The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038328	Escherichia coli O157:H7 strain NE 1092-2 chromosome, complete genome	5607499	1193425	1262580	5607499	tail,transposase,tRNA,integrase,holin	Enterobacteria_phage(19.23%)	67	1193378:1193392	1253030:1253044
1193378:1193392	attL	ACGCTGGAGCTGGTG	NA	NA	NA	NA
WP_000047198.1|1193425_1196056_+|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000906486.1|1196290_1196476_+	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000273309.1|1197703_1198270_+	fructose-1-phosphate/6-phosphogluconate phosphatase	NA	NA	NA	NA	NA
WP_001287450.1|1198266_1198695_+	DedA family protein	NA	NA	NA	NA	NA
WP_000611787.1|1198767_1200324_+	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_001130215.1|1200473_1200989_+	S-ribosylhomocysteine lyase	NA	NA	NA	NA	NA
WP_001295176.1|1201052_1202591_-	multidrug efflux MFS transporter permease subunit EmrB	NA	NA	NA	NA	NA
WP_001302673.1|1202607_1203780_-	multidrug efflux MFS transporter periplasmic adaptor subunit EmrA	NA	NA	NA	NA	NA
WP_000378442.1|1203906_1204437_-	multidrug efflux transporter EmrAB transcriptional repressor EmrR	NA	NA	NA	NA	NA
WP_000119749.1|1204527_1204863_-	L-valine transporter subunit YgaH	NA	NA	NA	NA	NA
WP_000445658.1|1204852_1205590_-	L-valine exporter subunit YgaZ	NA	NA	NA	NA	NA
WP_000165714.1|1205713_1206898_-	MFS transporter	NA	NA	NA	NA	NA
WP_001216525.1|1207089_1208082_-	glycine betaine/L-proline ABC transporter substrate-binding protein ProX	NA	NA	NA	NA	NA
WP_000774978.1|1208138_1209203_-	glycine betaine/L-proline ABC transporter permease ProW	NA	NA	NA	NA	NA
WP_000985501.1|1209195_1210398_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	38.8	1.9e-27
WP_000777971.1|1210753_1211713_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.5	2.9e-132
WP_000246553.1|1211722_1213867_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.4	2.9e-196
WP_000080947.1|1213839_1214250_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_001223227.1|1214246_1214492_-	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000209792.1|1214701_1215133_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001138451.1|1215220_1216555_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_001295174.1|1216704_1217034_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_000281320.1|1217185_1217530_+	YgaC family protein	NA	NA	NA	NA	NA
WP_000492656.1|1217566_1218016_-	L-alanine exporter AlaE	NA	NA	NA	NA	NA
WP_000115383.1|1218683_1219088_+	DNA-binding protein StpA	NA	NA	NA	NA	NA
WP_001229446.1|1219140_1219659_-	thiosulfate sulfurtransferase YgaP	NA	NA	NA	NA	NA
WP_000138003.1|1219668_1219968_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000508177.1|1220150_1220309_+	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_001690029.1|1220392_1220842_+	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
WP_000156811.1|1220842_1221505_-	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_001301367.1|1221525_1222926_-	GABA permease	NA	NA	NA	NA	NA
WP_000097647.1|1223163_1224444_-	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
WP_000772884.1|1224457_1225906_-	NADP-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000271966.1|1225928_1227197_-	L-2-hydroxyglutarate oxidase	NA	NA	NA	NA	NA
WP_001301435.1|1227216_1228194_-	carbon starvation induced protein CsiD	NA	NA	NA	NA	NA
WP_000906744.1|1232170_1233520_+	DUF5507 domain-containing protein	NA	NA	NA	NA	NA
WP_072145424.1|1233907_1234117_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	70.2	1.7e-08
WP_001120794.1|1234271_1234391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071526000.1|1234455_1238397_+	AIDA repeat-containing protein	NA	NA	NA	NA	NA
WP_001071599.1|1238496_1238703_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	43.3	1.8e-07
WP_000540864.1|1239025_1240231_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1240232_1241546_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1241542_1243174_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1243174_1243573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1243670_1244084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054626585.1|1244479_1245778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001418122.1|1245853_1246189_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1246191_1246947_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108083.1|1247288_1247855_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_001223948.1|1247829_1248441_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1248437_1249103_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1249099_1249723_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1249975_1250719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1250804_1250972_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143068.1|1251379_1253233_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
1253030:1253044	attR	ACGCTGGAGCTGGTG	NA	NA	NA	NA
WP_000284517.1|1253382_1253598_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1253602_1253947_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_171878571.1|1254303_1254684_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	99.2	1.2e-65
WP_000612591.1|1254680_1255028_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_162829202.1|1255528_1256742_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1256959_1257229_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442136.1|1257389_1257812_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	96.3	1.7e-71
WP_001301665.1|1257941_1259000_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1259078_1259729_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1259911_1260502_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1261003_1261252_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1262097_1262580_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP038328	Escherichia coli O157:H7 strain NE 1092-2 chromosome, complete genome	5607499	1488281	1610817	5607499	lysis,tail,bacteriocin,terminase,transposase,portal,tRNA,integrase,holin	Escherichia_phage(63.95%)	119	1517671:1517730	1586382:1587691
WP_000695640.1|1488281_1489697_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000604897.1|1489697_1490240_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	57.7	5.1e-41
WP_162829242.1|1490637_1491850_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_000826499.1|1492808_1493201_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001296278.1|1493202_1493547_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001301445.1|1494180_1496370_+	sensor domain-containing phosphodiesterase	NA	NA	NA	NA	NA
WP_001301799.1|1496419_1497622_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_024178913.1|1497957_1499196_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_000490072.1|1499335_1499662_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_000903148.1|1499776_1501033_-	ion channel protein	NA	NA	NA	NA	NA
WP_000170346.1|1501236_1502202_+	glucokinase	NA	NA	NA	NA	NA
WP_000038456.1|1502420_1502747_+	fructose-like phosphotransferase enzyme IIB component 1	NA	NA	NA	NA	NA
WP_000985336.1|1502768_1504016_+	PTS fructose transporter subunit IIC	NA	NA	NA	NA	NA
WP_000173224.1|1504030_1505116_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000366040.1|1505115_1506153_+	aminopeptidase	NA	NA	NA	NA	NA
WP_000955897.1|1506177_1508673_+	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000646830.1|1508675_1509533_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001295458.1|1509545_1510280_-	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
WP_000544359.1|1510294_1511992_-	two-component system sensor histidine kinase YpdA	NA	NA	NA	NA	NA
WP_000785916.1|1512368_1513607_+	alanine transaminase	NA	NA	NA	NA	NA
WP_010723117.1|1513671_1513743_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_000484404.1|1514098_1515019_-	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
WP_000499593.1|1515371_1515614_+	YfdY family protein	NA	NA	NA	NA	NA
WP_000867641.1|1515690_1515966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825602.1|1516261_1516897_+	YfdX family protein	NA	NA	NA	NA	NA
1517671:1517730	attL	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATC	NA	NA	NA	NA
WP_162829202.1|1517712_1518926_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001283490.1|1520027_1521722_+	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
WP_000955028.1|1521791_1522736_+	transporter YfdV	NA	NA	NA	NA	NA
WP_001301578.1|1524006_1527600_-	acid-sensing system histidine kinase EvgS	NA	A0A1V0SGX0	Hokovirus	32.1	7.8e-37
WP_000991370.1|1527604_1528219_-	acid-sensing system DNA-binding response regulator EvgA	NA	NA	NA	NA	NA
WP_001301602.1|1528634_1529798_+	multidrug efflux MFS transporter periplasmic adaptor subunit EmrK	NA	NA	NA	NA	NA
WP_162829202.1|1530943_1532157_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001417291.1|1532373_1532649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000426437.1|1532756_1534085_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000362341.1|1534500_1535559_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000194527.1|1535566_1537000_-	glycoside hydrolase family 32 protein	NA	F8WPR5	Bacillus_phage	25.0	1.2e-28
WP_001274894.1|1537215_1538130_+	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001197016.1|1538201_1539449_+	oligosaccharide MFS transporter	NA	NA	NA	NA	NA
WP_001102876.1|1540046_1540673_-	recombinase family protein	NA	A0A0A8WJD4	Clostridium_phage	28.7	5.9e-09
WP_000409798.1|1540975_1541152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119352.1|1541338_1542751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000245915.1|1543420_1544068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000950857.1|1544098_1544668_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1544667_1545135_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1545121_1545802_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1545811_1546948_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1547122_1548280_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_001218308.1|1548711_1549881_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_001694422.1|1549864_1550047_-	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	98.3	9.1e-27
WP_114077796.1|1550125_1550530_-	hypothetical protein	NA	A0A0P0ZH73	Escherichia_phage	76.1	1.1e-45
WP_001291843.1|1550586_1550799_-	DUF1382 family protein	NA	A0A0P0ZGA1	Escherichia_phage	100.0	7.1e-31
WP_000163448.1|1550758_1551385_-	adenine methylase	NA	G9L6F9	Escherichia_phage	100.0	1.8e-122
WP_000809302.1|1551381_1551813_-	hypothetical protein	NA	A0A2R2Z303	Escherichia_phage	100.0	7.3e-75
WP_000211520.1|1551868_1552498_-	phage antirepressor Ant	NA	G9L6G1	Escherichia_phage	100.0	2.3e-117
WP_000203837.1|1552747_1553032_-	phage antirepressor Ant	NA	G9L6G2	Escherichia_phage	100.0	4.1e-50
WP_001694420.1|1553387_1554317_-	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	100.0	5.1e-182
WP_000036158.1|1554830_1555532_-	ead/Ea22-like family protein	NA	A0A0H4ISY5	Shigella_phage	100.0	1.7e-134
WP_000476216.1|1555528_1555768_-	hypothetical protein	NA	A0A2R2Z309	Escherichia_phage	97.5	6.7e-38
WP_001694418.1|1555760_1555964_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	98.5	1.4e-31
WP_001453790.1|1555960_1556839_-	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	100.0	1.0e-179
WP_001159717.1|1556946_1557390_-	hypothetical protein	NA	A0A0H4IQ60	Shigella_phage	100.0	3.9e-79
WP_000080417.1|1557466_1558288_-	DUF2303 family protein	NA	A0A2R2Z323	Escherichia_phage	100.0	2.3e-149
WP_000077905.1|1558351_1558699_-	hypothetical protein	NA	A0A2R2X2A9	Escherichia_phage	100.0	5.9e-59
WP_000344634.1|1558774_1559362_-	hypothetical protein	NA	A0A2R2Z318	Escherichia_phage	100.0	4.0e-108
WP_000187063.1|1559361_1560051_-	YqaJ viral recombinase family protein	NA	A0A0P0ZFI7	Escherichia_phage	100.0	3.5e-135
WP_000459720.1|1560047_1560998_-	recombinase RecT	NA	A0A0H4IQ64	Shigella_phage	100.0	7.0e-179
WP_000995345.1|1561014_1561296_-	host nuclease inhibitor GamL	NA	A0A0P0ZFG3	Escherichia_phage	100.0	1.1e-47
WP_000934196.1|1561316_1561598_-	hypothetical protein	NA	A0A0P0ZGC3	Escherichia_phage	98.9	3.0e-45
WP_000917252.1|1561609_1561822_-	cell division inhibitor protein	NA	A0A0P0ZGD1	Escherichia_phage	100.0	5.8e-33
WP_106894353.1|1561892_1562678_-	Rha family phage regulatory protein	NA	A0A0P0ZGC2	Escherichia_phage	92.3	5.7e-134
WP_001064714.1|1563295_1564249_-	type II restriction endonuclease BsuBI	NA	A0A0P0ZG22	Escherichia_phage	100.0	7.0e-187
WP_000939558.1|1564245_1565715_-	Eco57I restriction-modification methylase domain-containing protein	NA	A0A2R2Z316	Escherichia_phage	100.0	3.5e-286
WP_001056250.1|1565809_1566523_-	LexA family transcriptional regulator	NA	A0A2R2X2B0	Escherichia_phage	100.0	6.3e-132
WP_001240876.1|1566618_1566822_+	Cro/CI family transcriptional regulator	NA	A0A2R2Z333	Escherichia_phage	100.0	2.0e-30
WP_001302923.1|1566992_1567187_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001271433.1|1567353_1567731_+	hypothetical protein	NA	A0A2R2Z329	Escherichia_phage	100.0	4.0e-61
WP_001694415.1|1567724_1569245_+	DEAD/DEAH box helicase	NA	A0A0H4IT01	Shigella_phage	100.0	4.9e-307
WP_001694414.1|1569234_1570206_+	toprim domain-containing protein	NA	A0A0H4IPK0	Shigella_phage	100.0	1.9e-195
WP_000402092.1|1570205_1570655_+	DUF1367 family protein	NA	A0A0P0ZFW0	Escherichia_phage	100.0	7.6e-83
WP_000813671.1|1570662_1571226_+	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	100.0	8.9e-105
WP_000144767.1|1571222_1571417_+	protein ninH	NA	A0A0P0ZGE1	Escherichia_phage	100.0	8.4e-31
WP_001204859.1|1571409_1571844_+	antitermination protein	NA	A0A0P0ZGJ3	Escherichia_phage	100.0	4.8e-82
WP_000691354.1|1572350_1573298_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1573307_1573577_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_171878572.1|1574076_1576014_+	DUF1737 domain-containing protein	NA	A0A1I9LJQ8	Stx_converting_phage	99.7	0.0e+00
WP_000143458.1|1576148_1576328_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290212.1|1576368_1576641_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000284506.1|1576717_1576933_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087460.1|1576937_1577471_+	lysozyme	NA	V5USG4	Shigella_phage	98.9	6.7e-102
