The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038336	Escherichia coli O157:H7 strain LSU61 chromosome, complete genome	5512129	1278892	1380082	5512129	protease,head,tRNA,integrase,tail,portal,capsid,holin,terminase	Stx2-converting_phage(37.5%)	108	1280050:1280073	1305833:1305856
WP_072145424.1|1278892_1279102_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	70.2	1.7e-08
WP_001120794.1|1279256_1279376_+	hypothetical protein	NA	NA	NA	NA	NA
1280050:1280073	attL	CTGAATTTGGCCACCTGAACAGAG	NA	NA	NA	NA
WP_000736914.1|1281361_1281802_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	99.3	4.5e-80
WP_000145931.1|1281875_1282166_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788871.1|1282162_1282864_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	100.0	3.4e-130
WP_171877220.1|1282860_1283760_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	98.7	1.8e-171
WP_000438490.1|1283792_1284092_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	96.0	2.0e-47
WP_000067727.1|1284233_1284449_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_096246228.1|1284522_1285218_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.1	4.3e-133
WP_000708836.1|1285345_1286203_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	39.7	5.8e-39
WP_100207026.1|1286536_1286668_+	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	95.3	2.1e-17
WP_000088205.1|1286645_1286918_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.2e-40
WP_000392425.1|1287202_1287652_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	88.6	1.9e-70
WP_000065374.1|1287847_1288216_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	100.0	2.0e-65
WP_001198854.1|1288288_1288453_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	A0A0N6WES3	Escherichia_phage	98.1	4.0e-26
WP_000372923.1|1288421_1288565_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	97.9	2.7e-18
WP_000995439.1|1288640_1288937_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100845.1|1288942_1289728_+	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000186716.1|1289724_1290405_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_000682317.1|1290401_1290584_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	98.3	2.8e-28
WP_000548523.1|1290556_1290748_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	95.2	1.8e-25
WP_013009268.1|1290758_1291040_+	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	97.8	4.6e-46
WP_000774248.1|1291138_1291360_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001290004.1|1291356_1292175_+	ead/Ea22-like family protein	NA	A0A1I9LJM5	Stx_converting_phage	57.9	6.7e-61
WP_000628781.1|1292171_1292675_+	DUF551 domain-containing protein	NA	A0A088CE95	Shigella_phage	43.6	4.7e-57
WP_000457735.1|1292762_1293005_+	DUF4222 domain-containing protein	NA	H6WZF9	Escherichia_phage	100.0	1.2e-37
WP_001030150.1|1293008_1293155_+	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	89.6	1.6e-21
WP_000516609.1|1293327_1294512_+	DUF3596 domain-containing protein	NA	I6PDJ1	Cronobacter_phage	87.4	3.4e-199
WP_000101040.1|1295004_1295928_+	DUF4760 domain-containing protein	NA	A0A1B5FPC5	Escherichia_phage	87.1	2.6e-154
WP_001358980.1|1296218_1297448_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	99.3	4.9e-233
WP_000448924.1|1297486_1297903_+	hypothetical protein	NA	A0A1B5FPM5	Escherichia_phage	98.6	1.1e-70
WP_001359379.1|1299770_1300385_-	His-Xaa-Ser repeat protein HxsA	NA	NA	NA	NA	NA
WP_000005567.1|1300381_1301494_-	His-Xaa-Ser system radical SAM maturase HxsC	NA	NA	NA	NA	NA
WP_001254222.1|1302833_1303016_+	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	100.0	1.9e-29
WP_001505174.1|1303519_1305292_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	99.5	0.0e+00
WP_001108081.1|1305881_1306448_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
1305833:1305856	attR	CTCTGTTCAGGTGGCCAAATTCAG	NA	NA	NA	NA
WP_001223952.1|1306422_1307034_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	96.1	6.5e-93
WP_001028854.1|1307030_1307696_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1307692_1308316_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1308568_1309312_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1309397_1309565_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_171877221.1|1309972_1311826_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_000284517.1|1311975_1312191_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1312195_1312540_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992167.1|1312590_1313124_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_001056806.1|1313394_1313964_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1313963_1314110_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1314337_1314523_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1314947_1315175_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|1315216_1315582_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958416.1|1315870_1316434_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_171877222.1|1316430_1318092_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_171877223.1|1318155_1320093_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.7	0.0e+00
WP_001063099.1|1320137_1320359_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_171877224.1|1320304_1322884_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.9	0.0e+00
WP_000125990.1|1322886_1323213_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|1323222_1323573_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_171877225.1|1323569_1324016_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	9.9e-75
WP_000133388.1|1324012_1324357_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275439.1|1324422_1325139_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.2	2.3e-126
WP_000710952.1|1325153_1325528_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|1325623_1325833_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000807954.1|1329114_1329456_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152182.1|1329455_1330154_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000194723.1|1330164_1330908_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_143212334.1|1330853_1331483_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	97.1	1.2e-102
WP_001230309.1|1335267_1335867_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	99.5	3.0e-111
WP_171877226.1|1335931_1337245_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	1.1e-76
WP_001502488.1|1337246_1337516_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q6H9S8	Enterobacteria_phage	97.8	1.1e-44
WP_000442132.1|1337676_1338099_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1338228_1339287_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1339365_1340016_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_171877227.1|1340198_1340789_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1341290_1341539_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1342384_1342867_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_000600190.1|1342998_1343475_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117838.1|1343464_1343755_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|1343816_1344158_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880923.1|1344306_1345968_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059169.1|1346053_1346932_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001296310.1|1347054_1347648_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_077626229.1|1347702_1348989_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|1349010_1349802_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|1349968_1351330_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|1351466_1351715_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|1351733_1352282_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_000264777.1|1352312_1353080_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|1353121_1353469_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589828.1|1353545_1354028_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969027.1|1354043_1355270_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001212391.1|1355259_1355778_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001301878.1|1355927_1356293_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168032.1|1356502_1357573_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	6.9e-90
WP_000225204.1|1357583_1358705_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_000200120.1|1358747_1359908_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|1360006_1360054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|1360157_1360499_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000197686.1|1360769_1361507_-	outer membrane protein assembly factor BamD	NA	NA	NA	NA	NA
WP_000079092.1|1361641_1362622_+	23S rRNA pseudouridine(1911/1915/1917) synthase RluD	NA	NA	NA	NA	NA
WP_000040152.1|1362618_1363350_+	polyphenol oxidase	NA	NA	NA	NA	NA
WP_001235102.1|1363479_1366053_+	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
WP_000852126.1|1371826_1373125_+	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	7.4e-46
WP_001322343.1|1373121_1373445_-	YfiM family lipoprotein	NA	NA	NA	NA	NA
WP_000949265.1|1373490_1374846_-	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_000082974.1|1374959_1377620_-	protein lysine acetyltransferase	NA	NA	NA	NA	NA
WP_000138184.1|1377651_1378350_-	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001098726.1|1378418_1378838_-	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_000997410.1|1379044_1380082_+|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP038336	Escherichia coli O157:H7 strain LSU61 chromosome, complete genome	5512129	1621652	1627078	5512129	integrase	Enterobacteria_phage(50.0%)	6	1610640:1610656	1629274:1629290
