The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038360	Escherichia coli O157:H7 strain F7386 chromosome, complete genome	5403105	1219816	1243381	5403105	holin,tail,integrase,transposase	Enterobacteria_phage(33.33%)	27	1211462:1211476	1244252:1244266
1211462:1211476	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|1219816_1221022_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1221023_1222337_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1222333_1223965_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1223965_1224364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1224461_1224875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000150571.1|1225270_1226563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001418122.1|1226638_1226974_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1226976_1227732_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1228109_1228676_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1228650_1229262_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1229258_1229924_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1229920_1230544_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1230796_1231540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1231625_1231793_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143065.1|1232200_1234054_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000284517.1|1234203_1234419_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_113564127.1|1234423_1234756_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	4.5e-56
WP_001171540.1|1235104_1235485_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|1235481_1235829_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_162829202.1|1236329_1237543_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1237760_1238030_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1238190_1238613_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1238742_1239801_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1239879_1240530_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1240712_1241303_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1241804_1242053_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1242898_1243381_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1244252:1244266	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP038360	Escherichia coli O157:H7 strain F7386 chromosome, complete genome	5403105	1520958	1579044	5403105	holin,capsid,integrase,protease,lysis,portal,tail,transposase,terminase	Escherichia_phage(46.74%)	92	1525353:1525377	1587611:1587635
WP_000950857.1|1520958_1521528_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1521527_1521995_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1521981_1522662_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1522671_1523808_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1523982_1525140_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
1525353:1525377	attL	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
WP_001218308.1|1525571_1526741_+|integrase	site-specific integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	100.0	1.7e-230
WP_000453637.1|1526724_1526907_-	helix-turn-helix domain-containing protein	NA	A0A2R2Z2X2	Escherichia_phage	100.0	4.1e-27
WP_000994803.1|1526985_1527363_-	DUF1627 domain-containing protein	NA	A0A2R2Z2X7	Escherichia_phage	100.0	2.0e-52
WP_001291844.1|1527398_1527611_-	DUF1382 family protein	NA	A0A2R2X2A7	Escherichia_phage	100.0	7.1e-31
WP_000163444.1|1527570_1528197_-	adenine methylase	NA	A0A2R2Z304	Escherichia_phage	100.0	1.0e-122
WP_000268107.1|1528193_1528424_-	hypothetical protein	NA	Q08J65	Stx2-converting_phage	100.0	1.9e-37
WP_000669287.1|1528423_1528591_-	hypothetical protein	NA	A0A0P0ZCR2	Stx2-converting_phage	100.0	2.9e-27
WP_000203836.1|1528633_1529257_-	phage antirepressor Ant	NA	A0A0P0ZAZ7	Stx2-converting_phage	100.0	1.7e-112
WP_000376712.1|1529612_1529897_-	DUF4752 family protein	NA	A0A0N7KZC7	Stx2-converting_phage	100.0	4.5e-49
WP_000206751.1|1529896_1530514_-	DUF551 domain-containing protein	NA	A0A1I9LJM0	Stx_converting_phage	100.0	7.7e-118
WP_000212746.1|1530517_1530805_-	hypothetical protein	NA	A0A1I9LJM1	Stx_converting_phage	100.0	9.2e-50
WP_001142590.1|1530806_1531025_-	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	100.0	3.5e-33
WP_001301947.1|1531026_1531242_-	hypothetical protein	NA	A0A0N7C076	Escherichia_phage	100.0	7.9e-38
WP_001301469.1|1531201_1531708_-	hypothetical protein	NA	A0A0N7C063	Escherichia_phage	100.0	4.2e-90
WP_001289942.1|1531709_1532657_-	ead/Ea22-like family protein	NA	A0A0P0ZDS3	Stx2-converting_phage	100.0	2.1e-183
WP_000774248.1|1532653_1532875_-	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	100.0	3.8e-35
WP_001447493.1|1532973_1533255_-	cell division protein ZapA	NA	Q6H9Z3	Enterobacteria_phage	100.0	3.2e-47
WP_000548531.1|1533265_1533457_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682315.1|1533429_1533612_-	DUF1317 domain-containing protein	NA	Q6H9Z1	Enterobacteria_phage	100.0	9.7e-29
WP_000186866.1|1533608_1534289_-	YqaJ viral recombinase family protein	NA	A0A0P0ZBV6	Stx2-converting_phage	100.0	2.1e-132
WP_000100845.1|1534285_1535071_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995464.1|1535076_1535373_-	host-nuclease inhibitor protein Gam	NA	A0A0P0ZCL3	Stx2-converting_phage	100.0	2.1e-49
WP_000372940.1|1535427_1535592_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	100.0	1.9e-23
WP_001198861.1|1535560_1535725_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065487.1|1535797_1536166_-	DUF2528 family protein	NA	A0A0P0ZCC3	Stx2-converting_phage	100.0	4.5e-65
WP_000167595.1|1536316_1536787_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_000198444.1|1536845_1537229_-	hypothetical protein	NA	G9L671	Escherichia_phage	100.0	3.9e-64
WP_000745484.1|1537717_1537882_-	hypothetical protein	NA	A0A0P0ZCU5	Stx2-converting_phage	100.0	3.0e-21
WP_000957426.1|1537884_1538931_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_001221210.1|1538924_1539386_-	hypothetical protein	NA	A0A0P0ZD85	Stx2-converting_phage	100.0	1.7e-77
WP_000885202.1|1539453_1539795_-	DUF3024 domain-containing protein	NA	G9L675	Escherichia_phage	100.0	5.1e-63
WP_000250473.1|1539855_1540563_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001180318.1|1540641_1540869_+	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438489.1|1541007_1541304_+	hypothetical protein	NA	A0A0N7KZD0	Stx2-converting_phage	100.0	5.2e-48
WP_000185456.1|1541336_1542275_+	replication protein	NA	C1JJ53	Enterobacteria_phage	100.0	2.8e-172
WP_000788871.1|1542271_1542973_+	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	100.0	3.4e-130
WP_000145935.1|1542969_1543260_+	protein ren	NA	A0A0P0ZCJ0	Stx2-converting_phage	100.0	9.6e-47
WP_001000130.1|1543330_1543609_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103680.1|1543741_1543957_+	hypothetical protein	NA	G9L684	Escherichia_phage	100.0	2.2e-32
WP_001229012.1|1544130_1544547_+	recombination protein NinB	NA	G9L686	Escherichia_phage	100.0	3.9e-73
WP_000573864.1|1544539_1545142_+	HNH endonuclease	NA	G9L687	Escherichia_phage	100.0	1.7e-114
WP_000153301.1|1545138_1545666_+	phage N-6-adenine-methyltransferase	NA	A0A0N7KZD1	Stx2-converting_phage	100.0	7.3e-101
WP_001254258.1|1545662_1545857_+	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
WP_000201603.1|1546113_1546788_+	phage antirepressor Ant	NA	G9L689	Escherichia_phage	100.0	1.6e-129
WP_000924600.1|1546862_1547264_+	hypothetical protein	NA	G9L690	Escherichia_phage	100.0	1.4e-72
WP_001563210.1|1547223_1547433_+	protein ninF	NA	G9L691	Escherichia_phage	100.0	1.4e-31
WP_001292288.1|1547425_1548148_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCJ8	Stx2-converting_phage	100.0	5.4e-131
WP_001107963.1|1548147_1548753_+	recombination protein NinG	NA	A0A0P0ZCS9	Stx2-converting_phage	100.0	1.7e-98
WP_000144764.1|1548749_1548944_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204880.1|1548936_1549371_+	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_001304085.1|1549619_1549772_+	hypothetical protein	NA	A0A0N7C2V5	Escherichia_phage	100.0	5.2e-20
WP_000649753.1|1550152_1551112_+	Shiga toxin Stx2c subunit A	NA	Q776Q3	Enterobacteria_phage	100.0	5.6e-176
WP_000738068.1|1551123_1551393_+	Shiga toxin Stx2a subunit B	NA	A0A2R2Z326	Escherichia_phage	100.0	1.2e-43
WP_000874499.1|1551879_1553817_+	SASA family carbohydrate esterase	NA	A0A1I9LJQ8	Stx_converting_phage	100.0	0.0e+00
WP_000143458.1|1553951_1554131_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290212.1|1554171_1554444_+	DUF826 domain-containing protein	NA	A0A1I9LJR2	Stx_converting_phage	100.0	1.2e-22
WP_000284506.1|1554520_1554736_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087461.1|1554740_1555274_+	lysozyme	NA	V5USG4	Shigella_phage	100.0	7.9e-103
WP_001056885.1|1555547_1556117_+	hypothetical protein	NA	A0A2R2Z339	Escherichia_phage	100.0	1.8e-105
WP_000455406.1|1556116_1556266_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_001082654.1|1556273_1556738_+|lysis	lysis protein	lysis	A0A2R2Z341	Escherichia_phage	100.0	5.8e-78
WP_000738505.1|1556769_1557063_-	serum resistance lipoprotein Bor	NA	A0A2R2X2B2	Escherichia_phage	100.0	6.8e-48
WP_001301714.1|1557212_1557416_+	hypothetical protein	NA	A0A2R2Z338	Escherichia_phage	100.0	7.7e-35
WP_001086069.1|1557471_1558278_+|terminase	terminase	terminase	A0A2R2Z334	Escherichia_phage	100.0	7.6e-134
WP_000143988.1|1558258_1559965_+|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	100.0	0.0e+00
WP_000787025.1|1559964_1562109_+|portal	portal protein	portal	A0A0P0ZBZ2	Stx2-converting_phage	100.0	0.0e+00
WP_162829202.1|1562826_1564040_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000994870.1|1564170_1564587_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.6e-69
WP_000214474.1|1564610_1565825_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|1565880_1566270_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001290743.1|1566319_1566781_+	hypothetical protein	NA	A0A2R2Z354	Escherichia_phage	100.0	7.8e-75
WP_000829200.1|1566764_1567328_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_000207923.1|1567327_1567978_+	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	100.0	7.8e-121
WP_001301432.1|1567974_1569912_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZCY7	Stx2-converting_phage	100.0	1.1e-64
WP_001024006.1|1569913_1570183_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_001303606.1|1570321_1570510_+	hypothetical protein	NA	A0A2R2Z344	Escherichia_phage	100.0	6.9e-30
WP_001146323.1|1570804_1572430_+	hypothetical protein	NA	A0A0P0ZDC2	Stx2-converting_phage	100.0	0.0e+00