WP_001056885.1|1577745_1578315_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000455406.1|1578314_1578464_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082654.1|1578471_1578936_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000738505.1|1578967_1579261_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|1579410_1579614_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_001694411.1|1579669_1580476_+|terminase	terminase small subunit	terminase	A0A0P0ZG40	Escherichia_phage	99.6	3.8e-133
WP_000143992.1|1580456_1582163_+|terminase	bacteriophage terminase large subunit	terminase	G9L6K0	Escherichia_phage	100.0	0.0e+00
WP_000787036.1|1582162_1584307_+|portal	portal protein	portal	V5URY3	Shigella_phage	100.0	0.0e+00
WP_000345010.1|1584464_1585472_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_162829202.1|1586423_1587637_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001140442.1|1588078_1588468_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
1586382:1587691	attR	TGAACCGCCCCGGGTTTCCTGGAGAGTGTTTTATCTGTGAACTCAGGCTGCCAGATCATCGTTTCCGATGGAAGCATAATAAGCTTTTTCTGCTTCTGCCGGAGGAGTATGGCCCAGCCTTCCCAGCAATCGTCGATTGTTATACCAGTCCACCCACGTTAGTGTGGCCAGTTCCACTTCTGCACGGTTTTTCCAGCTCTTACGGTGTATTACCTCCGCTTTGTAAAGACCATTGATGCTCTCAGCCATCGCGTTGTCATACGAGTCGCCTGTACTCCCTGTTGATGCCAGTAATCCGGCTTCTTTTAGTCGCTCCGTATAGGCCAGTGACACATACTGAGAGCCTTTATCGCTGTGATGGATGGTGCCAGACGGACGACGGGCCCACAACGCCTGCTCCAGCGCATCCAGCACGAATGTCGTTTCCATAGACGATGAGACCCGCCACCCCACGATGTATCCGGCAAACACATCAATGATAAACGCCACATAGACGAAGCCCTGCCATGTGCTGACGTAAGTAAAATCAGCCACCCACAGCTGGTCAGGTCGTTCTGCCACGAACTGACGGTTTACGCGGTCGCCTGCGGCAACGGCTTTCCGGCTGATGGTCGTACGGACCTTTTTACCCCGGAGAACACCGGCAAGTCCCATAACCGCCATGAGACGTGCCACTGTACATCTGGCCACCCTGATTCCTTCCCGTAACAACTGACGCCAGACTTTACGCACACCGTACACCTGATGATTTTCATCGTATACGCGCTGTATCTCTCTCTTCAGCCAGTCGTCGTGCTGCGCACGGGCACTGCGTTTATCCGGATGATGTCGCTGTTGCTGACAATGGTAATACGTTGACGGGGCAATATGCAGTTCGCTGCATACCGGTCCGACCCCGTACTGCTCACGCAGCTTATCCAGCAGTGGCATCATTTTTTCCAGAGGCGGTCGAACTCCGCCTTCGCAAAATAAGCGGAAGCCTGGCGAAGGATATCGTTACTGCGGCGCAGTTCACGATTTTCACGTTCCAGCTCTTTCAGACGCTGACGTTCAGCGCTGGTGAGCCCACCATCACCGCCCCCGGTATCCCGCTCATGCTGGCGAACCCAGACACGCAGAGTCTCCGGCGTACAGCCAATCTTTGGGGCAATGGAACAAATTGCCGCCCACTGTGAGTCATATTCATCCTGACTTTCCAGAACCATACGAATCGCCCGCTGACGGACTTCGGGGGAAAAACGAGTATTTTTAGTCATCCTGTTTACCTCTTTCTCAGGGAGTTTAGTCTCCAGGATTTCCGGGGCGGTTCA	NA	NA	NA	NA
WP_001290743.1|1588517_1588979_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|1588962_1589526_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207923.1|1589525_1590176_+	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_171878573.1|1590172_1592119_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.1e-64
WP_001024006.1|1592120_1592390_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001303606.1|1592529_1592718_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001146326.1|1593012_1594638_+	hypothetical protein	NA	A0A1I9LJT3	Stx_converting_phage	100.0	0.0e+00
WP_000197192.1|1594634_1595903_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|1595917_1596196_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001301884.1|1596201_1596819_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835359.1|1596909_1597644_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0N7C1B9	Escherichia_phage	99.6	2.2e-135
WP_000078907.1|1597876_1598017_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1598073_1598475_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|1598568_1599225_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455644.1|1599227_1599674_+	hypothetical protein	NA	A0A1I9LJU1	Stx_converting_phage	100.0	1.4e-76
WP_000540391.1|1599683_1599935_+|bacteriocin	bacteriocin	bacteriocin	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012450.1|1599945_1601211_+	hypothetical protein	NA	A0A1I9LJU3	Stx_converting_phage	100.0	1.4e-206
WP_001689996.1|1601280_1609662_+	hypothetical protein	NA	A0A0N7BSA7	Escherichia_phage	99.7	0.0e+00
WP_000368131.1|1609884_1610817_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
>prophage 3
NZ_CP038328	Escherichia coli O157:H7 strain NE 1092-2 chromosome, complete genome	5607499	1864789	1966808	5607499	tail,protease,terminase,portal,tRNA,holin	Enterobacteria_phage(53.52%)	110	NA	NA
WP_000569336.1|1864789_1865716_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1865720_1866452_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1866432_1866540_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1866599_1867301_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1867321_1868608_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1868641_1868896_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1868914_1869049_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1869052_1869295_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1869382_1869745_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1869741_1870098_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1870431_1870608_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_087683803.1|1870609_1871557_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	99.7	1.4e-182
WP_000763383.1|1871553_1871775_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1871873_1872155_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1872165_1872357_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1872329_1872512_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1872511_1873189_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1873185_1873971_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1873976_1874273_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1874348_1874639_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1875142_1876750_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|1876856_1877549_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182877.1|1877912_1878452_+	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.0	2.6e-61
WP_000147238.1|1878448_1879468_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.7e-109
WP_000788902.1|1879464_1880166_+	Replication protein P	NA	M1FJ72	Enterobacteria_phage	99.1	3.8e-129
WP_000152742.1|1880370_1880718_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001415151.1|1881470_1882079_+	hypothetical protein	NA	Q9T1Q5	Acyrthosiphon_pisum_secondary_endosymbiont_phage	67.3	1.5e-33
WP_001038620.1|1882378_1882795_+	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_000520500.1|1882773_1883175_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072097617.1|1883298_1883400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053023.1|1883396_1883852_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	3.1e-60
WP_000224914.1|1883851_1884022_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_000774477.1|1884014_1884305_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	96.9	6.0e-49
WP_001099712.1|1884301_1884664_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1884660_1884801_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1884886_1885321_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1885569_1885722_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142933.1|1886525_1888472_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.5	0.0e+00
WP_000143458.1|1888608_1888788_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1888828_1889074_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1889151_1889367_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1889371_1889905_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1890175_1890745_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1890744_1890891_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1891118_1891304_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001302882.1|1891515_1891788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000348565.1|1891820_1892297_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|1892293_1894417_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|1894413_1894626_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1894625_1896128_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1896072_1898097_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1898184_1898511_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1898503_1898785_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1898787_1899411_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1899423_1899822_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1899829_1900582_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|1900595_1901018_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_171878576.1|1901044_1901353_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	86.3	8.7e-46
WP_046671471.1|1901396_1904042_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.7	0.0e+00
WP_000847298.1|1904038_1904368_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_171878577.1|1904367_1905066_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	3.1e-131
WP_000194798.1|1905076_1905820_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_096851774.1|1905765_1906395_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	2.3e-101
WP_171878578.1|1906635_1910109_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_001228289.1|1910176_1910776_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000279064.1|1910840_1912154_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.3	3.7e-77
WP_001023455.1|1912155_1912425_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	98.9	2.4e-44
WP_001261937.1|1912792_1913041_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1913555_1915241_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1915237_1915957_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1916003_1916474_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1916515_1916977_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1917101_1919105_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1919101_1920238_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1920230_1920962_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1920980_1922510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1922520_1923609_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1924849_1925167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1925228_1928858_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1935815_1937849_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1937980_1939090_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1939351_1939633_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1939924_1940467_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|1940554_1941229_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1941244_1943725_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1943735_1944770_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1944851_1945190_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134629.1|1945407_1946259_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1946399_1946672_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1946781_1947096_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1947105_1947453_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000141034.1|1948503_1948743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1949076_1949865_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1949861_1950662_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1950726_1951545_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1951596_1952343_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1952316_1953282_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1953278_1954283_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1954279_1955557_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1955813_1956866_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001301486.1|1957164_1958019_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853846.1|1958047_1959310_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000182899.1|1959319_1959772_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1959802_1960087_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1960090_1961446_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1961493_1962534_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1962633_1963413_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1963494_1964394_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1964799_1965117_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476014.1|1965446_1966808_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
>prophage 4
NZ_CP038328	Escherichia coli O157:H7 strain NE 1092-2 chromosome, complete genome	5607499	2052825	2195765	5607499	lysis,tail,head,protease,terminase,transposase,capsid,portal,integrase,holin	Stx2-converting_phage(33.33%)	161	2049443:2049457	2155837:2155851
2049443:2049457	attL	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_001007946.1|2052825_2054004_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|2053984_2054176_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|2054253_2054598_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|2054785_2055136_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_171878579.1|2055993_2056941_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	99.7	1.0e-182
WP_000763383.1|2056937_2057159_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|2057257_2057539_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548528.1|2057549_2057741_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|2057713_2057896_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186807.1|2057892_2058573_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	99.6	3.5e-132
WP_001302855.1|2058569_2059355_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