1610640:1610656	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1621652_1622222_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1622221_1622689_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1622675_1623356_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1623365_1624502_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1624676_1625834_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1626145_1627078_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1629274:1629290	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038336	Escherichia coli O157:H7 strain LSU61 chromosome, complete genome	5512129	1871291	1880737	5512129		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569336.1|1871291_1872218_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1872222_1872954_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216962.1|1872934_1873042_-	protein YohO	NA	NA	NA	NA	NA
WP_001240409.1|1873101_1873833_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	1.5e-112
WP_001359340.1|1874054_1875740_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.8	5.1e-305
WP_000598641.1|1875736_1876456_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1876502_1876973_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1877014_1877476_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001359847.1|1877600_1879604_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	99.9	0.0e+00
WP_001359846.1|1879600_1880737_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
>prophage 4
NZ_CP038336	Escherichia coli O157:H7 strain LSU61 chromosome, complete genome	5512129	2037012	2108554	5512129	head,tail,portal,capsid,transposase,holin,terminase	Escherichia_phage(28.57%)	66	NA	NA
WP_171877233.1|2037012_2038227_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	56.6	4.1e-99
WP_000502859.1|2038653_2039292_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.0	1.6e-54
WP_001359833.1|2039662_2041810_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000973176.1|2043481_2044027_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2044023_2044767_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2044778_2045858_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2045919_2046855_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2047311_2048229_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2048330_2049281_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122995687.1|2049398_2051042_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2051667_2052384_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2052726_2054181_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2054282_2055599_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2055913_2056966_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_138976839.1|2057227_2065210_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_001302302.1|2065699_2066497_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000094838.1|2067757_2067961_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_171877234.1|2068019_2070491_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2070586_2070775_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2070771_2070960_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2071440_2071593_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444615.1|2071867_2072512_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2072609_2072837_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2072833_2073259_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262408.1|2073327_2074365_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	67.1	1.7e-85
WP_000373320.1|2074396_2074819_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	96.4	5.0e-76
WP_000450610.1|2074853_2075552_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_171877235.1|2075573_2075855_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	4.5e-09
WP_001290006.1|2075794_2076151_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2076183_2076336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001273106.1|2076332_2076644_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2076770_2077334_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2077443_2077548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2077734_2077947_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001341388.1|2078114_2078393_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265075.1|2078394_2079444_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2079456_2079816_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001254932.1|2079924_2081076_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_171877377.1|2081071_2081725_+	antiterminator	NA	I6PDF8	Cronobacter_phage	50.7	1.7e-54
WP_171877236.1|2083268_2085119_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.1	0.0e+00
WP_024165672.1|2085410_2085626_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731192.1|2085630_2085975_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000992126.1|2086025_2086559_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2086714_2086897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2086909_2087041_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2087268_2087454_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2087980_2088295_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2088376_2088601_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2088995_2089505_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_171877237.1|2089476_2091405_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	6.7e-261
WP_000259002.1|2091388_2091595_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_171877238.1|2091591_2093184_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	2.7e-183
WP_000256723.1|2094715_2095063_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001452698.1|2095120_2095387_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2095368_2096109_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2096122_2096554_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533403.1|2096580_2096994_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_171877239.1|2096974_2099554_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.2	0.0e+00
WP_000847304.1|2099550_2099880_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001152182.1|2099879_2100578_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000194723.1|2100588_2101332_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_171877378.1|2101277_2101910_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	96.7	1.2e-102
WP_000649829.1|2102100_2102628_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_025404308.1|2106305_2106905_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	99.0	2.0e-110
WP_171877240.1|2106969_2108283_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	2.2e-77
WP_001023990.1|2108284_2108554_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	97.8	1.7e-45
>prophage 5
NZ_CP038336	Escherichia coli O157:H7 strain LSU61 chromosome, complete genome	5512129	2169508	2203273	5512129	head,tail,integrase,portal,capsid,plate,holin,terminase	Enterobacteria_phage(85.37%)	47	2167022:2167036	2204184:2204198
2167022:2167036	attL	TCCGCAGGAAAAAGC	NA	NA	NA	NA
WP_000005445.1|2169508_2170693_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	97.0	3.5e-220
WP_000290456.1|2170692_2171205_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2171259_2171625_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2171633_2171789_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000853406.1|2171775_2174583_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	90.3	0.0e+00
WP_000979955.1|2174595_2175084_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2175240_2175813_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001414827.1|2175856_2176435_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	2.0e-96
WP_171877242.1|2176443_2177346_-	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	63.9	6.8e-99
WP_171877243.1|2177342_2179502_-|tail	tail fiber protein	tail	A0A0A7NV63	Enterobacteria_phage	95.8	6.6e-108
WP_000071706.1|2179504_2180035_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	1.6e-92
WP_001111935.1|2180027_2180924_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	5.7e-154
WP_001067548.1|2180927_2181257_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001476003.1|2181274_2181841_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	1.1e-99
WP_000356352.1|2181852_2182488_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	1.5e-113
WP_000920594.1|2182480_2182948_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000780536.1|2183085_2183493_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	1.9e-64
WP_000072328.1|2183489_2183882_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	99.2	1.3e-70
WP_000104350.1|2183878_2184202_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864897.1|2184204_2184405_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.0e-32
WP_000063103.1|2184404_2184899_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632345.1|2185000_2185801_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.1	6.0e-131
WP_001055104.1|2185846_2186899_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.7	1.3e-194
WP_001262671.1|2186922_2187759_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	99.6	6.0e-150
WP_000613756.1|2187913_2189665_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	98.3	0.0e+00
WP_000087821.1|2189664_2190711_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	99.7	7.4e-206
WP_001068330.1|2191359_2191857_+	DUF4760 domain-containing protein	NA	NA	NA	NA	NA
WP_000193206.1|2191896_2192739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000211280.1|2192821_2193136_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686522.1|2193140_2194100_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.4	1.1e-179
WP_000123459.1|2194176_2196999_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.8	0.0e+00