WP_000197192.1|1572426_1573695_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455635.1|1573709_1573988_+	hypothetical protein	NA	A0A088CD71	Shigella_phage	100.0	1.1e-50
WP_001301884.1|1573993_1574611_+	hypothetical protein	NA	A0A2R2Z362	Escherichia_phage	100.0	1.1e-121
WP_000835361.1|1574701_1575436_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZH34	Escherichia_phage	100.0	9.7e-136
WP_000078907.1|1575666_1575807_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035557.1|1575863_1576265_+	hypothetical protein	NA	A0A088CC37	Shigella_phage	100.0	1.2e-71
WP_000509483.1|1576359_1577016_+	hypothetical protein	NA	A0A0P0ZCM5	Stx2-converting_phage	100.0	5.1e-104
WP_000455652.1|1577018_1577465_+	hypothetical protein	NA	V5UT82	Shigella_phage	100.0	1.1e-76
WP_000540400.1|1577474_1577768_+	hypothetical protein	NA	A0A0P0ZDW9	Stx2-converting_phage	100.0	4.1e-13
WP_000012445.1|1577778_1579044_+	hypothetical protein	NA	A0A0P0ZD72	Stx2-converting_phage	100.0	4.4e-229
1587611:1587635	attR	TTATATCCATTTAACTAAGAGGACA	NA	NA	NA	NA
>prophage 3
NZ_CP038360	Escherichia coli O157:H7 strain F7386 chromosome, complete genome	5403105	1834757	1943518	5403105	holin,integrase,tRNA,protease,portal,tail,transposase,terminase	Enterobacteria_phage(48.19%)	121	1920714:1920728	1945581:1945595
WP_000569336.1|1834757_1835684_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1835688_1836420_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1836400_1836508_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1836567_1837269_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1837289_1838576_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1838609_1838864_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556581.1|1838882_1839017_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	97.7	1.4e-21
WP_000457728.1|1839020_1839263_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1839350_1839713_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1839709_1840066_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1840399_1840576_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1840577_1841525_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1841521_1841743_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1841841_1842123_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1842133_1842325_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1842297_1842480_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1842479_1843157_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1843153_1843939_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995439.1|1843944_1844241_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000233576.1|1844316_1844523_-	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000866321.1|1845003_1845381_-	ASCH domain-containing protein	NA	Q6SE87	Lactobacillus_prophage	49.2	1.3e-30
WP_000380252.1|1845358_1846420_-	hypothetical protein	NA	Q6SE88	Lactobacillus_prophage	42.0	2.9e-64
WP_000858974.1|1846500_1847190_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_001067457.1|1847294_1847525_+	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	69.3	3.8e-22
WP_001182899.1|1847594_1848134_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_000147876.1|1848130_1849150_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.4	4.0e-111
WP_162829202.1|1849455_1850669_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000145915.1|1851157_1851460_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070451.1|1851527_1851860_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_032102575.1|1851951_1852059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709082.1|1852116_1853643_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	27.8	7.9e-31
WP_001302427.1|1854107_1854659_+	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_000881075.1|1854668_1855466_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001303586.1|1855582_1855684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001054341.1|1855680_1856136_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	67.5	1.1e-60
WP_000224916.1|1856135_1856306_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_000774488.1|1856298_1856589_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_001099712.1|1856585_1856948_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1856944_1857085_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1857170_1857605_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1857856_1858009_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1858812_1860759_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1860895_1861075_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1861115_1861361_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1861438_1861654_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_000087728.1|1861658_1862192_+	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	100.0	1.8e-102
WP_001056806.1|1862462_1863032_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1863031_1863178_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1863405_1863591_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1864108_1864585_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077625.1|1864581_1866705_+|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000102414.1|1866701_1866914_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	97.1	1.1e-28
WP_000974564.1|1866913_1868416_+|portal	phage portal protein	portal	Q9EYD2	Enterobacteria_phage	100.0	4.8e-291
WP_001114424.1|1868360_1870385_+|protease	Clp protease ClpP	protease	S5M7Q8	Escherichia_phage	99.8	0.0e+00
WP_001097065.1|1870472_1870799_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1870791_1871073_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1871075_1871699_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1871711_1872110_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1872117_1872870_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479043.1|1872883_1873306_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000438877.1|1873332_1873641_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000918269.1|1873684_1876330_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	100.0	0.0e+00
WP_000847298.1|1876326_1876656_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001301816.1|1876655_1877354_+|tail	phage minor tail protein L	tail	Q9EYE3	Enterobacteria_phage	100.0	1.5e-133
WP_000194798.1|1877364_1878108_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	100.0	3.7e-151
WP_072147834.1|1878053_1878683_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.5	3.5e-110
WP_000514989.1|1878923_1882397_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.9	0.0e+00
WP_001228302.1|1882464_1883064_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	99.5	1.3e-109
WP_000268979.1|1883128_1884442_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.1	2.4e-76
WP_001023381.1|1884443_1884713_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	1.0e-42
WP_001261937.1|1885080_1885329_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	97.6	9.1e-38
WP_001301761.1|1885843_1887529_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1887525_1888245_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1888291_1888762_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1888803_1889265_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1889389_1891393_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1891389_1892526_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1892518_1893250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1893268_1894798_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1894808_1895897_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1897137_1897455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1897516_1901146_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1908103_1910137_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
WP_001005448.1|1910268_1911378_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_010904812.1|1911639_1911921_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_000682830.1|1912212_1912755_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000677408.1|1912842_1913517_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000945390.1|1913532_1916013_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_001301545.1|1916023_1917058_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000153070.1|1917139_1917478_-	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000134626.1|1917695_1918559_-	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
WP_000019944.1|1918679_1918952_+	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000735648.1|1919061_1919376_-	outer membrane protein	NA	NA	NA	NA	NA
WP_000836936.1|1919385_1919733_-	hypothetical protein	NA	NA	NA	NA	NA
1920714:1920728	attL	TTTTTATGATCATAG	NA	NA	NA	NA
WP_000141034.1|1920783_1921023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195634.1|1921356_1922145_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822268.1|1922141_1922942_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001301907.1|1923006_1923825_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	37.6	4.2e-23
WP_000434038.1|1923876_1924623_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011970.1|1924596_1925562_-	kinase	NA	NA	NA	NA	NA
WP_000846238.1|1925558_1926563_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	4.9e-13
WP_000859148.1|1926559_1927837_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1928093_1929146_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_001452765.1|1929444_1930299_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000182899.1|1931594_1932047_+	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_000823288.1|1932077_1932362_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490679.1|1932365_1933721_+	galactitol permease IIC component	NA	NA	NA	NA	NA
WP_000844219.1|1933768_1934809_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178551.1|1934908_1935688_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807362.1|1935769_1936669_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1937074_1937392_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985260.1|1937656_1938670_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|1938785_1939085_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1939206_1939482_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|1939492_1939663_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217670.1|1939659_1940160_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557698.1|1940223_1940448_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277898.1|1940447_1940747_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113265.1|1940749_1940974_+	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_000027664.1|1940970_1941246_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268574.1|1941235_1943518_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