WP_000995486.1|2059360_2059657_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|2059731_2059875_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2059843_2060008_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|2060080_2060449_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|2060631_2060883_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|2060941_2061214_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|2061191_2061374_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|2061942_2062464_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|2062965_2063661_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|2063736_2063952_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|2064093_2064390_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|2064422_2064584_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|2064570_2065392_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|2065388_2066765_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|2066835_2067114_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|2067246_2067462_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|2067472_2067709_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|2067665_2068112_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|2068108_2068636_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|2068632_2068815_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208502.1|2069089_2069848_+	ORF6N domain-containing protein	NA	B6ETC2	Enterobacteria_phage	100.0	2.0e-115
WP_000849633.1|2070103_2070784_+	phage antirepressor Ant	NA	Q8HA19	Enterobacteria_phage	100.0	1.1e-128
WP_001004016.1|2070858_2071581_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|2071580_2072186_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|2072182_2072854_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|2072844_2073333_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|2073982_2074942_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|2074953_2075223_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|2075519_2075843_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143087.1|2076086_2078024_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	98.9	0.0e+00
WP_000143458.1|2078160_2078340_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2078380_2078653_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|2078729_2078945_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|2078944_2079442_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|2079438_2079876_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|2080078_2080576_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|2080572_2080830_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095736.1|2081292_2081520_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|2081561_2081927_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958365.1|2082219_2082783_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	98.9	8.9e-89
WP_001301491.1|2082779_2084441_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2084504_2086442_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2086486_2086708_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2086653_2089155_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2089234_2089561_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2089570_2089921_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2089917_2090364_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2090360_2090705_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2090770_2091487_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2091501_2091876_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2091971_2092181_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212829.1|2092228_2095471_+|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	100.0	0.0e+00
WP_000807954.1|2095463_2095805_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179516.1|2095804_2096503_+|tail	phage minor tail protein L	tail	A0A0P0ZD82	Stx2-converting_phage	100.0	1.5e-133
WP_001302649.1|2096519_2096840_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2096947_2097121_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2097191_2098115_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_000967271.1|2098168_2098906_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_115445438.1|2098851_2099484_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	99.5	5.8e-105
WP_072608489.1|2099743_2103238_+	host specificity protein J	NA	A0A0P0ZEQ8	Stx2-converting_phage	98.6	0.0e+00
WP_000268864.1|2103973_2105287_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.8	2.6e-78
WP_001023452.1|2105288_2105558_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2105698_2106574_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2106798_2107449_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2108772_2109939_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2110057_2110531_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2110729_2111788_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2111959_2112289_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2112389_2112572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2113060_2113174_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2113186_2113381_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2113839_2114208_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2114281_2114503_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2114565_2115042_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2115056_2115536_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2115617_2116439_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2116659_2117070_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2117085_2117769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102658.1|2117904_2118975_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2118971_2119877_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_061069249.1|2119873_2120728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000649219.1|2121009_2122632_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_162829202.1|2122709_2123922_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000998048.1|2125917_2127456_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2127505_2127853_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2127849_2128230_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973178.1|2128591_2129137_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2129133_2129877_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2129888_2130968_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2131029_2131965_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2132421_2133339_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|2133765_2134979_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_122989775.1|2135821_2137465_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2138090_2138807_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2139149_2140604_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2140705_2142022_-	shikimate transporter	NA	NA	NA	NA	NA
WP_162829202.1|2142609_2143823_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001356620.1|2144962_2152945_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2153434_2154232_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2154467_2155490_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2155489_2155693_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2155751_2158223_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
2155837:2155851	attR	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_000199485.1|2158318_2158507_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2158503_2158692_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2159172_2159325_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2159599_2160244_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2160341_2160569_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2160565_2160991_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2161059_2162097_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2162008_2162551_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2162585_2163284_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2163305_2163530_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2163526_2163883_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2163915_2164068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2164064_2164376_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2164502_2165066_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2165175_2165280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2165466_2165679_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2165846_2166125_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2166126_2167176_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2167188_2167548_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2167544_2168234_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|2168867_2169296_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000216644.1|2169292_2169460_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	68.6	1.2e-09
WP_000023257.1|2169773_2171624_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2171705_2172919_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2173229_2173445_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2173449_2173794_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2173844_2174378_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2174533_2174716_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2174728_2174860_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2175087_2175273_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2175799_2176114_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2176195_2176420_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2176814_2177324_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2179209_2179416_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2179412_2181005_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2180994_2182500_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_001301534.1|2182941_2183208_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2183189_2183930_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2183943_2184375_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2184401_2184815_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_171878580.1|2184795_2187375_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.6	0.0e+00
WP_000847298.1|2187371_2187701_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001356552.1|2187700_2188399_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	99.1	3.6e-132
WP_000194798.1|2188409_2189153_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_096851774.1|2189098_2189728_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	2.3e-101
WP_171878581.1|2189968_2193448_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.8	0.0e+00
WP_171878582.1|2194180_2195494_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_086259220.1|2195495_2195765_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.1e-43
>prophage 5
NZ_CP038328	Escherichia coli O157:H7 strain NE 1092-2 chromosome, complete genome	5607499	2251318	2271587	5607499	tail,integrase,transposase	Enterobacteria_phage(70.83%)	28	2264723:2264736	2274729:2274742
WP_050543672.1|2251318_2252398_+|transposase	IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.4	3.1e-37
WP_162829202.1|2252400_2253614_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001453757.1|2253673_2254354_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.5	2.5e-125
WP_000290456.1|2254353_2254866_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2254920_2255286_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2255294_2255450_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2258252_2258741_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2258897_2259470_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2259513_2260044_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2261135_2261450_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2261454_2262414_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2262490_2265313_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2264723:2264736	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2265319_2265685_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2265681_2266299_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2266310_2266610_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2266606_2266873_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2266869_2267073_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2267096_2267513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2267605_2267719_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2267715_2267958_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2267969_2268248_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2268258_2268609_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2268630_2268834_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2268905_2269043_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2269132_2269537_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2269552_2270203_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2270232_2270580_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2270585_2271587_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2274729:2274742	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 6
NZ_CP038328	Escherichia coli O157:H7 strain NE 1092-2 chromosome, complete genome	5607499	2590820	2654830	5607499	tail,head,protease,terminase,capsid,portal,holin	Enterobacteria_phage(37.74%)	77	NA	NA
WP_001260835.1|2590820_2591642_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2591741_2591825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2591917_2592253_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2592649_2593903_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2594009_2594903_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2595037_2596258_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2596382_2597078_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2597030_2598323_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2598480_2599095_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2599137_2599992_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2599993_2600611_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2600621_2603045_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2603105_2605532_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2605730_2606036_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2606143_2606854_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2606856_2607417_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2607451_2607793_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2607927_2608254_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2609242_2609494_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2609566_2612038_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2612130_2612322_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2612318_2612507_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2612907_2613072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2613075_2613294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2613365_2613665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2614017_2614296_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2614297_2614489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2614509_2614881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2614978_2615281_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2615277_2615703_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095668.1|2615725_2616688_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.6	4.8e-82