WP_000599379.1|2197005_2197371_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2197367_2197985_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2197996_2198296_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2198292_2198559_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2198555_2198759_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2198782_2199199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2199291_2199405_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2199401_2199644_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2199655_2199934_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2199944_2200295_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2200316_2200520_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2200591_2200729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2200818_2201223_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2201238_2201889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2201918_2202266_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2202271_2203273_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2204184:2204198	attR	TCCGCAGGAAAAAGC	NA	NA	NA	NA
>prophage 6
NZ_CP038336	Escherichia coli O157:H7 strain LSU61 chromosome, complete genome	5512129	2522503	2687849	5512129	protease,head,tail,integrase,portal,capsid,transposase,holin,terminase	Escherichia_phage(27.89%)	194	2543694:2543741	2647512:2647559
WP_001260835.1|2522503_2523325_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2523424_2523508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2523600_2523936_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2524332_2525586_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2525692_2526586_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2526720_2527941_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2528065_2528761_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2528713_2530006_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2530163_2530778_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2530820_2531675_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2531676_2532294_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2532304_2534728_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041705.1|2534788_2537215_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	4.2e-212
WP_000778147.1|2537413_2537719_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2537826_2538537_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2538539_2539100_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2539134_2539476_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001358609.1|2539610_2539937_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
2543694:2543741	attL	ACCTCATTACAGATTTAAGGGTGAACAAATCCCTGCCATTGCTGGCAT	NA	NA	NA	NA
WP_001090200.1|2543777_2543969_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2543965_2544154_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2544554_2544719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2544722_2544941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2545012_2545312_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2545664_2545943_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2545944_2546136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2546156_2546528_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2546625_2546928_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2546924_2547350_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2547372_2548335_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2548341_2549082_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_000450876.1|2549107_2549878_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.7	2.0e-83
WP_001118159.1|2549893_2550289_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_171877379.1|2550345_2550870_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	86.4	2.1e-23
WP_001278460.1|2551045_2551150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2551336_2551549_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2551716_2551995_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2551996_2553046_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217457.1|2553058_2553418_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	4.1e-39
WP_001059381.1|2553414_2554104_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_171877244.1|2555644_2557495_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_024164617.1|2557932_2558148_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000731241.1|2558152_2558497_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992167.1|2558547_2559081_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_001056806.1|2559351_2559921_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2559920_2560067_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2560294_2560480_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2560904_2561132_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|2561173_2561539_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958416.1|2561827_2562391_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_171877222.1|2562387_2564049_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.9	0.0e+00
WP_171877245.1|2564112_2566050_+|capsid	phage major capsid protein	capsid	H6WZL0	Escherichia_phage	99.8	0.0e+00
WP_001063099.1|2566094_2566316_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_171877224.1|2566261_2568841_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.9	0.0e+00
WP_000125990.1|2568843_2569170_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|2569179_2569530_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_171877225.1|2569526_2569973_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	9.9e-75
WP_000133388.1|2569969_2570314_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275439.1|2570379_2571096_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.2	2.3e-126
WP_000710952.1|2571110_2571485_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2571580_2571790_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000807954.1|2575071_2575413_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152182.1|2575412_2576111_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000194723.1|2576121_2576865_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_050439450.1|2576810_2577443_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_171877246.1|2577785_2581259_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.0	0.0e+00
WP_001228290.1|2581326_2581926_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	97.0	4.1e-108
WP_106904145.1|2582077_2583391_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.4	6.9e-76
WP_001023477.1|2583392_2583662_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	96.6	1.0e-42
WP_001025672.1|2584689_2586015_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_106409364.1|2587611_2587734_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_000950979.1|2587840_2588752_+	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_000938103.1|2588817_2589387_+	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_001303943.1|2590554_2590833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2591260_2591407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2591543_2592191_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2592374_2592965_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001345079.1|2594471_2595122_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_000113674.1|2596433_2597564_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000113189.1|2597541_2597790_-	excisionase	NA	NA	NA	NA	NA
WP_171877247.1|2597854_2600326_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_001090200.1|2600418_2600610_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2600606_2600795_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001356681.1|2601192_2601360_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000920491.1|2601353_2601587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2601564_2601972_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_001171903.1|2601994_2602213_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240336.1|2602285_2602585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787428.1|2602849_2603257_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912298.1|2603333_2603561_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705622.1|2603544_2604096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020556.1|2604067_2605108_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_157825328.1|2605019_2605562_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000450692.1|2605595_2606330_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_001505071.1|2606326_2606491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001449026.1|2607189_2607948_+	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_000961821.1|2608226_2608439_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001217394.1|2608659_2608917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2608986_2609265_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_171877248.1|2609266_2610316_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	8.5e-109
WP_171877249.1|2610328_2610688_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	3.9e-37
WP_000640048.1|2610696_2611227_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000917750.1|2611468_2611666_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000935547.1|2611816_2612875_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.6	4.7e-200
WP_171877250.1|2613671_2615525_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000284517.1|2615674_2615890_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|2615894_2616239_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992167.1|2616289_2616823_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_001056806.1|2617093_2617663_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2617662_2617809_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001208682.1|2618036_2618243_+	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000735655.1|2618307_2618532_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347013.1|2618888_2619029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302977.1|2619158_2619344_-	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000279786.1|2619385_2619751_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958366.1|2620040_2620604_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	92.0	1.6e-82