1945581:1945595	attR	CTATGATCATAAAAA	NA	NA	NA	NA
>prophage 4
NZ_CP038360	Escherichia coli O157:H7 strain F7386 chromosome, complete genome	5403105	1947614	1973836	5403105	holin,capsid,lysis,tRNA,plate,head,portal,tail,terminase	Escherichia_phage(73.53%)	35	NA	NA
WP_000038161.1|1947614_1948649_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156848.1|1948648_1950421_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_001085952.1|1950594_1951449_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_001248594.1|1951507_1952581_+|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_000203418.1|1952584_1953328_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_000988633.1|1953427_1953937_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846406.1|1953936_1954140_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123123.1|1954143_1954425_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1954424_1954922_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736555.1|1954936_1955362_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_000040644.1|1955349_1955775_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_001300730.1|1955746_1955920_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917144.1|1955882_1956350_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001001810.1|1956342_1956795_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	97.3	2.2e-74
WP_001093728.1|1956861_1957497_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_000127154.1|1957493_1957841_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001121479.1|1957845_1958754_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_001285352.1|1958746_1959358_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_000217052.1|1959354_1960674_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	68.5	1.2e-179
WP_001057694.1|1960673_1961276_+|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_001008233.1|1961247_1961691_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001145592.1|1961711_1962122_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	98.4	5.9e-66
WP_000905094.1|1962152_1962746_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001286706.1|1962805_1963996_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	6.9e-224
WP_001251408.1|1964008_1964527_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1964583_1964859_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001496926.1|1964891_1965011_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_000069957.1|1965003_1967451_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_000978913.1|1967465_1967945_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000882933.1|1967944_1969108_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000468308.1|1969189_1969408_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1969681_1971043_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
WP_001301848.1|1971190_1971523_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|1971713_1972436_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|1972432_1973836_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 5
NZ_CP038360	Escherichia coli O157:H7 strain F7386 chromosome, complete genome	5403105	2072922	2140155	5403105	holin,capsid,integrase,head,portal,tail,transposase,terminase	Escherichia_phage(35.56%)	68	2068563:2068578	2124342:2124357
2068563:2068578	attL	AAACGGTTCCCCATAC	NA	NA	NA	NA
WP_000998048.1|2072922_2074461_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2074510_2074858_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|2074854_2075235_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000973180.1|2075596_2076142_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2076138_2076882_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2076893_2077973_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2078034_2078970_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2079426_2080344_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2080445_2081396_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|2081513_2083157_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2083782_2084499_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2084841_2086296_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2086397_2087714_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2088027_2089080_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_134793145.1|2089341_2097324_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_001302302.1|2097813_2098611_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533601.1|2098802_2099882_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.2e-99
WP_000094838.1|2099881_2100085_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2100143_2102615_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2102710_2102899_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2102895_2103084_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2103564_2103717_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2103991_2104636_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2104733_2104961_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2104957_2105383_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2105451_2106489_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2106400_2106943_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2106977_2107676_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2107697_2107922_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2107918_2108275_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2108307_2108460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2108456_2108768_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2108894_2109458_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2109567_2109672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2109858_2110071_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2110238_2110517_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2110518_2111568_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2111580_2111940_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2111936_2112626_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_001303558.1|2113259_2113688_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.4	4.9e-63
WP_000023257.1|2114165_2116016_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2116097_2117311_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2117621_2117837_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2117841_2118186_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2118236_2118770_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2118925_2119108_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2119120_2119252_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2119479_2119665_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2120191_2120506_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2120587_2120812_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2121206_2121716_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2123600_2123807_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2123803_2125396_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
2124342:2124357	attR	GTATGGGGAACCGTTT	NA	NA	NA	NA
WP_001254002.1|2125385_2126891_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2126927_2127275_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001452698.1|2127332_2127599_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2127580_2128321_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2128334_2128766_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2128792_2129206_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082463.1|2129186_2131766_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000847274.1|2131762_2132092_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_001151105.1|2132091_2132790_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000194801.1|2132800_2133544_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_097454001.1|2133489_2134119_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	99.0	7.8e-110
WP_137056729.1|2134359_2137839_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	98.8	0.0e+00
WP_001230514.1|2137906_2138506_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000268981.1|2138570_2139884_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	2.8e-77
WP_001023407.1|2139885_2140155_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 6
NZ_CP038360	Escherichia coli O157:H7 strain F7386 chromosome, complete genome	5403105	2517158	2626326	5403105	holin,capsid,protease,head,portal,tail,transposase,terminase	Stx2-converting_phage(40.59%)	130	NA	NA
WP_001260835.1|2517158_2517980_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2518079_2518163_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2518255_2518591_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2518987_2520241_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2520347_2521241_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2521375_2522596_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2522720_2523416_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2523368_2524661_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2524818_2525433_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2525475_2526330_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2526331_2526949_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2526959_2529383_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2529443_2531870_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2532068_2532374_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2532481_2533192_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2533194_2533755_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2533789_2534131_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2534265_2534592_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2535580_2535832_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_001491751.1|2535904_2537245_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	1.8e-58