WP_000788938.1|2616694_2617435_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2618245_2618641_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2618697_2619282_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2619397_2619502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2619690_2619903_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2620070_2620349_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_171878583.1|2620350_2621400_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.6e-107
WP_001217455.1|2621412_2621772_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2621768_2622458_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2623094_2623523_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2624001_2625852_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2626291_2626507_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731259.1|2626511_2626856_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|2626906_2627440_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2627710_2628280_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_054630878.1|2628279_2628426_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	84.8	2.5e-11
WP_001208680.1|2628648_2628834_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2629359_2629674_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2629755_2629980_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2630366_2630912_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027223.1|2630886_2632812_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2632808_2633015_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2633011_2634613_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2634593_2635913_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2635922_2636255_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2636310_2637336_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2637377_2637776_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2637787_2638141_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2638155_2638689_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2638685_2639081_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2639088_2639841_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2639854_2640277_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2640303_2640717_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|2640697_2643310_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|2643306_2643636_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151106.1|2643635_2644334_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	97.8	3.8e-129
WP_087674353.1|2644344_2645088_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.2	5.6e-147
WP_123007081.1|2645033_2645663_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	3.9e-101
WP_171878584.1|2645903_2649377_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.2	0.0e+00
WP_001228289.1|2649444_2650044_+	Ail/Lom family protein	NA	Q9EV15	Enterobacteria_phage	100.0	2.6e-110
WP_000279065.1|2650108_2651431_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q687E6	Enterobacteria_phage	98.6	2.0e-75
WP_001023406.1|2651432_2651702_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	97.8	2.4e-44
WP_001131659.1|2651814_2652390_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.4	5.3e-89
WP_001443810.1|2652462_2653092_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	92.2	1.3e-77
WP_001143784.1|2653173_2653815_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001295593.1|2654395_2654830_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
>prophage 7
NZ_CP038328	Escherichia coli O157:H7 strain NE 1092-2 chromosome, complete genome	5607499	2801798	2897240	5607499	tail,protease,terminase,transposase,portal,tRNA,holin	Escherichia_phage(33.82%)	103	NA	NA
WP_001138082.1|2801798_2804684_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	39.9	1.1e-190
WP_000904897.1|2804809_2805433_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	48.6	2.3e-37
WP_085959879.1|2805463_2806592_+|transposase	IS3-like element IS1133 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.1	1.6e-52
WP_001082319.1|2806724_2807528_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|2807527_2808364_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000113137.1|2810821_2812414_-	autoinducer-2 kinase	NA	NA	NA	NA	NA
WP_000154352.1|2812492_2813446_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194917.1|2813694_2815230_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.4	1.7e-20
WP_000911140.1|2815223_2816252_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222737.1|2816251_2817244_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_000172466.1|2817255_2818278_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774161.1|2818304_2819180_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558527.1|2819203_2819494_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286577.1|2819550_2820309_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_001302151.1|2820312_2821227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854633.1|2821423_2822875_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_000558063.1|2823101_2824520_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
WP_001191021.1|2824658_2825018_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|2825017_2825944_-	glutaminase B	NA	NA	NA	NA	NA
WP_000156618.1|2826007_2827396_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000366470.1|2827496_2828378_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_094364431.1|2829249_2829570_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210801.1|2829720_2830911_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885016.1|2830935_2831601_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000843419.1|2831812_2832247_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|2832266_2832650_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803524.1|2832681_2832900_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000087233.1|2832930_2833830_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054199.1|2834024_2835212_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_001271101.1|2835252_2835648_-	rhodanese	NA	NA	NA	NA	NA
WP_001310251.1|2835742_2836714_+	transcriptional regulator FtrA	NA	NA	NA	NA	NA
WP_000901365.1|2836821_2836917_+	protein MgtS	NA	NA	NA	NA	NA
WP_000592852.1|2837135_2838026_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	1.4e-19
WP_000671724.1|2838280_2838673_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001024796.1|2838948_2839467_+	2-oxo-tetronate isomerase	NA	NA	NA	NA	NA
WP_001302117.1|2839511_2841557_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_000636568.1|2841693_2842440_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215549.1|2842528_2843215_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|2843391_2843595_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|2843630_2845091_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|2845179_2846463_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001120551.1|2846594_2846837_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|2846998_2847640_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|2847721_2848351_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|2848423_2848999_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|2849112_2849382_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268860.1|2849383_2850607_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001230508.1|2850671_2851271_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_149888716.1|2851338_2854818_-	DUF1983 domain-containing protein	NA	B6DZB5	Enterobacteria_phage	99.1	0.0e+00
WP_096851774.1|2855058_2855688_-|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.9	2.3e-101
WP_000194798.1|2855633_2856377_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_171878577.1|2856387_2857086_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	3.1e-131
WP_000847298.1|2857085_2857415_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_046671471.1|2857411_2860057_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.7	0.0e+00
WP_000532073.1|2860100_2860409_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479043.1|2860435_2860858_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2860871_2861624_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682716.1|2861631_2862030_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000974966.1|2862042_2862666_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|2862668_2862950_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|2862942_2863269_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001114424.1|2863356_2865381_-|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_000974564.1|2865325_2866828_-|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_000102414.1|2866827_2867040_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_001077625.1|2867036_2869160_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000348565.1|2869156_2869633_-	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001302882.1|2869665_2869938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|2870149_2870335_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2870562_2870709_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2870708_2871278_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000087728.1|2871548_2872082_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_000284506.1|2872086_2872302_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001290230.1|2872379_2872625_-	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000143458.1|2872665_2872845_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_171878585.1|2872981_2874928_-	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.6	0.0e+00
WP_000640110.1|2875628_2876171_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.3	3.9e-73
WP_000228017.1|2876167_2876458_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	87.5	8.2e-46
WP_000940305.1|2876457_2877057_-	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	1.0e-106
WP_000902698.1|2877616_2877829_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.2e-17
WP_000418464.1|2877951_2879073_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_001138877.1|2879059_2879710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000014164.1|2879864_2880095_-	hypothetical protein	NA	A0A2R2Z315	Escherichia_phage	76.8	4.1e-16
WP_001151116.1|2880091_2880514_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.8e-63
WP_000450718.1|2880529_2881291_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.7	1.0e-116
WP_000788984.1|2881313_2882060_-	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.9	4.8e-114
WP_001356605.1|2882066_2882855_-	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.0	5.1e-42
WP_000702017.1|2882932_2883355_-	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	5.9e-69
WP_001033914.1|2883351_2883594_-	helix-turn-helix transcriptional regulator	NA	K7PKH4	Enterobacteria_phage	62.1	2.3e-17
WP_000410105.1|2883690_2884110_+	helix-turn-helix domain-containing protein	NA	K7PH71	Enterobacterial_phage	60.6	3.1e-14
WP_000379547.1|2884416_2884569_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000887681.1|2884980_2885829_+	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	60.8	5.9e-60
WP_000560226.1|2885875_2886097_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	97.3	6.9e-37
WP_000245534.1|2886090_2886267_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	89.7	4.1e-24
WP_000102194.1|2886347_2889017_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	61.3	4.2e-205
WP_000166315.1|2889009_2889819_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_042853000.1|2889875_2890070_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	7.6e-32
WP_001356607.1|2890062_2890251_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	97.9	1.6e-18
WP_000079604.1|2890350_2890566_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_000040845.1|2890567_2891803_+	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.3	1.1e-237
WP_001157382.1|2891854_2892790_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.6	5.4e-147
WP_000123746.1|2892918_2894292_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000387388.1|2894769_2895753_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000628061.1|2896007_2897240_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 8
NZ_CP038328	Escherichia coli O157:H7 strain NE 1092-2 chromosome, complete genome	5607499	2932885	3020876	5607499	tail,head,plate,protease,transposase,capsid	Shigella_phage(46.51%)	98	NA	NA
WP_001266279.1|2932885_2933152_+	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	46.0	1.4e-07
WP_000270206.1|2933162_2935253_+|transposase	Mu transposase C-terminal domain-containing protein	transposase	A0A2D1GNK9	Pseudomonas_phage	46.8	3.4e-165
WP_001689842.1|2935324_2936257_+	AAA family ATPase	NA	A0A0C4UQR3	Shigella_phage	48.7	2.4e-70
WP_000257930.1|2936259_2936481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001057199.1|2936493_2936748_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000739863.1|2936749_2937031_+	hypothetical protein	NA	I6WB15	Burkholderia_virus	47.4	2.8e-11