WP_096911981.1|2620600_2622262_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	98.4	0.0e+00
WP_171877251.1|2622325_2624251_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	98.3	0.0e+00
WP_025380550.1|2624295_2624517_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	91.8	3.9e-32
WP_000125988.1|2626548_2626875_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2626884_2627235_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2627231_2627678_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133393.1|2627674_2628019_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_001275479.1|2628086_2628803_+	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_001030063.1|2628808_2629183_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453746.1|2629278_2629488_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000807954.1|2632769_2633111_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152180.1|2633110_2633548_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	5.0e-63
WP_171877252.1|2633736_2637210_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	90.3	0.0e+00
WP_171877253.1|2637277_2637877_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	89.9	9.1e-100
WP_171877254.1|2637941_2639255_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.3	3.7e-77
WP_001023357.1|2639256_2639526_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_001131642.1|2639639_2640215_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121225.1|2640925_2641576_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000343700.1|2641725_2642934_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	1.6e-47
WP_001120551.1|2642983_2643226_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001206148.1|2643403_2644699_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	62.3	2.5e-155
WP_000005551.1|2644718_2644970_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_000102122.1|2645042_2647505_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.7	2.3e-125
WP_000199475.1|2647597_2647786_-	DUF1482 family protein	NA	NA	NA	NA	NA
2647512:2647559	attR	ACCTCATTACAGATTTAAGGGTGAACAAATCCCTGCCATTGCTGGCAT	NA	NA	NA	NA
WP_000449175.1|2647782_2647971_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2648535_2648745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2648745_2649384_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2649395_2649548_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2649840_2650179_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_171877255.1|2650570_2650813_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693816.1|2650796_2651222_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_057711673.1|2651290_2652334_+	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	65.5	2.1e-83
WP_000139447.1|2652326_2652788_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2652821_2653538_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2653570_2653852_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2653848_2654076_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2654068_2654380_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2654507_2654726_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2654727_2655285_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2655518_2655731_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_171877256.1|2655850_2656195_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	98.2	3.9e-55
WP_000191872.1|2656316_2656589_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2656590_2657640_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217447.1|2657652_2658012_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.5	5.0e-37
WP_000640035.1|2658020_2658575_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2658799_2658997_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2659133_2659847_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001359877.1|2660297_2660729_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	3.6e-66
WP_171877244.1|2661207_2663058_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_024164617.1|2663495_2663711_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000731241.1|2663715_2664060_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992167.1|2664110_2664644_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_001056806.1|2664914_2665484_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539795.1|2665483_2665630_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001208680.1|2665852_2666038_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302717.1|2666563_2666878_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2666959_2667184_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2667570_2668116_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2668090_2670016_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2670012_2670219_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001359963.1|2670215_2671817_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.3	1.1e-306
WP_000123329.1|2671797_2673117_+	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.4	2.6e-232
WP_001295978.1|2673126_2673459_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063284.1|2673514_2674540_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.4	6.0e-192
WP_000158906.1|2674581_2674980_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2674991_2675345_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2675359_2675893_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683058.1|2675889_2676243_+	hypothetical protein	NA	A0A2R9YJI2	Escherichia_phage	80.3	2.3e-50
WP_000235090.1|2676292_2677045_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2677058_2677481_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2677507_2677921_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_171877257.1|2677901_2680514_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	94.1	0.0e+00
WP_000847306.1|2680510_2680840_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_171877258.1|2680839_2681538_+|tail	phage minor tail protein L	tail	Q687F1	Enterobacteria_phage	99.1	6.2e-132
WP_171877259.1|2681548_2682292_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.1	3.4e-144
WP_171877380.1|2682237_2682870_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	4.6e-102
WP_171877260.1|2685600_2686200_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	1.7e-106
WP_171877261.1|2686264_2687578_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	99.1	9.7e-78
WP_001101700.1|2687579_2687849_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	97.8	1.9e-44
>prophage 7
NZ_CP038336	Escherichia coli O157:H7 strain LSU61 chromosome, complete genome	5512129	2877201	2944058	5512129	lysis,tRNA,head,tail	Salmonella_phage(43.48%)	99	NA	NA
WP_000081418.1|2877201_2878137_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_000123712.1|2878265_2879639_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.9	5.6e-52
WP_001625136.1|2879671_2879842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000387388.1|2880116_2881100_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001046821.1|2882607_2883171_-	DNA endonuclease SmrA	NA	NA	NA	NA	NA
WP_000885454.1|2883500_2884409_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000444937.1|2884584_2885895_+	p-aminobenzoyl-glutamate hydrolase subunit AbgA	NA	NA	NA	NA	NA
WP_001156434.1|2885894_2887340_+	p-aminobenzoyl-glutamate hydrolase subunit AbgB	NA	NA	NA	NA	NA
WP_000062967.1|2887376_2888903_+	p-aminobenzoyl-glutamate transporter	NA	NA	NA	NA	NA
WP_000945010.1|2888913_2889429_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.1	2.4e-24
WP_000611911.1|2889623_2890376_+	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_001262123.1|2890527_2891478_+	universal stress protein UspE	NA	NA	NA	NA	NA
WP_000605090.1|2891527_2891785_-	DUF2534 family protein	NA	NA	NA	NA	NA
WP_000559900.1|2892028_2893060_+	low conductance mechanosensitive channel YnaI	NA	NA	NA	NA	NA
WP_171877264.1|2893110_2894721_-	murein tripeptide ABC transporter substrate-binding protein MppA	NA	NA	NA	NA	NA
WP_171877265.1|2894819_2897264_-|tail	tail fiber domain-containing protein	tail	A0A1V0DZD2	Escherichia_phage	80.4	3.4e-209
WP_171877266.1|2897621_2898557_+	hypothetical protein	NA	Q333E0	Escherichia_virus	62.4	1.4e-110
WP_171877267.1|2898557_2901992_-	DUF1983 domain-containing protein	NA	I6R9B3	Salmonella_phage	55.5	0.0e+00
WP_171877268.1|2902004_2902535_-|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	50.6	8.2e-36
WP_171877269.1|2902477_2903209_-	C40 family peptidase	NA	Q5G8W2	Enterobacteria_phage	63.6	8.9e-89
WP_171877381.1|2903211_2903916_-|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	70.0	1.5e-96
WP_153302702.1|2904055_2904214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096924023.1|2904236_2904590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171877270.1|2904599_2904848_+	phage antirepressor KilAC domain-containing protein	NA	NA	NA	NA	NA
WP_171877271.1|2905087_2905441_-|tail	phage tail protein	tail	A0A1V0E5N3	Salmonella_phage	67.8	3.3e-41
WP_171877272.1|2905610_2905766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171877273.1|2905783_2906038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171877274.1|2906177_2908520_-	tape measure protein	NA	A0A291AXC6	Shigella_phage	38.8	4.2e-47
WP_096924028.1|2908822_2909236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171877275.1|2909251_2909929_-	hypothetical protein	NA	I6R0Q2	Salmonella_phage	42.0	2.9e-41
WP_075842243.1|2909983_2910460_-	hypothetical protein	NA	A0A1V0E5P2	Salmonella_phage	62.7	5.1e-53
WP_171877276.1|2910472_2910859_-	hypothetical protein	NA	A0A1V0E5P4	Salmonella_phage	61.7	9.5e-42