WP_162829202.1|2537339_2538553_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001090200.1|2539781_2539973_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2539969_2540158_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2540558_2540723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2540726_2540945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2541016_2541316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2541668_2541947_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2541948_2542140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2542160_2542532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2542629_2542932_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2542928_2543354_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2543376_2544339_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2544345_2545086_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2545896_2546292_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2546348_2546933_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2547048_2547153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2547341_2547554_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2547721_2548000_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2548001_2549051_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2549063_2549423_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2549419_2550109_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2550746_2551175_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_000023202.1|2551653_2553504_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.4	0.0e+00
WP_024180155.1|2553943_2554159_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2554163_2554508_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2554558_2555092_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2555362_2555932_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2555931_2556078_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2556305_2556491_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2556915_2557143_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|2557184_2557550_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958387.1|2557840_2558404_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2558400_2560062_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2560125_2562063_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2562107_2562329_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267295.1|2562274_2564854_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_000125988.1|2564856_2565183_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2565192_2565543_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2565539_2565986_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2565982_2566327_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2566392_2567109_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2567123_2567498_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2567593_2567803_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212818.1|2567850_2571093_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_000807954.1|2571085_2571427_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179509.1|2571426_2571864_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_012779365.1|2572051_2575312_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.3	0.0e+00
WP_001304111.1|2575314_2575530_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2575597_2576197_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268860.1|2576261_2577485_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	94.8	8.7e-81
WP_001023362.1|2577486_2577756_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131642.1|2577869_2578445_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121225.1|2579155_2579806_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2580388_2581927_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2581976_2582324_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|2582320_2582701_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_001120551.1|2583663_2583906_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000102123.1|2584616_2585861_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2585953_2586142_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2586138_2586327_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2586891_2587101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2587101_2587740_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2587751_2587904_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2588196_2588535_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2588926_2589169_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2589152_2589578_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2589646_2590690_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|2590682_2591144_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2591177_2591894_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2591926_2592208_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699808.1|2592204_2592432_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	1.5e-10
WP_001289673.1|2592424_2592736_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2592863_2593082_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2593083_2593641_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2593874_2594087_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2594206_2594551_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2594672_2594945_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2594946_2595996_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2596008_2596314_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2596376_2596931_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2597155_2597353_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2597488_2598202_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2598652_2599084_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|2599561_2601412_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|2601850_2602066_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731239.1|2602070_2602478_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	97.2	1.3e-52
WP_001063023.1|2603021_2603243_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000126026.1|2605283_2605610_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	4.5e-53
WP_001007901.1|2605619_2605970_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2605966_2606413_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2606409_2606754_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2606812_2607529_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2607534_2607909_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2608004_2608214_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212925.1|2608265_2611508_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
WP_000807954.1|2611500_2611842_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179510.1|2611841_2612540_+|tail	phage minor tail protein L	tail	A0A0P0ZD89	Stx2-converting_phage	97.8	7.6e-130
WP_000194720.1|2612550_2613294_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_050439450.1|2613239_2613872_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000514693.1|2614213_2615782_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.2	1.1e-298
WP_001230508.1|2618356_2618956_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268848.1|2619020_2620334_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	98.2	1.4e-81
WP_001023407.1|2620335_2620605_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2620718_2621294_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2621366_2621996_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2622077_2622719_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|2622880_2623123_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2623254_2624538_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2624626_2626087_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2626122_2626326_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 7
NZ_CP038360	Escherichia coli O157:H7 strain F7386 chromosome, complete genome	5403105	2897934	2971571	5403105	holin,capsid,integrase,lysis,protease,head,portal,tail,transposase,terminase	Enterobacteria_phage(32.73%)	84	2913436:2913463	2971708:2971735
WP_000422055.1|2897934_2898984_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2899203_2899962_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2899958_2900549_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2900588_2901461_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2901673_2903257_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2903284_2903905_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2903901_2904783_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2904920_2904965_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194604.1|2905056_2906619_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2906618_2908214_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|2908214_2909576_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2909587_2910781_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2910780_2911587_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2911967_2912147_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2912232_2912733_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2912778_2913285_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2913436:2913463	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_001144877.1|2916756_2917347_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2917530_2918178_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2918314_2918461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2918888_2919167_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171540.1|2919506_2919887_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2919883_2920231_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2920280_2921819_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|2922784_2923354_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2923419_2924331_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2924437_2924560_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2926157_2927483_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2928509_2928779_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216534.1|2928780_2930085_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.5	3.9e-79
WP_001228334.1|2930236_2930836_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.0	1.0e-106
WP_000514948.1|2930903_2933759_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	72.8	0.0e+00
WP_122989782.1|2933999_2934629_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	96.6	2.7e-102
WP_001151105.1|2935328_2936027_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|2936026_2936356_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000918257.1|2936352_2938998_-|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	98.6	0.0e+00