WP_000049432.1|2937027_2937300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000049304.1|2937304_2937598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001129553.1|2937609_2938140_+	host-nuclease inhibitor Gam family protein	NA	C9DGL8	Escherichia_phage	57.1	1.9e-48
WP_001689840.1|2938237_2938780_+	hypothetical protein	NA	A0A0C4UQZ6	Shigella_phage	39.4	4.9e-28
WP_000564281.1|2938783_2939317_+	hypothetical protein	NA	A0A0C4UQU2	Shigella_phage	67.2	6.9e-67
WP_000465562.1|2939316_2939832_+	hypothetical protein	NA	C9DGM0	Escherichia_phage	55.4	1.2e-47
WP_000973021.1|2939835_2940387_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_000595948.1|2940383_2940569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000021231.1|2940607_2940940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001086882.1|2940932_2941130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001509933.1|2941119_2941416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001214356.1|2941412_2941922_+	gp16 family protein	NA	A0A0C4UQU3	Shigella_phage	43.4	1.1e-26
WP_000852377.1|2941991_2942417_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_001125304.1|2942488_2942989_+	lysozyme	NA	B6SD29	Bacteriophage	42.6	3.0e-27
WP_115801859.1|2943023_2943452_+	endopeptidase	NA	NA	NA	NA	NA
WP_001122255.1|2943435_2943654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342749.1|2943664_2943892_+	TraR/DksA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000270159.1|2943872_2944181_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_001279080.1|2944177_2944468_+	hypothetical protein	NA	A0A0C4UR00	Shigella_phage	63.2	2.1e-25
WP_000360582.1|2944470_2945052_+	DUF3486 family protein	NA	A0A0C4UQU5	Shigella_phage	56.8	5.5e-49
WP_001057672.1|2945051_2946716_+	hypothetical protein	NA	A0A0C4UR29	Shigella_phage	73.2	1.4e-230
WP_001689834.1|2946715_2948305_+	DUF935 domain-containing protein	NA	A0A0C4UQR8	Shigella_phage	57.7	9.4e-168
WP_001689833.1|2948288_2949620_+|capsid	minor capsid protein	capsid	A0A0C4UQY9	Shigella_phage	58.8	4.6e-152
WP_000094812.1|2949741_2950215_+	phage virion morphogenesis protein	NA	A0A0C4UR01	Shigella_phage	53.9	6.0e-38
WP_001689832.1|2950391_2951516_+	hypothetical protein	NA	A0A0C4UQU6	Shigella_phage	47.9	4.4e-79
WP_001142979.1|2951515_2952463_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A0C4UQR9	Shigella_phage	66.2	1.3e-121
WP_001002040.1|2952506_2952860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001104956.1|2952856_2953276_+	gp436 family protein	NA	A0A0C4UR02	Shigella_phage	53.6	4.7e-34
WP_000627431.1|2953272_2953833_+	DUF1834 family protein	NA	A0A0C4UQU7	Shigella_phage	47.7	1.1e-41
WP_000848437.1|2953833_2954079_+	DUF2635 domain-containing protein	NA	C9DGP6	Escherichia_phage	54.5	2.8e-07
WP_000606747.1|2954075_2955578_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	C9DGP7	Escherichia_phage	51.3	5.6e-138
WP_000015474.1|2955586_2955952_+|tail	phage tail tube protein	tail	C9DGP8	Escherichia_phage	51.7	1.5e-25
WP_000213225.1|2955966_2956443_+|tail	phage tail assembly protein	tail	A0A0C4UR03	Shigella_phage	50.8	1.0e-21
WP_001689828.1|2956569_2958645_+	tape measure protein	NA	A0A0C4UQU8	Shigella_phage	37.9	1.4e-70
WP_000146118.1|2958631_2959981_+	DNA circularization protein	NA	C9DGQ2	Escherichia_phage	33.1	5.9e-54
WP_000098807.1|2959964_2961089_+|tail	tail protein	tail	C9DGQ3	Escherichia_phage	48.5	2.9e-91
WP_000980533.1|2961078_2961693_+|plate	phage baseplate assembly protein V	plate	A0A0C4UQZ3	Shigella_phage	51.0	3.6e-51
WP_000763330.1|2961685_2962123_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	53.5	1.9e-38
WP_001146835.1|2962122_2963205_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	53.2	1.1e-98
WP_000301578.1|2963195_2963756_+	YmfQ family protein	NA	C9DGQ7	Escherichia_phage	49.1	3.9e-44
WP_000469163.1|2963755_2964667_+	hypothetical protein	NA	C9DGQ8	Escherichia_phage	47.5	2.2e-36
WP_001481145.1|2964701_2965223_-|tail	tail fiber assembly protein	tail	A0A0U2QV64	Escherichia_phage	52.6	6.0e-47
WP_010917875.1|2965302_2965506_-|tail	tail fiber protein	tail	NA	NA	NA	NA
WP_000904930.1|2965727_2966288_+	recombinase family protein	NA	A0A0C4UR34	Shigella_phage	75.7	4.3e-75
WP_077821849.1|2966387_2968427_+	sialate O-acetylesterase	NA	S5MDQ7	Escherichia_phage	79.6	1.9e-274
WP_000144787.1|2968573_2968756_+	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	54.4	1.3e-09
WP_001114103.1|2968791_2969037_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_001443803.1|2969646_2969847_+	Com family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000473113.1|2973093_2973408_-	thiosulfate sulfurtransferase PspE	NA	NA	NA	NA	NA
WP_001295585.1|2973482_2973704_-	phage shock protein PspD	NA	NA	NA	NA	NA
WP_000907387.1|2973712_2974072_-	envelope stress response membrane protein PspC	NA	NA	NA	NA	NA
WP_001274963.1|2974071_2974296_-	envelope stress response membrane protein PspB	NA	NA	NA	NA	NA
WP_000511025.1|2974349_2975018_-	phage shock protein PspA	NA	NA	NA	NA	NA
WP_000852835.1|2975184_2976162_+	phage shock protein operon transcriptional activator	NA	NA	NA	NA	NA
WP_000069223.1|2976292_2977558_-	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.7	7.8e-24
WP_000134855.1|2977595_2978876_-	gamma-glutamylputrescine oxidase	NA	NA	NA	NA	NA
WP_001009127.1|2978877_2980365_-	aldehyde dehydrogenase PuuC	NA	NA	NA	NA	NA
WP_001278725.1|2980514_2981072_-	HTH-type transcriptional regulator PuuR	NA	NA	NA	NA	NA
WP_001322278.1|2981098_2981863_-	gamma-glutamyl-gamma-aminobutyrate hydrolase	NA	NA	NA	NA	NA
WP_001298814.1|2982074_2983493_+	glutamate-putrescine ligase	NA	NA	NA	NA	NA
WP_122986108.1|2983641_2983806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302119.1|2983795_2985181_+	putrescine/proton symporter PuuP	NA	NA	NA	NA	NA
WP_001015099.1|2985314_2985560_+	YmjA family protein	NA	NA	NA	NA	NA
WP_001250195.1|2985872_2987516_+	peptide ABC transporter substrate-binding protein SapA	NA	NA	NA	NA	NA
WP_000583277.1|2987512_2988478_+	peptide ABC transporter permease SapB	NA	NA	NA	NA	NA
WP_001146170.1|2988464_2989355_+	peptide ABC transporter permease SapC	NA	NA	NA	NA	NA
WP_001128858.1|2989354_2990347_+	peptide ABC transporter ATP-binding protein SapD	NA	NA	NA	NA	NA
WP_000573412.1|2990348_2991155_+	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
WP_000135022.1|2991206_2992370_-	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.1	6.2e-28
WP_000946218.1|2992378_2993752_-	TolC family protein	NA	NA	NA	NA	NA
WP_000873809.1|2996857_2997979_-	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_000202114.1|2998127_2998694_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000506490.1|2999170_2999959_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_001302118.1|3000102_3001230_+	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000485019.1|3001297_3003232_+	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	2.4e-32
WP_001288364.1|3005599_3005773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001088621.1|3005862_3006612_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000498253.1|3006880_3007099_+	osmotically-inducible lipoprotein OsmB	NA	NA	NA	NA	NA
WP_001303294.1|3007224_3007551_-	stress response translation initiation inhibitor YciH	NA	NA	NA	NA	NA
WP_000176265.1|3007550_3008288_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_000891353.1|3008480_3009650_-	lipopolysaccharide assembly protein LapB	NA	NA	NA	NA	NA
WP_000876292.1|3009656_3009965_-	lipopolysaccharide assembly protein LapA	NA	NA	NA	NA	NA
WP_001256538.1|3010113_3010878_-	phosphatidylglycerophosphatase B	NA	NA	NA	NA	NA
WP_001176295.1|3011047_3011638_+	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
WP_000099451.1|3011701_3014377_-	aconitate hydratase AcnA	NA	NA	NA	NA	NA
WP_001310756.1|3014540_3014636_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233043.1|3014749_3014917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908596.1|3014919_3015084_-	YmiA family putative membrane protein	NA	NA	NA	NA	NA
WP_000776253.1|3015378_3016353_-	HTH-type transcriptional regulator CysB	NA	NA	NA	NA	NA
WP_001295576.1|3016562_3019160_-	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.5	7.0e-88
WP_001031530.1|3019539_3019791_+	YciN family protein	NA	NA	NA	NA	NA
WP_000422055.1|3019826_3020876_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 9
NZ_CP038328	Escherichia coli O157:H7 strain NE 1092-2 chromosome, complete genome	5607499	3037009	3096572	5607499	tail,head,terminase,transposase,capsid,portal,holin	Stx2-converting_phage(37.74%)	68	NA	NA
WP_162829202.1|3037009_3038223_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001144877.1|3039960_3040551_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|3040734_3041382_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|3041518_3041665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|3042092_3042371_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|3042710_3043091_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3043087_3043435_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3043484_3045023_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_024178889.1|3045988_3046558_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|3046623_3047535_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|3047641_3047764_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|3049361_3050687_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|3051713_3051983_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|3051984_3053298_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|3053449_3054049_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_137325071.1|3054116_3056462_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.2	0.0e+00
WP_001304109.1|3056413_3057589_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|3057931_3058564_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|3058509_3059253_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001179481.1|3059263_3059962_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	1.1e-128
WP_000807954.1|3059961_3060303_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_171878586.1|3060295_3063538_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.6	0.0e+00
WP_001453746.1|3063585_3063795_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3063890_3064265_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3064279_3064996_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3065061_3065406_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3065402_3065849_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3065845_3066196_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3066205_3066532_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3066611_3069113_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3069058_3069280_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3069324_3071262_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3071325_3072987_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|3072983_3073547_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3073836_3074202_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|3074243_3074471_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3074895_3075081_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3075308_3075455_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3075454_3076024_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3076294_3076828_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3076878_3077223_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3077227_3077443_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|3077592_3079446_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|3080242_3081301_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|3081451_3081649_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3081890_3082421_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3082429_3082789_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3082801_3083848_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|3083849_3084128_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3084197_3084455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829202.1|3084512_3085726_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000961820.1|3085988_3086201_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3086479_3087238_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3087936_3088101_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3088097_3088679_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|3088865_3089408_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3089319_3090360_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3090331_3090883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3090866_3091094_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3091170_3091578_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3091841_3092141_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3092213_3092432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3092454_3092862_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3092839_3093073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3093066_3093234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3093631_3093820_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3093816_3094008_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|3094100_3096572_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
>prophage 10
NZ_CP038328	Escherichia coli O157:H7 strain NE 1092-2 chromosome, complete genome	5607499	3144689	3249215	5607499	lysis,tail,head,protease,terminase,transposase,capsid,portal,tRNA,integrase,holin	Enterobacteria_phage(47.27%)	109	3178716:3178731	3243118:3243133