WP_171877277.1|2910855_2911320_-	hypothetical protein	NA	A0A1V0E5P5	Salmonella_phage	49.7	1.3e-32
WP_075842240.1|2911322_2911691_-	hypothetical protein	NA	Q5G8X6	Enterobacteria_phage	50.8	3.6e-30
WP_075842239.1|2911683_2911869_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075842238.1|2911871_2912258_-	hypothetical protein	NA	A0A1V0E5R0	Salmonella_phage	61.7	3.1e-40
WP_096924032.1|2912323_2913376_-	hypothetical protein	NA	Q5G8Y0	Enterobacteria_phage	62.1	3.4e-126
WP_096924033.1|2913395_2913806_-	hypothetical protein	NA	I6S1Q2	Salmonella_phage	50.0	4.1e-27
WP_171877278.1|2913816_2915103_-	hypothetical protein	NA	A0A1V0E5Q9	Salmonella_phage	54.4	4.4e-115
WP_171877382.1|2915093_2915990_-|head	phage head morphogenesis protein	head	H6WRT1	Salmonella_phage	49.5	8.4e-73
WP_171877279.1|2915979_2917353_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	57.5	3.7e-144
WP_096924036.1|2917431_2918910_-	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	69.4	3.5e-201
WP_075842232.1|2918912_2919398_-	DNA-binding protein	NA	Q716H4	Shigella_phage	40.3	1.4e-21
WP_171877280.1|2920007_2920397_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171877281.1|2920383_2920926_-	hypothetical protein	NA	Q76H27	Enterobacteria_phage	42.4	5.5e-19
WP_171877282.1|2921204_2921675_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_171877383.1|2921662_2922151_-	lysozyme	NA	A0A1V0E5Q7	Salmonella_phage	62.2	5.6e-55
WP_171877283.1|2922155_2922356_-	hypothetical protein	NA	A0A1V0E5H9	Salmonella_phage	49.0	8.8e-07
WP_171877284.1|2922461_2922638_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171877285.1|2922634_2922817_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171877286.1|2922817_2923042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171877287.1|2923031_2923232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171877288.1|2923224_2923365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171877289.1|2923367_2923619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171877290.1|2923602_2923926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171877291.1|2923929_2924184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171877292.1|2924203_2924461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171877293.1|2924463_2924763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162744413.1|2924806_2924947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171877294.1|2924958_2925231_-	hypothetical protein	NA	A0A023MHY3	Escherichia_phage	80.7	3.6e-35
WP_171877295.1|2925333_2925549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_149858471.1|2925558_2925771_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171877296.1|2925760_2926045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024189074.1|2926044_2926296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001703259.1|2926286_2926502_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096978491.1|2926506_2926734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171877297.1|2926730_2926964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094058197.1|2926974_2927205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171877298.1|2927195_2927561_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096978493.1|2927565_2927778_-	hypothetical protein	NA	A0A1P8DTK9	Salmonella_phage	53.6	1.6e-11
WP_094058196.1|2927767_2927983_-	hypothetical protein	NA	C0LP33	Escherichia_virus	54.2	3.5e-09
WP_094058195.1|2927979_2928288_-	RNA-binding protein	NA	I6S5Y4	Salmonella_phage	61.8	1.7e-25
WP_171877215.1|2928277_2928550_-	hypothetical protein	NA	A0A2H4PRP0	Proteus_phage	45.6	8.6e-05
WP_023156565.1|2928536_2928737_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171877299.1|2928736_2929459_-	antitermination protein	NA	A0A0M4RTW7	Salmonella_phage	36.2	1.9e-38
WP_171877300.1|2929458_2929641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001008216.1|2929637_2930045_-	RusA family crossover junction endodeoxyribonuclease	NA	F1C5C9	Cronobacter_phage	57.9	4.4e-37
WP_171877301.1|2930041_2930647_-	recombination protein NinG	NA	G0ZNC4	Cronobacter_phage	53.1	2.5e-44
WP_171877302.1|2930997_2931756_-	DNA cytosine methyltransferase	NA	S4TQH6	Salmonella_virus	62.9	2.5e-86
WP_171877303.1|2931752_2932256_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065225584.1|2932745_2933282_-	phage N-6-adenine-methyltransferase	NA	H6WCM2	Enterobacteria_phage	93.8	7.4e-101
WP_021524103.1|2933291_2933525_-	hypothetical protein	NA	H6WCM1	Enterobacteria_phage	94.8	3.1e-35
WP_171877304.1|2933529_2933766_-	cell division protein FtsK	NA	H6WCM0	Enterobacteria_phage	56.4	1.5e-18
WP_171877305.1|2933767_2933971_-	hypothetical protein	NA	H6WCL9	Enterobacteria_phage	77.6	9.1e-28
WP_094058181.1|2934250_2934469_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171877306.1|2934568_2935189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032184056.1|2935202_2935535_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171877307.1|2935524_2935716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_074574778.1|2935706_2935979_-	toxin-antitoxin system toxin subunit	NA	NA	NA	NA	NA
WP_171877308.1|2936216_2936468_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171877309.1|2936480_2936759_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171877310.1|2936774_2937191_-	single-stranded DNA-binding protein	NA	H9C0R6	Aeromonas_phage	48.5	4.5e-21
WP_137538732.1|2937190_2937856_-	ERF family protein	NA	I6RSN3	Salmonella_phage	50.2	3.0e-51
WP_096924061.1|2938005_2938296_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075842566.1|2938796_2939444_-	helix-turn-helix domain-containing protein	NA	A0A286S2B2	Klebsiella_phage	50.9	2.4e-53
WP_075842567.1|2939750_2940005_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_171877311.1|2940007_2941102_+	DUF4373 domain-containing protein	NA	A0A2I7RBL5	Vibrio_phage	43.7	5.8e-44
WP_171877312.1|2941499_2942618_+	hypothetical protein	NA	A0A1X7QGR9	Escherichia_phage	66.6	3.1e-149
WP_171877313.1|2942636_2944058_+	AAA family ATPase	NA	A0A192Y673	Salmonella_phage	56.1	1.8e-138
>prophage 8
NZ_CP038336	Escherichia coli O157:H7 strain LSU61 chromosome, complete genome	5512129	3148305	3276084	5512129	protease,head,lysis,tRNA,tail,integrase,portal,capsid,holin,terminase	Enterobacteria_phage(38.05%)	156	3172237:3172252	3276072:3276087
WP_001201843.1|3148305_3149259_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3149445_3150930_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000239884.1|3151475_3152144_+	methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3152641_3152824_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3152902_3153403_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3153439_3153946_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3153964_3154855_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3154974_3155556_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_171877317.1|3155555_3158471_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	97.4	9.4e-57
WP_001230336.1|3158535_3159135_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_171877318.1|3159201_3162600_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.8	0.0e+00
WP_000090920.1|3162660_3163293_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3163229_3163973_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_171877319.1|3163978_3164677_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	97.0	1.4e-131
WP_000847329.1|3164686_3165016_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	1.6e-58
WP_000840323.1|3165012_3167562_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3167554_3167989_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3167970_3168393_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3168408_3169149_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3169156_3169552_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3169548_3170127_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3170138_3170492_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3170503_3170902_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_052937980.1|3170943_3171969_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.1	1.7e-191
WP_001295978.1|3172024_3172357_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
3172237:3172252	attL	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_000123329.1|3172366_3173686_-	S49 family peptidase	NA	A0A0K2FI53	Enterobacteria_phage	98.4	2.6e-232
3172237:3172252	attL	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_001359963.1|3173666_3175268_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.3	1.1e-306
WP_000198153.1|3175264_3175471_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_171877320.1|3175467_3177393_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.1	0.0e+00
WP_000453564.1|3177367_3177913_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001031427.1|3178660_3178867_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_171877321.1|3179152_3179563_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	97.8	2.3e-70
WP_000738495.1|3179854_3180148_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_001228695.1|3180238_3180421_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001180487.1|3180637_3181114_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3181100_3181406_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3181727_3182417_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3182413_3182554_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3182550_3182913_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3182909_3183200_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3183192_3183363_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3183362_3183818_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3184319_3185846_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3185903_3186026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070453.1|3186090_3186423_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3186490_3186793_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3186789_3187491_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000147891.1|3187487_3188507_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	4.4e-110