WP_000438877.1|2939041_2939350_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	99.0	1.5e-53
WP_000479043.1|2939376_2939799_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	100.0	5.1e-73
WP_000235090.1|2939812_2940565_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|2940572_2940968_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|2940964_2941498_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|2941512_2941866_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|2941877_2942276_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|2942317_2943343_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|2943398_2943731_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|2943740_2945060_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|2945040_2946642_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|2946638_2946845_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027185.1|2946841_2948767_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.0	0.0e+00
WP_000867498.1|2948741_2949287_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|2949673_2949898_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|2949979_2950294_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001082601.1|2950757_2951225_-|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	92.2	1.1e-71
WP_000539792.1|2951232_2951379_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2951378_2951948_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2952218_2952752_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2952802_2953147_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2953151_2953367_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_001415558.1|2954235_2954394_-	DUF1737 domain-containing protein	NA	Q5MBW4	Stx1-converting_phage	100.0	3.5e-11
WP_000935548.1|2955133_2956192_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|2956342_2956540_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2956781_2957312_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2957320_2957680_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2957692_2958739_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2958740_2959019_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2959088_2959346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2959566_2959779_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2960057_2960816_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2961514_2961679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2961675_2962257_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2962443_2962986_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2962897_2963938_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2963909_2964461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2964444_2964672_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2964748_2965156_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2965419_2965719_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2965791_2966010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2966032_2966440_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2966417_2966651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|2966644_2966812_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2967209_2967398_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090196.1|2967394_2967586_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|2967678_2970150_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2970214_2970463_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2970440_2971571_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
2971708:2971735	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 8
NZ_CP038360	Escherichia coli O157:H7 strain F7386 chromosome, complete genome	5403105	3018267	3108933	5403105	holin,capsid,integrase,tRNA,lysis,protease,head,portal,tail,transposase,terminase	Enterobacteria_phage(48.15%)	99	3035803:3035818	3102836:3102851
WP_001299679.1|3018267_3019524_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3019737_3020361_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3020360_3021212_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3021362_3022310_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3022434_3024114_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3024168_3024447_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3024724_3025309_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3025425_3026517_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001295616.1|3028629_3029241_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3029340_3030255_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3030350_3032087_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_000197859.1|3032475_3033546_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3033555_3034854_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3035216_3036749_+	SpoVR family protein	NA	NA	NA	NA	NA
3035803:3035818	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3036800_3037520_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3037741_3039283_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3039428_3039959_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457641.1|3040004_3041273_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	82.9	8.7e-209
WP_000897378.1|3041272_3041692_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3042064_3042976_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3043182_3043644_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3043720_3044380_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3044451_3044745_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3044756_3044915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3044985_3045387_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3045489_3045858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3046377_3047073_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3047096_3047909_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3047912_3048179_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_162829202.1|3049344_3050558_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000361110.1|3050731_3051316_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3051814_3052768_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3052954_3054439_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998042.1|3054741_3056280_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.0e-299
WP_000612591.1|3056329_3056677_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171540.1|3056673_3057054_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000937476.1|3057129_3057378_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3057434_3058103_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3058600_3058783_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3058861_3059362_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3059398_3059905_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3059923_3060814_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3060933_3061515_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3061514_3064430_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3064494_3065094_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3065160_3068559_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3068619_3069252_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3069188_3069932_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3069937_3070636_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3070635_3070965_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3070961_3073511_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3073503_3073938_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3073919_3074342_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3074357_3075098_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3075105_3075501_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3075497_3076076_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3076087_3076441_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3076452_3076851_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063213.1|3076892_3077918_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	2.5e-190
WP_001295978.1|3077973_3078306_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3078315_3079635_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3079615_3081217_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3081213_3081420_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3081416_3083342_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3083316_3083862_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3084250_3084445_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3084609_3084816_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3085101_3085512_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3085803_3086097_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3086187_3086370_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3086586_3087063_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3087049_3087355_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3087676_3088366_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3088362_3088503_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3088499_3088862_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3088858_3089149_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3089141_3089312_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3089311_3089767_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_162829202.1|3090772_3091986_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000709085.1|3092011_3093109_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	6.7e-32
WP_001302833.1|3093166_3093289_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3093353_3093686_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3093753_3094056_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3094052_3094754_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3095678_3095915_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3095904_3097047_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3097160_3098411_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3098582_3099236_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3099245_3099707_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3099760_3100867_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3100902_3101544_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3101547_3102918_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3102836:3102851	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3103086_3103758_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3103757_3105218_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3105818_3106100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3106355_3106898_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3107103_3107517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3107529_3107865_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3107877_3108933_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 9