WP_001299679.1|3144689_3145946_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3146159_3146783_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3146782_3147634_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3147784_3148732_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3148856_3150536_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3150590_3150869_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3151146_3151731_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3151847_3152939_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000733713.1|3155760_3156831_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3156841_3157474_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3157484_3158903_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001459046.1|3160934_3161135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3161242_3162265_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3162264_3163245_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3163241_3164000_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|3164818_3165673_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3165698_3167669_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3167718_3167973_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_171878588.1|3168821_3170034_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	99.7	3.4e-170
WP_001295616.1|3170222_3170834_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3170933_3171848_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3171943_3173680_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_162829348.1|3173837_3175051_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000197859.1|3175388_3176459_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3176468_3177767_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3178129_3179662_+	SpoVR family protein	NA	NA	NA	NA	NA
3178716:3178731	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3179713_3180433_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3180654_3182196_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3182341_3182872_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3182917_3184186_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3184185_3184605_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3184977_3185889_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3186095_3186557_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3186633_3187293_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3187364_3187658_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3187669_3187828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3187898_3188300_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3188402_3188771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3189290_3189986_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3190009_3190822_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3190825_3191092_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3192327_3192912_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3193410_3194364_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3194550_3196035_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3196337_3197876_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3197925_3198273_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3198269_3198650_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3198725_3198974_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3199030_3199699_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3200196_3200379_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3200457_3200958_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3200994_3201501_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3201519_3202410_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3202529_3203111_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000268883.1|3203110_3206026_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.3	1.5e-57
WP_001230340.1|3206090_3206690_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	8.8e-111
WP_000515612.1|3206756_3210155_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3210215_3210848_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3210784_3211528_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3211533_3212232_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847334.1|3212231_3212561_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	99.1	6.2e-58
WP_000840323.1|3212557_3215107_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3215099_3215534_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3215515_3215938_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3215953_3216694_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3216701_3217097_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3217093_3217672_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3217683_3218037_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3218048_3218447_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3218488_3219514_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3219569_3219902_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3219911_3221231_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3221211_3222813_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3222809_3223016_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3223012_3224938_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3224912_3225458_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3225846_3226041_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3226205_3226412_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3226697_3227108_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3227399_3227693_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3227783_3227966_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3228182_3228659_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3228645_3228951_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3229272_3229962_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3229958_3230099_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3230095_3230458_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3230454_3230745_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3230737_3230908_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3230907_3231363_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3231864_3233391_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3233448_3233571_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3233635_3233968_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3234035_3234338_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3234334_3235036_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3235960_3236197_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3236186_3237329_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3237442_3238693_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3238864_3239518_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3239527_3239989_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3240042_3241149_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3241184_3241826_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3241829_3243200_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3243118:3243133	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3243368_3244040_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3244039_3245500_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3246100_3246382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3246637_3247180_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3247385_3247799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3247811_3248147_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3248159_3249215_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 11
NZ_CP038328	Escherichia coli O157:H7 strain NE 1092-2 chromosome, complete genome	5607499	3255307	3312628	5607499	tail,head,terminase,capsid,portal,integrase,holin	Stx2-converting_phage(25.45%)	70	3298195:3298215	3319285:3319305
WP_000085256.1|3255307_3256537_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3256785_3257907_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3257955_3259182_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3259431_3260568_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3260551_3261415_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3261778_3263140_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3263200_3263476_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3265784_3269186_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001356663.1|3269776_3272125_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3272144_3272234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3272246_3272483_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3272428_3273166_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3273219_3274098_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3274400_3274511_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3274620_3274875_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001179479.1|3274891_3275590_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.4	2.0e-130
WP_000807954.1|3275589_3275931_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_171878589.1|3275923_3279166_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.8	0.0e+00
WP_001453746.1|3279213_3279423_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3279518_3279893_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3279907_3280624_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3280689_3281034_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3281030_3281477_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000126003.1|3281807_3282134_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	99.1	2.7e-53
WP_000267295.1|3282136_3284716_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|3284661_3284883_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3284927_3286865_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3286928_3288590_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_171878590.1|3288586_3289150_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	98.4	2.6e-88
WP_000279786.1|3289439_3289805_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|3289846_3290032_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3290161_3290302_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3290658_3290883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3290947_3291154_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3291381_3291528_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3291527_3292097_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3292367_3292901_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3292951_3293296_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3293300_3293516_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3293591_3293861_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3293898_3294081_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3294228_3296166_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3296480_3296648_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3297244_3298066_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3298062_3298437_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3298195:3298215	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|3298449_3299499_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3299500_3299779_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3299946_3300159_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3300347_3300452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3300567_3301155_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3301157_3301349_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3301350_3301788_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3301774_3302092_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3302045_3302363_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3302352_3302655_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3302651_3302933_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3302965_3303682_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3303715_3304258_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3304169_3305207_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3305275_3305701_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3305684_3306008_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3306132_3306609_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3306924_3307077_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3307191_3307707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3307839_3308229_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3308290_3308560_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3308528_3309647_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3309813_3310608_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3310604_3311651_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3311806_3312628_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3319285:3319305	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 12
NZ_CP038328	Escherichia coli O157:H7 strain NE 1092-2 chromosome, complete genome	5607499	3571773	3627164	5607499	tail,head,protease,transposase,capsid,portal,integrase,holin	Escherichia_phage(29.27%)	60	3573708:3573723	3628929:3628944
WP_000003653.1|3571773_3572361_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3572357_3573065_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3573083_3574877_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3573708:3573723	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3574873_3575992_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3578265_3578535_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268862.1|3578536_3579850_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	2.0e-78
WP_001230371.1|3579914_3580514_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	94.5	5.5e-105
WP_000515110.1|3580581_3584055_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_000649829.1|3584188_3584716_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_050546863.1|3584906_3585539_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194720.1|3585484_3586228_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_171878591.1|3586238_3586937_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	8.4e-129
WP_000847298.1|3586936_3587266_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082466.1|3587262_3589842_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.7	0.0e+00