WP_001182903.1|3188503_3189043_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	1.2e-61
WP_001067458.1|3189112_3189343_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|3189447_3190137_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000233576.1|3190738_3190945_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995401.1|3191020_3191317_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	3.1e-48
WP_000100847.1|3191322_3192108_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186792.1|3192104_3192785_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	99.6	4.6e-132
WP_000149538.1|3192781_3192964_+	DUF1317 domain-containing protein	NA	A0A1U8QQC1	Enterobacteria_phage	98.3	3.7e-28
WP_000548522.1|3192936_3193128_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	6.2e-26
WP_001386642.1|3193138_3193420_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763385.1|3193518_3193737_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488406.1|3193784_3194024_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_000088653.1|3194152_3194389_+	excisionase	NA	NA	NA	NA	NA
WP_000741342.1|3194378_3195521_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	99.7	1.8e-205
WP_000444477.1|3195634_3196885_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3197056_3197710_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3197719_3198181_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3198234_3199341_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3199376_3200018_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3200021_3201392_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265474.1|3201560_3202232_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3202231_3203692_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3204293_3204575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3204830_3205373_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224606.1|3205578_3205992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3206004_3206340_-|head	head decoration protein	head	NA	NA	NA	NA
3206229:3206244	attR	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_000907465.1|3206352_3207408_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
3206229:3206244	attR	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_000796968.1|3207407_3207614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132079.1|3207865_3208090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233304.1|3208216_3208489_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126687.1|3208499_3208910_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000192401.1|3208906_3209158_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000833630.1|3209358_3210759_-	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.6	9.6e-116
WP_000770178.1|3210755_3211055_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_001204985.1|3211060_3211294_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000551675.1|3211286_3211751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000609225.1|3211740_3211953_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000226782.1|3211945_3212143_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000953272.1|3212947_3213136_-	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	2.0e-13
WP_000085256.1|3213500_3214730_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001359994.1|3214978_3216100_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3216148_3217375_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3217624_3218761_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799400.1|3218744_3219608_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_171877322.1|3219971_3221333_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	28.9	1.2e-49
WP_171877323.1|3221393_3221669_+	secretion protein EspO	NA	NA	NA	NA	NA
WP_001301673.1|3227968_3230317_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3230336_3230426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001023356.1|3230532_3230802_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
WP_171877324.1|3230803_3232117_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	96.8	4.1e-76
WP_001230428.1|3232181_3232781_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.5	1.4e-111
WP_122995769.1|3236566_3237196_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	96.2	2.1e-102
WP_171877325.1|3237141_3237879_-|tail	phage tail protein	tail	A0A0P0ZDT1	Stx2-converting_phage	99.2	3.4e-149
WP_171877326.1|3237932_3238811_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	76.3	9.3e-93
WP_000410309.1|3239074_3239227_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3239336_3239591_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3239607_3240306_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807954.1|3240305_3240647_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_171877327.1|3240639_3243882_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.5	0.0e+00
WP_001453746.1|3243929_3244139_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_001030063.1|3244234_3244609_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275479.1|3244614_3245331_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	4.0e-126
WP_000133393.1|3245398_3245743_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	9.4e-57
WP_000573391.1|3245739_3246186_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3246182_3246533_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3246542_3246869_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001063108.1|3249557_3249779_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	91.8	5.1e-32
WP_171877328.1|3249823_3251761_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	99.5	0.0e+00
WP_171877329.1|3251824_3253486_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	98.6	0.0e+00
WP_000958416.1|3253482_3254046_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3254334_3254700_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302977.1|3254741_3254927_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3255056_3255197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3255553_3255778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3255842_3256049_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3256276_3256423_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3256422_3256992_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992167.1|3257262_3257796_-	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_000731192.1|3257846_3258191_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	98.2	6.5e-58
WP_000284518.1|3258195_3258411_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3258486_3258756_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3258793_3258976_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023169.1|3259123_3261061_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.9	2.3e-293
WP_000216629.1|3261375_3261543_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762928.1|3262139_3262961_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_001217410.1|3262957_3263332_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_001265167.1|3263344_3264394_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.9e-108
WP_001341388.1|3264395_3264674_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3264841_3265054_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3265242_3265347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3265462_3266050_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3266052_3266244_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3266245_3266683_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3266669_3266987_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3266940_3267258_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_072141964.1|3267247_3267550_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	6.5e-46
WP_072141965.1|3267546_3267828_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	74.2	3.6e-30
WP_000451011.1|3267860_3268577_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.8e-71
WP_072143019.1|3268610_3269153_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_053921372.1|3269064_3270102_-	phage replisome organizer	NA	A0A0U2RT81	Escherichia_phage	79.5	4.3e-89
WP_000693915.1|3270170_3270596_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3270579_3270903_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3271027_3271504_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3271819_3271972_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3272086_3272602_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3273143_3273332_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3273328_3273520_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_171877330.1|3273612_3276084_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
3276072:3276087	attR	GGCTGATTTTTAATGT	NA	NA	NA	NA
>prophage 9
NZ_CP038336	Escherichia coli O157:H7 strain LSU61 chromosome, complete genome	5512129	3454737	3509063	5512129	protease,head,tail,integrase,portal,capsid,holin,terminase	Enterobacteria_phage(29.55%)	64	3456672:3456687	3510828:3510843
WP_000003653.1|3454737_3455325_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186427.1|3455321_3456029_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3456047_3457841_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3456672:3456687	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3457837_3458956_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_052912734.1|3460072_3460825_+	Tir-cytoskeleton coupling protein TccP2	NA	NA	NA	NA	NA
WP_001023990.1|3460950_3461220_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCV7	Stx2-converting_phage	97.8	1.7e-45
WP_171877332.1|3461221_3462634_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	91.7	2.9e-72