NZ_CP038360	Escherichia coli O157:H7 strain F7386 chromosome, complete genome	5403105	3115024	3169693	5403105	holin,capsid,integrase,head,portal,tail,terminase	Stx2-converting_phage(28.85%)	67	3136670:3136685	3176436:3176451
WP_000085256.1|3115024_3116254_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3116502_3117624_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3117672_3118899_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3119148_3120285_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3120268_3121132_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3121495_3122857_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3122917_3123193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3125501_3128903_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3129493_3131842_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3131861_3131951_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3131963_3132200_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3132145_3132883_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3132936_3133815_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3134117_3134228_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3134337_3134592_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3134608_3135307_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807950.1|3135306_3135648_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	99.1	3.3e-62
WP_000212818.1|3135640_3138883_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.6	0.0e+00
3136670:3136685	attL	CAGTTCACCCAGCGCT	NA	NA	NA	NA
WP_001453746.1|3138930_3139140_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3139235_3139610_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275434.1|3139624_3140341_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000133388.1|3140406_3140751_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573391.1|3140747_3141194_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_001007905.1|3141190_3141541_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125988.1|3141550_3141877_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_000267295.1|3141879_3144459_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	100.0	0.0e+00
WP_001063099.1|3144404_3144626_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3144670_3146608_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3146671_3148333_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958416.1|3148329_3148893_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3149182_3149548_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_001302295.1|3149589_3149775_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	88.5	1.4e-19
WP_000347013.1|3149904_3150045_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3150401_3150626_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3150690_3150897_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3151124_3151271_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3151270_3151840_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3152110_3152644_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3152694_3153039_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3153043_3153259_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3153334_3153604_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3153641_3153824_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001265168.1|3155514_3156564_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3156565_3156844_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3157011_3157224_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3157412_3157517_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3157632_3158220_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3158222_3158414_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3158415_3158853_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3158839_3159157_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3159110_3159428_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3159417_3159720_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3159716_3159998_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3160030_3160747_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3160780_3161323_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3161234_3162272_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3162340_3162766_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3162749_3163073_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3163197_3163674_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3163989_3164142_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3164256_3164772_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3164904_3165294_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3165355_3165625_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3165593_3166712_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3166878_3167673_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3167669_3168716_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3168871_3169693_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3176436:3176451	attR	AGCGCTGGGTGAACTG	NA	NA	NA	NA
>prophage 10
NZ_CP038360	Escherichia coli O157:H7 strain F7386 chromosome, complete genome	5403105	3299140	3366070	5403105	transposase,integrase,protease	Stx2-converting_phage(35.71%)	59	3325623:3325638	3344836:3344851
WP_001182418.1|3299140_3300220_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	34.4	6.2e-38
WP_000797372.1|3300219_3301176_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_000506898.1|3301186_3302395_+	DUF4236 domain-containing protein	NA	NA	NA	NA	NA
WP_001176766.1|3302412_3302880_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_000042916.1|3303140_3303470_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_000957248.1|3303456_3303798_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_000088522.1|3304740_3306354_-|transposase	IS66-like element IS682 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	65.7	3.1e-166
WP_000624701.1|3306384_3306735_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	64.7	1.1e-39
WP_000435663.1|3306731_3307157_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	1.4e-33
WP_000097913.1|3308301_3308475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000397132.1|3309494_3310166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001135715.1|3311037_3311178_-	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	66.7	2.4e-11
WP_000803992.1|3311479_3311743_-	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_001021389.1|3312954_3313572_-	urease accessory protein UreG	NA	NA	NA	NA	NA
WP_001142971.1|3313583_3314258_-	urease accessory protein UreF	NA	NA	NA	NA	NA
WP_000966485.1|3314258_3314723_-	urease accessory protein UreE	NA	NA	NA	NA	NA
WP_000065682.1|3314732_3316436_-	urease subunit alpha	NA	NA	NA	NA	NA
WP_000612150.1|3316428_3316749_-	urease subunit beta	NA	NA	NA	NA	NA
WP_000424145.1|3316757_3317060_-	urease subunit gamma	NA	NA	NA	NA	NA
WP_010904558.1|3317150_3317849_-	urease accessory protein UreD	NA	NA	NA	NA	NA
WP_000134927.1|3318229_3318505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000591997.1|3318729_3320349_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000024297.1|3320441_3320801_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_001304211.1|3321486_3321777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303891.1|3321800_3322052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028913479.1|3322099_3322705_-	conjugal transfer protein TraT	NA	NA	NA	NA	NA
WP_001171554.1|3324096_3324477_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3324473_3324821_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3324870_3326409_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
3325623:3325638	attL	CCAGGTACTGCTGCCG	NA	NA	NA	NA
WP_000136079.1|3326827_3327004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000233452.1|3327165_3329526_-	DEAD/DEAH box helicase family protein	NA	Q84473	Paramecium_bursaria_Chlorella_virus	32.5	1.8e-34
WP_000600952.1|3329680_3330208_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_162829242.1|3330268_3331481_+|transposase	IS3 family transposase	transposase	A0A0N7C035	Escherichia_phage	100.0	2.2e-169
WP_000335698.1|3332377_3333763_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|3333981_3334179_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_001303889.1|3334405_3334702_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000282209.1|3335813_3337631_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279869.1|3337817_3339020_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	3.8e-44
WP_000611868.1|3339386_3340373_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115801845.1|3340369_3341311_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_000831622.1|3341324_3342713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001055491.1|3342709_3343498_-	outer membrane lipoprotein-sorting protein	NA	NA	NA	NA	NA
WP_000012254.1|3343506_3344817_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000192888.1|3344817_3345474_-	hypothetical protein	NA	NA	NA	NA	NA
3344836:3344851	attR	CGGCAGCAGTACCTGG	NA	NA	NA	NA
WP_001192027.1|3345457_3346165_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	1.9e-35
WP_000137012.1|3346175_3347129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000367826.1|3347125_3348349_-	beta-ketoacyl synthase	NA	NA	NA	NA	NA
WP_000856330.1|3348353_3350912_-	beta-ketoacyl-ACP synthase	NA	NA	NA	NA	NA
WP_000838077.1|3350985_3352146_-	aminomethyl transferase family protein	NA	NA	NA	NA	NA
WP_000106017.1|3352181_3352463_-	acyl carrier protein	NA	NA	NA	NA	NA
WP_000049966.1|3352484_3353033_-	beta-hydroxyacyl-ACP dehydratase	NA	NA	NA	NA	NA
WP_001302777.1|3353036_3353798_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001219671.1|3353811_3354180_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001177016.1|3354195_3355815_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_001240839.1|3355903_3359716_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	34.7	8.1e-24