WP_000533402.1|3589822_3590236_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3590262_3590694_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3590707_3591448_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3591429_3591696_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_001254002.1|3592137_3593643_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3593632_3595225_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3595221_3595428_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3597605_3599144_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3599193_3599541_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3599537_3599918_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3599993_3600269_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3601019_3601226_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3601481_3601754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3601913_3602447_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3602667_3602781_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3603002_3603188_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3603715_3604030_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000874392.1|3605386_3607237_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3608004_3608718_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3609338_3610157_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3610308_3610680_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3610669_3611041_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3611053_3612103_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3612104_3612383_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3612550_3612706_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3612807_3612945_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3613310_3614084_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3614435_3614849_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3614864_3615635_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3615656_3616403_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3616409_3617501_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3617579_3618035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3618241_3618667_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3618650_3618923_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3619031_3619433_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3619460_3619652_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3619651_3619939_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3620216_3620372_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3620513_3620903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3621089_3621275_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3621848_3622037_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3622033_3622225_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3622318_3624790_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3624857_3625100_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3625077_3626097_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3626504_3627164_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3628929:3628944	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 13
NZ_CP038328	Escherichia coli O157:H7 strain NE 1092-2 chromosome, complete genome	5607499	3858094	3896191	5607499	lysis,tail,protease,terminase,portal,integrase,holin	Enterobacteria_phage(51.16%)	50	3857679:3857693	3896265:3896279
3857679:3857693	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3858094_3858793_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3859023_3859905_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3860074_3860236_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3860732_3861752_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3861785_3862766_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3862942_3863212_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741876.1|3863213_3864530_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.4	7.7e-67
WP_001233141.1|3864589_3865189_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3865259_3868673_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3868733_3869342_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3869278_3870022_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3870027_3870726_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3870735_3871065_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3871064_3874130_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3874101_3874431_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3874439_3874826_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3874886_3875630_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3875640_3876042_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3876038_3876617_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_024178878.1|3876628_3876904_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	98.9	1.5e-44
WP_001097050.1|3876896_3877220_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136595.1|3877306_3879334_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_127446149.1|3879278_3879614_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3879735_3880860_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3880787_3881000_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3880996_3883099_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3883098_3883590_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3884264_3884417_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3884404_3884872_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3884868_3885366_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3885365_3885581_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3885723_3886122_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3886202_3886361_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3886446_3887190_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3887373_3888063_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3888077_3888200_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3888537_3889497_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3889708_3890374_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3890370_3890991_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3890983_3891154_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3891150_3891333_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3892030_3892711_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3892707_3892890_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3892862_3893054_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3893064_3893346_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3893444_3893666_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3893876_3894479_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3894721_3894889_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3894928_3895147_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3895420_3896191_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3896265:3896279	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 14
NZ_CP038328	Escherichia coli O157:H7 strain NE 1092-2 chromosome, complete genome	5607499	4439357	4518596	5607499	lysis,tail,head,plate,protease,terminase,transposase,capsid,portal,integrase,holin	Shigella_phage(45.0%)	95	4476474:4476520	4514694:4514740
WP_000998048.1|4439357_4440896_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4440945_4441293_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4441289_4441670_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4441933_4442197_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4442196_4442337_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4442406_4442598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4443422_4443965_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4444039_4444627_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4444684_4445353_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001694227.1|4445378_4447904_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4447893_4449537_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4449505_4450216_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4450528_4450858_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4451105_4451720_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4452137_4452827_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643311.1|4452823_4453780_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4453776_4455975_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4455984_4456941_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4457119_4458247_-	MFS transporter	NA	NA	NA	NA	NA
WP_149005043.1|4458388_4459447_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4459692_4460595_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4461297_4461576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4461742_4462465_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4462563_4463463_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4464138_4465095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4465227_4467561_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4467574_4467898_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4467897_4468119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4468115_4468673_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4468669_4468930_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4469863_4470616_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4470612_4471164_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4471169_4471442_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4471851_4472418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4472417_4473008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4473038_4473671_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4473663_4474122_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4474121_4474739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4475130_4476312_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
4476474:4476520	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000246059.1|4477274_4478018_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355484.1|4478842_4479616_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000905124.1|4479676_4480231_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_001145350.1|4480261_4480672_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	97.6	6.5e-65
WP_001008234.1|4480692_4481136_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_000368084.1|4481107_4481710_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_000554706.1|4481709_4482480_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000383550.1|4482483_4483068_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000785302.1|4483058_4484117_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000424732.1|4484103_4484529_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259066.1|4484528_4485077_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000999513.1|4485076_4486156_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.7	9.1e-207
WP_000219910.1|4486152_4487481_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000807197.1|4487541_4489377_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000661054.1|4489518_4489788_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090993.1|4489787_4490144_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_000155726.1|4490143_4491640_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.6	4.2e-271
WP_000497751.1|4491623_4491794_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779288.1|4491802_4492363_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000224836.1|4492359_4492866_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702395.1|4492840_4493251_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000924828.1|4493247_4493571_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000766100.1|4493649_4494879_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000999805.1|4494889_4495492_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000923141.1|4495484_4496711_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000838374.1|4496700_4496862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128484532.1|4496858_4498355_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000929175.1|4498588_4499083_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	99.4	3.9e-88
WP_001135207.1|4499208_4499559_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	98.3	2.1e-64
WP_000738423.1|4500084_4500378_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4500468_4500651_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001197766.1|4500864_4501341_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120501.1|4501344_4501680_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001449601.1|4501816_4502110_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001310393.1|4502388_4502622_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484663.1|4502765_4503305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001008431.1|4503519_4504272_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_001360050.1|4504285_4505275_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061444.1|4505282_4506092_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|4506111_4506501_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210155.1|4506497_4506824_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	7.8e-53
WP_001303054.1|4506820_4507474_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_072131649.1|4507473_4507968_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.8	4.3e-87
WP_000104949.1|4507964_4508906_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_001250269.1|4508895_4509075_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|4509250_4509802_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|4509794_4510055_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|4510152_4510845_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000917896.1|4511122_4511419_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_001694221.1|4512095_4512632_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.3	9.0e-99