WP_025404308.1|3462698_3463298_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	99.0	2.0e-110
WP_000649829.1|3466975_3467503_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_064763724.1|3467693_3468326_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	97.1	5.5e-103
WP_000194723.1|3468271_3469015_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_001152182.1|3469025_3469724_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000847304.1|3469723_3470053_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_171877239.1|3470049_3472629_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.2	0.0e+00
WP_000533403.1|3472609_3473023_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3473049_3473481_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000235110.1|3473494_3474247_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	1.2e-133
WP_000683079.1|3474254_3474650_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000975047.1|3474646_3475180_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	1.5e-56
WP_001204549.1|3475195_3475549_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	8.7e-42
WP_000201524.1|3475541_3475916_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522579.1|3475967_3476996_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.0	3.5e-115
WP_000256723.1|3477053_3477401_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001253987.1|3477437_3478943_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.6e-100
WP_001374583.1|3478932_3480525_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	9.3e-184
WP_000259002.1|3480521_3480728_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_012816750.1|3480711_3482640_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.2	3.6e-262
WP_000235436.1|3482611_3483121_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_171877333.1|3483522_3483747_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.3e-19
WP_001303878.1|3483828_3484143_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_012816791.1|3484670_3484856_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000675931.1|3485077_3485191_-	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_001003118.1|3485411_3485945_-	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000138558.1|3486104_3486377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024182511.1|3486632_3486848_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_171877334.1|3487286_3489137_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	95.9	0.0e+00
WP_000261909.1|3489904_3490618_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3491238_3492057_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3492208_3492580_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3492569_3492941_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_171877335.1|3492953_3494003_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001341388.1|3494004_3494283_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3494450_3494606_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3494707_3494845_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3495210_3495984_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3496335_3496749_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3496764_3497535_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3497556_3498303_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3498309_3499401_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3499479_3499935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3500141_3500567_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3500550_3500823_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3500931_3501333_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3501360_3501552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3501551_3501839_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3502115_3502271_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3502412_3502802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3502988_3503174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3503747_3503936_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3503932_3504124_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3504217_3506689_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3506756_3506999_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_171877336.1|3506976_3507996_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.4	4.9e-85
WP_000375124.1|3508403_3509063_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	2.4e-48
3510828:3510843	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 10
NZ_CP038336	Escherichia coli O157:H7 strain LSU61 chromosome, complete genome	5512129	3739993	3785524	5512129	protease,lysis,tail,integrase,portal,holin,terminase	Enterobacteria_phage(44.64%)	65	3739578:3739592	3785598:3785612
3739578:3739592	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247931.1|3739993_3740692_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3740922_3741804_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3741972_3742134_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3742630_3743650_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3743683_3744664_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3744840_3745110_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3745111_3746428_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3746487_3747087_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_171877337.1|3747157_3750571_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.2	0.0e+00
WP_000090841.1|3750631_3751240_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3751176_3751920_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3751925_3752624_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3752633_3752963_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371993.1|3752962_3756028_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.0	0.0e+00
WP_001161009.1|3755999_3756329_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3756337_3756724_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3756784_3757528_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3757538_3757940_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677100.1|3757936_3758515_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	9.4e-102
WP_001283153.1|3758526_3758802_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3758794_3759118_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136584.1|3759204_3761232_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.5	0.0e+00
WP_000985964.1|3761176_3762685_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	4.5e-289
WP_001072975.1|3762684_3762897_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934143.1|3762893_3764996_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000349509.1|3764995_3765487_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3766161_3766314_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092264.1|3766301_3766769_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	98.1	2.5e-76
WP_000075144.1|3766765_3767263_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
WP_000284524.1|3767262_3767478_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3767620_3768019_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3768099_3768258_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3768343_3769087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3769271_3769961_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3769975_3770098_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3770436_3771396_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3771607_3772273_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108059.1|3772269_3772890_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.6	4.1e-95
WP_000567000.1|3772882_3773053_-	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
WP_001254218.1|3773049_3773232_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000736913.1|3773228_3773669_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145931.1|3773742_3774033_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_000788871.1|3774029_3774731_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	100.0	3.4e-130
WP_171877220.1|3774727_3775627_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	98.7	1.8e-171
WP_000438490.1|3775659_3775959_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	96.0	2.0e-47
WP_000067727.1|3776100_3776316_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_096246228.1|3776389_3777085_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.1	4.3e-133
WP_000854876.1|3777257_3777554_+	DUF1902 domain-containing protein	NA	NA	NA	NA	NA
WP_000478871.1|3777565_3777850_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_000088205.1|3778282_3778555_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.2e-40
WP_000392425.1|3778839_3779289_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	88.6	1.9e-70
WP_000065351.1|3779484_3779853_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	4.5e-65
WP_001198861.1|3779925_3780090_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3780058_3780202_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995449.1|3780275_3780572_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|3780577_3781363_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186844.1|3781359_3782040_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3782036_3782219_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3782191_3782383_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_001386642.1|3782393_3782675_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763363.1|3782773_3782995_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3783205_3783808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3784050_3784218_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3784257_3784476_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3784453_3785524_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3785598:3785612	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 11