WP_001039007.1|3361106_3361730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000493084.1|3361772_3362333_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001019839.1|3362418_3363120_+	molecular chaperone	NA	NA	NA	NA	NA
WP_162829202.1|3364857_3366070_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
>prophage 11
NZ_CP038360	Escherichia coli O157:H7 strain F7386 chromosome, complete genome	5403105	3432729	3488343	5403105	holin,capsid,protease,head,portal,tail,transposase	Escherichia_phage(26.19%)	61	NA	NA
WP_000003653.1|3432729_3433317_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3433313_3434021_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3434039_3435833_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
WP_001301613.1|3435829_3436948_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3439221_3439491_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_171877658.1|3439492_3440806_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.8	8.2e-77
WP_001230444.1|3440870_3441470_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515111.1|3441537_3445011_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	95.5	0.0e+00
WP_000649829.1|3445144_3445672_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_050546863.1|3445862_3446495_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194801.1|3446440_3447184_-|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	99.6	7.0e-150
WP_001151105.1|3447194_3447893_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847274.1|3447892_3448222_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	99.1	2.1e-58
WP_000082463.1|3448218_3450798_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|3450778_3451192_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3451218_3451650_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3451663_3452404_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001452698.1|3452385_3452652_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3452709_3453057_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3453093_3454599_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3454588_3456181_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3456177_3456384_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3458560_3460099_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3460148_3460496_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3460492_3460873_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3460948_3461224_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3461974_3462181_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3462436_3462709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003115.1|3462868_3463402_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	93.8	5.3e-99
WP_000675931.1|3463622_3463736_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3463957_3464143_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3464670_3464985_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3465189_3466403_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|3466578_3468429_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3469196_3469910_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3470530_3471349_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3471500_3471872_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3471861_3472233_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3472245_3473295_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3473296_3473575_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3473742_3473898_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3473999_3474137_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3474502_3475276_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3475627_3476041_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3476056_3476827_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788745.1|3476848_3477595_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	3.1e-113
WP_001205823.1|3477601_3478693_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3478771_3479227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3479433_3479859_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3479842_3480115_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3480223_3480625_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3480652_3480844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3480843_3481131_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3481408_3481564_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3481705_3482095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3482281_3482467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3483040_3483229_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3483225_3483417_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3483510_3485982_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3486049_3486292_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000375128.1|3487683_3488343_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
>prophage 12
NZ_CP038360	Escherichia coli O157:H7 strain F7386 chromosome, complete genome	5403105	3719270	3757371	5403105	holin,integrase,protease,lysis,portal,tail,terminase	Enterobacteria_phage(48.84%)	50	3718855:3718869	3757445:3757459
3718855:3718869	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3719270_3719969_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951025.1|3720199_3721081_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	89.8	1.1e-146
WP_072127173.1|3721250_3721412_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3721908_3722928_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3722961_3723942_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3724118_3724388_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741889.1|3724389_3725706_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	95.6	1.2e-70
WP_001233141.1|3725765_3726365_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3726435_3729849_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3729909_3730518_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3730454_3731198_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3731203_3731902_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3731911_3732241_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3732240_3735306_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3735277_3735607_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3735615_3736002_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3736062_3736806_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3736816_3737218_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3737214_3737793_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3737804_3738080_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3738072_3738396_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3738482_3740510_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3740454_3740790_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3740911_3742036_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3741963_3742176_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3742172_3744275_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3744274_3744766_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3745440_3745593_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3745580_3746048_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3746044_3746542_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_001303850.1|3746541_3746757_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_012578864.1|3746899_3747298_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3747378_3747537_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3747622_3748366_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3748549_3749239_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3749253_3749376_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3749713_3750673_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3750884_3751550_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3751546_3752167_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3752159_3752330_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3752326_3752509_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3753206_3753887_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3753883_3754066_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3754038_3754230_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3754240_3754522_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3754620_3754842_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3755052_3755655_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3755897_3756065_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3756104_3756323_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3756300_3757371_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3757445:3757459	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 13
NZ_CP038360	Escherichia coli O157:H7 strain F7386 chromosome, complete genome	5403105	4337060	4378310	5403105	tail,transposase	Escherichia_phage(35.0%)	44	NA	NA
WP_162829202.1|4337060_4338273_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000246059.1|4339798_4340542_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355475.1|4341365_4342139_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4342196_4342751_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115574.1|4342780_4343275_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	93.5	3.9e-80
WP_000805544.1|4343274_4343868_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|4343839_4344283_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_000844960.1|4344303_4344699_-	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	96.9	1.7e-65
WP_000788819.1|4345013_4345325_-	hypothetical protein	NA	A0A0M5M1K4	Salmonella_phage	73.2	9.7e-29
WP_000251069.1|4346276_4346570_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_000437875.1|4346688_4346889_-	hypothetical protein	NA	A4KWT7	Enterobacteria_phage	100.0	4.3e-30
WP_001274756.1|4346989_4347703_+	LexA family transcriptional regulator	NA	A4KWV9	Enterobacteria_phage	99.2	3.5e-130
WP_000708831.1|4347830_4348214_+	hypothetical protein	NA	A0A0R6PGY5	Moraxella_phage	36.2	4.4e-07