WP_001242749.1|4512622_4512985_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|4512984_4513290_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|4513516_4514680_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893282.1|4514884_4516138_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4514694:4514740	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4516149_4517253_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4517540_4518596_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 15
NZ_CP038328	Escherichia coli O157:H7 strain NE 1092-2 chromosome, complete genome	5607499	4537382	4601655	5607499	tRNA,plate,transposase	uncultured_Caudovirales_phage(33.33%)	52	NA	NA
WP_000027430.1|4537382_4538555_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4538635_4538821_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4538735_4538999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4539200_4540961_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420837.1|4540963_4542100_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001506588.1|4542845_4543385_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000339420.1|4543453_4544962_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_000995683.1|4545143_4545860_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000103125.1|4550307_4552449_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	4.1e-25
WP_001142958.1|4552658_4553177_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4553872_4554373_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4554407_4554632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4554682_4556074_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4556164_4556578_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393849.1|4556581_4558432_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4558395_4559478_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4559502_4560783_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080155.1|4560779_4561304_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246434.1|4561306_4562638_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343292.1|4562642_4563404_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614378.1|4563412_4566202_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.3	1.1e-81
WP_000088854.1|4566198_4566942_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001303798.1|4568494_4571929_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087743.1|4571939_4573349_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001284958.1|4573314_4573794_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000002701.1|4573814_4574036_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|4574114_4574711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|4574713_4575163_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001086136.1|4575640_4576441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301976.1|4576978_4577710_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_000917883.1|4577774_4578242_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301721.1|4578238_4578961_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|4578994_4579750_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644686.1|4579821_4581180_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211693.1|4581227_4581998_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4582075_4582876_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648586.1|4583116_4584031_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997018.1|4584027_4584831_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_001140187.1|4590590_4591166_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4591353_4592385_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294606.1|4592377_4593031_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874227.1|4593070_4593886_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202328.1|4594003_4594408_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094000.1|4594404_4595112_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260720.1|4595222_4596941_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001302206.1|4596993_4597818_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239181.1|4598017_4598728_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635546.1|4598741_4599152_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185286.1|4599148_4599694_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|4599859_4600060_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|4600046_4600307_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176537.1|4600359_4601655_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
>prophage 16
NZ_CP038328	Escherichia coli O157:H7 strain NE 1092-2 chromosome, complete genome	5607499	5199619	5249444	5607499	tail,head,terminase,capsid,tRNA,integrase,holin	Stx2-converting_phage(35.09%)	60	5192436:5192451	5236530:5236545
5192436:5192451	attL	ATGCTGGTGGCAGGAA	NA	NA	NA	NA
WP_000543822.1|5199619_5200657_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332271.1|5200745_5201843_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.7	9.5e-212
WP_001217539.1|5201904_5202153_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_001121225.1|5202746_5203397_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_001023407.1|5204636_5204906_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_106918319.1|5204907_5206221_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.5	1.3e-77
WP_001216290.1|5206285_5206909_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	60.4	1.1e-68
WP_171878593.1|5206977_5210454_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	95.7	0.0e+00
WP_064761467.1|5210699_5211329_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	98.6	1.2e-102
WP_025404499.1|5211274_5212018_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.0	2.1e-146
WP_001357740.1|5212023_5212722_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000807964.1|5212721_5213063_-|tail	phage tail protein	tail	A0A0P0ZCS8	Stx2-converting_phage	100.0	8.7e-63
WP_171878594.1|5213055_5216298_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.1	0.0e+00
WP_001513217.1|5216345_5216555_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_000710952.1|5216650_5217025_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275483.1|5217039_5217756_-	immunoglobulin domain-containing protein	NA	B6DZA6	Enterobacteria_phage	99.6	2.1e-127
WP_000133388.1|5217821_5218166_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|5218162_5218609_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007905.1|5218605_5218956_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|5218966_5219293_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|5221819_5222041_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173079.1|5222085_5224023_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_001365116.1|5224086_5225748_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.8	0.0e+00
WP_000958380.1|5225744_5226308_-|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_001303046.1|5226597_5226963_-	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000095749.1|5227004_5227232_+	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_012816791.1|5227656_5227842_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|5228069_5228216_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|5228215_5228785_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992166.1|5229055_5229589_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	5.6e-101
WP_000731236.1|5229639_5229984_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_024164617.1|5229988_5230204_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_024247920.1|5230642_5232493_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.4	0.0e+00
WP_000466957.1|5233065_5233497_-	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_000301785.1|5233946_5234660_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917737.1|5234794_5234992_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_001038609.1|5235264_5235711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204819.1|5235791_5236157_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	82.6	1.6e-54
WP_001360050.1|5236174_5237164_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
5236530:5236545	attR	ATGCTGGTGGCAGGAA	NA	NA	NA	NA
WP_024219727.1|5237171_5237981_-	KilA-N domain-containing protein	NA	A5LH75	Enterobacteria_phage	99.6	2.4e-151
WP_000210134.1|5238385_5238712_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	5.9e-53
WP_001343335.1|5238708_5239362_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	9.6e-127
WP_001359043.1|5239361_5239856_-	PerC family transcriptional regulator	NA	K7PJR0	Enterobacteria_phage	99.4	1.9e-87
WP_000061529.1|5239852_5240671_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	100.0	1.8e-122
WP_000620696.1|5240667_5240892_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_001689565.1|5240888_5242049_-	Rha family phage regulatory protein	NA	K7PLX4	Enterobacteria_phage	78.3	7.6e-159
WP_062859755.1|5242045_5242630_-	hypothetical protein	NA	A0A1C9II13	Salmonella_phage	60.9	9.3e-57
WP_001231956.1|5242657_5242855_-	Cro/Cl family transcriptional regulator	NA	K7PHB1	Enterobacterial_phage	56.9	1.1e-14
WP_000981537.1|5242950_5243604_+	helix-turn-helix domain-containing protein	NA	K7PLZ5	Enterobacterial_phage	60.8	5.7e-71
WP_000135680.1|5244061_5244424_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081287.1|5244489_5245314_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_096850447.1|5245441_5245978_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	97.8	4.5e-98
WP_001242740.1|5245968_5246319_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145671.1|5246315_5246789_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_000829413.1|5246935_5247403_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.1	1.1e-36
WP_001014294.1|5247404_5247596_+	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_001094871.1|5247598_5248333_+	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
WP_001061339.1|5248332_5248905_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001093919.1|5248941_5249223_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	96.8	2.2e-43
WP_000390073.1|5249270_5249444_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	94.7	6.4e-22
>prophage 1
NZ_CP038330	Escherichia coli O157:H7 strain NE 1092-2 plasmid pNE1092-3, complete sequence	93970	18006	57068	93970	transposase	Escherichia_phage(33.33%)	48	NA	NA
WP_001067855.1|18006_18711_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067855.1|19261_19966_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000794249.1|20120_21038_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_001049717.1|21021_21648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000805625.1|21644_21926_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_001326174.1|22070_22448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001231464.1|22771_23434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000869297.1|23433_23811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000122507.1|23820_24267_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743449.1|24276_24906_-	DUF4400 domain-containing protein	NA	NA	NA	NA	NA
WP_000332868.1|24862_25447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178857.1|25457_27323_-	conjugative transfer system coupling protein TraD	NA	NA	NA	NA	NA
WP_001326173.1|27319_30292_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_001249395.1|30459_31077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001191890.1|31058_31292_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000366823.1|31291_33484_+	DNA topoisomerase 3	NA	A0A1X9I6W8	Streptococcus_phage	29.4	9.9e-43
WP_000467110.1|33498_33987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001326171.1|34077_34377_-	hypothetical protein	NA	A0A0K1LLW2	Caulobacter_phage	55.4	3.6e-20
WP_000464630.1|34588_35206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000268552.1|35261_35918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000936897.1|35917_37345_-	DNA cytosine methyltransferase	NA	NA	NA	NA	NA
WP_000647188.1|37348_37849_-	hypothetical protein	NA	I3UMJ0	Colwellia_phage	38.4	9.5e-18
WP_001447539.1|37857_38169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001326170.1|38174_38606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000344149.1|38673_39348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000044823.1|39322_39604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125904.1|39596_39974_-	hypothetical protein	NA	A0A2H4P7P5	Pseudomonas_phage	49.6	1.7e-22
WP_000939033.1|40300_40444_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000074431.1|40535_41171_+	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_000703827.1|41223_41496_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001207227.1|41544_42726_-	ParB/RepB/Spo0J family partition protein	NA	I3NLC2	Bifidobacterium_phage	28.7	2.4e-11
WP_001151304.1|42729_43515_-	ParA family protein	NA	A0A1X9IGI7	Lactococcus_phage	26.4	6.1e-11
WP_000338945.1|43688_44000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|44306_45122_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_001082319.1|45182_45986_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	NA	NA	NA	NA
WP_000480968.1|45985_46822_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_000844627.1|47127_47370_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000164043.1|47401_48052_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_000804063.1|48157_49357_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_001255015.1|49623_49929_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001694495.1|49956_51171_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	29.1	7.2e-19
WP_001447541.1|51387_52272_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001120888.1|52302_53796_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000743213.1|54006_54231_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001366550.1|54227_54965_-	recombinase family protein	NA	NA	NA	NA	NA
WP_001044210.1|55450_55591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|55596_56301_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001067858.1|56363_57068_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
