879_4588140_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|4588237_4588930_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000917896.1|4589207_4589504_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000008235.1|4590180_4590717_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_001242749.1|4590707_4591070_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|4591069_4591375_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|4591601_4592765_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893282.1|4592969_4594223_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4592779:4592825	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4594234_4595338_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4595625_4596681_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 16
NZ_CP038302	Escherichia coli O157:H7 strain SS TX 313-1 chromosome, complete genome	5643409	5026705	5043524	5643409	integrase,transposase	Enterobacteria_phage(64.29%)	19	5029982:5029997	5048477:5048492
WP_000998048.1|5026705_5028244_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|5028293_5028641_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|5028637_5029018_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000168589.1|5029637_5030489_+	HNH endonuclease	NA	NA	NA	NA	NA
5029982:5029997	attL	TTTCGATGAACAGCAC	NA	NA	NA	NA
WP_001301682.1|5030948_5031776_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
WP_044815386.1|5031993_5032188_-	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_000783684.1|5032543_5034877_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_000856729.1|5034891_5035212_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459287.1|5035347_5035803_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001244670.1|5035795_5036083_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_000980224.1|5036075_5036666_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	90.3	5.3e-60
WP_001149160.1|5036662_5036929_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283021.1|5037480_5038215_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	98.8	2.3e-129
WP_000638634.1|5038211_5038712_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446132.1|5038785_5039358_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	97.3	2.2e-95
WP_000095622.1|5039683_5040928_+	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_001453880.1|5040965_5041700_-	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000936844.1|5041776_5042082_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000772662.1|5042249_5043524_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
5048477:5048492	attR	TTTCGATGAACAGCAC	NA	NA	NA	NA
>prophage 17
NZ_CP038302	Escherichia coli O157:H7 strain SS TX 313-1 chromosome, complete genome	5643409	5075944	5134972	5643409	protease,transposase	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|5075944_5077297_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|5077390_5077942_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|5078097_5079471_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|5079646_5080645_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|5080677_5081673_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|5081659_5082682_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205785.1|5082695_5084198_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	3.1e-11
WP_000265942.1|5084337_5085294_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|5085603_5086134_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|5086213_5086564_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|5086557_5086809_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|5087020_5087362_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|5087364_5091144_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|5091140_5092874_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|5093079_5093718_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|5094040_5095384_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|5095479_5095686_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175296.1|5096010_5096565_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|5096627_5097566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|5097777_5098518_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589488.1|5098707_5100651_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_001302935.1|5100768_5101149_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|5101237_5102098_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|5102205_5103171_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|5103278_5103941_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|5103985_5105398_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|5105706_5106327_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|5106544_5107183_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|5107317_5108526_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|5108533_5108965_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|5109587_5110382_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|5110452_5110902_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|5110943_5111171_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|5111175_5111490_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|5111496_5111892_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|5112218_5112494_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|5112622_5113309_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|5113308_5114163_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|5114172_5114823_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|5114836_5115301_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|5115310_5115616_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|5115631_5117029_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|5118555_5119311_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|5119307_5120057_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|5120238_5120568_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|5120716_5120992_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_171877067.1|5121108_5122734_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|5122817_5123981_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|5123983_5124622_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|5124631_5125030_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|5125047_5125707_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|5125757_5126456_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|5126474_5126876_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|5127002_5127734_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|5127914_5130356_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|5130394_5130820_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|5131024_5132323_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|5132426_5132624_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|5132705_5133710_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|5133712_5134972_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 18
NZ_CP038302	Escherichia coli O157:H7 strain SS TX 313-1 chromosome, complete genome	5643409	5271852	5286517	5643409	tail,integrase,tRNA	Enterobacteria_phage(43.75%)	19	5267693:5267708	5285222:5285237
5267693:5267708	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5271852_5273268_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5273350_5274334_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5274499_5274742_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5274875_5275913_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5276001_5277099_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5277160_5277409_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5277569_5278211_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5278292_5278922_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5278994_5279567_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5279678_5279948_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5279949_5281263_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5281327_5281927_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5283248_5283785_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5283775_5284126_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5284122_5284407_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5284742_5284940_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5285284_5285566_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5285222:5285237	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5285613_5285787_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5285983_5286517_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP038304	Escherichia coli O157:H7 strain SS TX 313-1 plasmid pTX313-1, complete sequence	96937	24315	86937	96937	integrase,transposase,protease	Macacine_betaherpesvirus(27.78%)	55	11888:11903	53442:53457
11888:11903	attL	GTGTTTTTCTGGCCGG	NA	NA	NA	NA
WP_001066920.1|24315_25056_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000708307.1|26724_26925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|26921_27542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|27538_28222_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|28680_28899_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|28900_29206_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|29206_30013_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829202.1|30735_31949_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000852148.1|32024_32780_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|33367_34534_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|34533_35505_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|36113_37016_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|37019_37325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|37401_38085_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
WP_001104869.1|38085_38307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358893.1|38200_38755_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001310284.1|39449_40022_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_010891293.1|40117_40420_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271685.1|40466_40889_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027495.1|40885_41077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303399.1|41195_41585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|42072_42303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199442.1|42354_43716_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001302171.1|43762_44326_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
WP_001358896.1|44411_44867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547965.1|44936_45143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290823.1|45168_45621_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_000005995.1|45677_45911_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117168.1|45976_47935_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000845908.1|47989_48424_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276250.1|48420_49182_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001302184.1|49413_49572_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001453090.1|51794_52226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581719.1|53991_63501_+	toxin B	NA	NA	NA	NA	NA
53442:53457	attR	CCGGCCAGAAAAACAC	NA	NA	NA	NA
WP_001171554.1|64495_64876_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|64872_65220_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|65269_66808_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000205762.1|68209_68956_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
WP_000704522.1|69014_69875_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000840472.1|69977_70538_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001302189.1|70670_70883_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233853.1|71127_71589_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	5.5e-20
WP_001302200.1|71634_71844_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766796.1|71881_72220_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083831.1|72459_72714_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001370046.1|72949_73024_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130945.1|73016_73874_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001178089.1|74785_75070_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421248.1|75069_75345_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001105064.1|75439_75646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302179.1|76986_77172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000592771.1|77348_79559_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|79602_79992_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_001034097.1|81217_85120_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
WP_171877072.1|85723_86937_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