WP_162829202.1|4348239_4349452_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303805.1|4349779_4350025_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4351094_4352348_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4352359_4353463_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4353750_4354806_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4354844_4355246_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4355303_4356548_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4356639_4357098_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4357358_4358816_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023438539.1|4358872_4359430_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4359341_4359608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4359914_4360367_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4360376_4360775_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4360777_4361071_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226187.1|4361122_4362178_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4362248_4363034_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4362978_4364718_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4365535_4366309_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4366494_4366755_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4366773_4367034_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4367189_4367930_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4367900_4368668_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4368772_4369351_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4369590_4372035_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4372077_4372551_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4372704_4373475_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4373592_4374765_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4374845_4375031_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4374945_4375209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4375410_4377171_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4377173_4378310_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 14
NZ_CP038360	Escherichia coli O157:H7 strain F7386 chromosome, complete genome	5403105	4835664	4894675	5403105	transposase,protease	Klosneuvirus(12.5%)	60	NA	NA
WP_001162171.1|4835664_4837017_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4837110_4837662_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4837817_4839191_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4839366_4840365_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4840397_4841393_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4841379_4842402_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000265942.1|4844057_4845014_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4845323_4845854_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4845933_4846284_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4846277_4846529_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4846740_4847082_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_171877661.1|4847084_4850864_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4850860_4852594_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4852799_4853438_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4853760_4855104_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4855182_4855389_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|4855713_4856268_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937659.1|4856330_4857269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4857480_4858221_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|4858410_4860354_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4860471_4860852_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4860940_4861801_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4861908_4862874_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4862981_4863644_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4863688_4865101_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4865409_4866030_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4866247_4866886_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4867020_4868229_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4868236_4868668_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4869290_4870085_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4870155_4870605_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4870646_4870874_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4870878_4871193_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4871199_4871595_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4871921_4872197_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4872325_4873012_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949515.1|4873011_4873866_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4873875_4874526_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4874539_4875004_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4875013_4875319_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|4875334_4876732_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|4877086_4878151_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|4878258_4879014_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|4879010_4879760_-	esterase	NA	NA	NA	NA	NA
WP_000254630.1|4879941_4880271_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4880419_4880695_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4880811_4882437_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4882520_4883684_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4883686_4884325_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4884334_4884733_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|4884750_4885410_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4885460_4886159_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4886177_4886579_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4886705_4887437_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|4887617_4890059_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177633.1|4890097_4890523_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4890727_4892026_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4892129_4892327_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4892408_4893413_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4893415_4894675_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 15
NZ_CP038360	Escherichia coli O157:H7 strain F7386 chromosome, complete genome	5403105	5031554	5046219	5403105	tRNA,integrase,tail	Enterobacteria_phage(43.75%)	19	5027395:5027410	5044924:5044939
5027395:5027410	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5031554_5032970_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5033052_5034036_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5034201_5034444_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543818.1|5034577_5035615_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5035703_5036801_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5036862_5037111_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5037271_5037913_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5037994_5038624_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5038696_5039269_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5039380_5039650_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5039651_5040965_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5041029_5041629_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5042950_5043487_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5043477_5043828_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5043824_5044109_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5044444_5044642_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5044986_5045268_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5044924:5044939	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5045315_5045489_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5045685_5046219_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP038362	Escherichia coli O157:H7 strain F7386 plasmid pF7386-1, complete sequence	95928	0	40807	95928	transposase,integrase	Macacine_betaherpesvirus(45.45%)	35	16525:16539	40532:40546
WP_001302175.1|2588_3464_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_001302177.1|3464_5432_+	variant type II secretion system secretin EtpD	NA	NA	NA	NA	NA
WP_000092338.1|5431_6937_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173152.1|6938_8162_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001231211.1|8192_8627_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_000082929.1|8623_9178_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000173396.1|9192_9540_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000082782.1|9536_10136_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000776550.1|10132_11110_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_071525076.1|11148_12321_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_001004187.1|12307_12820_+	type II secretion system protein M	NA	NA	NA	NA	NA
WP_000096786.1|12877_13711_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000971918.1|13802_14204_+	GspS family T2SS pilot lipoprotein variant EptO	NA	NA	NA	NA	NA
WP_000839950.1|16094_16610_+	enterohemolysin-activating lysine-acyltransferase EhxC	NA	NA	NA	NA	NA
16525:16539	attL	AAATATTCAGGCAAT	NA	NA	NA	NA
WP_000217733.1|16611_19608_+	enterohemolysin EhxA	NA	NA	NA	NA	NA
WP_000987091.1|19657_21778_+	enterohemolysin T1SS ABC transporter permease/ATPase EhxB	NA	W8CYL7	Bacillus_phage	30.2	7.1e-46
WP_001213545.1|21781_23221_+	enterohemolysin T1SS ABC transporter subunit EhxD	NA	NA	NA	NA	NA
WP_032195322.1|23964_24204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001066920.1|24324_25065_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|25349_26327_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|26734_26935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|26931_27552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|27548_28232_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|28690_28909_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_162829348.1|28962_30176_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_027868286.1|30229_30529_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|30529_31336_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829202.1|31855_33069_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_162829202.1|33371_34585_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000852148.1|34660_35416_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|36003_37170_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|37169_38141_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|38835_39738_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|39741_40047_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|40123_40807_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
40532:40546	attR	AAATATTCAGGCAAT	NA	NA	NA	NA