NZ_CP038336	Escherichia coli O157:H7 strain LSU61 chromosome, complete genome	5512129	4413117	4476849	5512129	protease,transposase,plate	uncultured_Caudovirales_phage(25.0%)	54	NA	NA
WP_171877356.1|4413117_4414197_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|4414196_4415153_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_171877357.1|4415163_4416372_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|4416389_4416857_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042910.1|4417117_4417447_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_171877358.1|4417433_4417826_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_171877359.1|4420872_4421766_+	DNA-protecting protein DprA	NA	S6BFL3	Thermus_phage	38.4	2.7e-31
WP_171877360.1|4421762_4422389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171877361.1|4422406_4424767_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.8	4.1e-34
WP_171877362.1|4424921_4425485_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_171877363.1|4426492_4427926_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_171877364.1|4428174_4428414_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000266639.1|4428519_4428747_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_000893282.1|4432273_4433527_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4433538_4434642_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4434929_4435985_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4436023_4436425_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189550.1|4436482_4437727_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4437818_4438277_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4438537_4439995_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023438539.1|4440051_4440609_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4440520_4440787_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4441093_4441546_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4441555_4441954_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4441956_4442250_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4442301_4443357_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4443427_4444213_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4444157_4445897_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543889.1|4446714_4447488_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	6.0e-19
WP_000729705.1|4447673_4447934_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000615979.1|4447936_4448215_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4448370_4449111_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4449081_4449849_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4449953_4450532_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973088.1|4450771_4453216_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4453258_4453732_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4453885_4454656_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4454773_4455946_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4456026_4456212_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4456126_4456390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4456591_4458352_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4458354_4459491_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001414559.1|4460236_4460752_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000339420.1|4460820_4462329_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_000390582.1|4462510_4463263_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000509101.1|4463369_4467602_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103342.1|4467677_4469819_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001142958.1|4470028_4470547_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4471243_4471744_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4471778_4472003_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056995.1|4472053_4473529_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4473535_4473949_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393835.1|4473952_4475803_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4475766_4476849_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 12
NZ_CP038336	Escherichia coli O157:H7 strain LSU61 chromosome, complete genome	5512129	5105003	5155213	5512129	head,tRNA,tail,integrase,capsid,holin,terminase	Stx2-converting_phage(35.09%)	61	5100843:5100858	5141873:5141888
5100843:5100858	attL	ATGCTGGTGGCAGGAA	NA	NA	NA	NA
WP_000918366.1|5105003_5106419_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5106501_5107485_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5107650_5107893_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543816.1|5108026_5109064_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5109152_5110250_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5110311_5110560_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5110720_5111362_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5111443_5112073_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5112145_5112718_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_021502109.1|5112829_5113099_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	98.9	1.7e-45
WP_171877226.1|5113100_5114414_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	1.1e-76
WP_171877368.1|5114478_5115078_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	3.0e-111
WP_171877369.1|5115145_5118541_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	84.1	0.0e+00
WP_144319768.1|5118787_5119420_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	98.1	2.2e-104
WP_062881112.1|5119365_5120109_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	3.8e-148
WP_001152182.1|5120119_5120818_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807954.1|5120817_5121159_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_171877370.1|5121151_5124394_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	91.9	0.0e+00
WP_001453746.1|5124441_5124651_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_001030047.1|5124746_5125121_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	92.7	5.8e-60
WP_001275505.1|5125126_5125843_-	immunoglobulin domain-containing protein	NA	A0A0P0ZD29	Stx2-converting_phage	97.5	5.2e-126
WP_000133388.1|5125909_5126254_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|5126250_5126697_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|5126693_5127044_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|5127053_5127380_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_069197361.1|5129743_5129965_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	94.5	2.7e-33
WP_171877371.1|5130009_5131947_-|capsid	phage major capsid protein	capsid	Q6H9U8	Enterobacteria_phage	99.8	0.0e+00
WP_171877372.1|5132010_5133672_-|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	99.8	0.0e+00
WP_000958416.1|5133668_5134232_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000074669.1|5134919_5135144_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|5135225_5135540_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208681.1|5136067_5136253_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_000075132.1|5136469_5136967_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_024164617.1|5136966_5137182_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000143003.1|5137621_5139472_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_001339373.1|5140289_5140442_-	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_001047096.1|5140751_5141504_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	5.8e-136
WP_001359939.1|5141517_5142507_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	9.9e-192
5141873:5141888	attR	ATGCTGGTGGCAGGAA	NA	NA	NA	NA
WP_001061413.1|5142514_5143312_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	7.5e-150
WP_000767105.1|5143331_5143721_-	RusA family crossover junction endodeoxyribonuclease	NA	A5LH74	Enterobacteria_phage	99.2	2.1e-68
WP_000210148.1|5143717_5144044_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	98.1	1.0e-52
WP_001359044.1|5144040_5144694_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	98.6	2.8e-126
WP_001359043.1|5144693_5145188_-	PerC family transcriptional regulator	NA	K7PJR0	Enterobacteria_phage	99.4	1.9e-87
WP_000104942.1|5145184_5146126_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	93.3	1.7e-140
WP_001250269.1|5146115_5146295_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515830.1|5146470_5147022_-	protein YmfL	NA	S5FXP0	Shigella_phage	98.4	2.2e-100
WP_000649477.1|5147065_5147266_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|5147356_5148031_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_000917896.1|5148203_5148500_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000135680.1|5149100_5149463_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081300.1|5149528_5150353_+	YfdQ family protein	NA	Q8SBF9	Shigella_phage	99.6	1.3e-149
WP_000008211.1|5150480_5151017_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_171877373.1|5151007_5151358_+	Eae protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.0	1.1e-55
WP_000145671.1|5151354_5151828_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	75.5	4.0e-66
WP_000829413.1|5151974_5152442_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	72.1	1.1e-36
WP_001014294.1|5152443_5152635_+	hypothetical protein	NA	G9L660	Escherichia_phage	100.0	9.5e-27
WP_001094871.1|5152637_5153372_+	DUF551 domain-containing protein	NA	S5MC19	Escherichia_phage	98.8	1.4e-139
WP_001061339.1|5153371_5153944_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001093918.1|5153980_5154262_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
WP_000654815.1|5154309_5154483_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5154679_5155213_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
