The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038386	Escherichia coli O157:H7 strain DEC5D chromosome, complete genome	5195683	864866	961199	5195683	protease,tRNA,transposase,integrase	Shigella_phage(50.0%)	75	912710:912727	958279:958296
WP_001034542.1|864866_869426_+|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
WP_000895883.1|869752_870562_+	prepilin peptidase PppA	NA	NA	NA	NA	NA
WP_001345954.1|870627_871038_+	type II secretion system pilot lipoprotein GspS-beta	NA	NA	NA	NA	NA
WP_000135080.1|871055_872015_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_000498829.1|872044_874105_+	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_000249364.1|874104_875598_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173397.1|875597_876821_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001087296.1|876837_877293_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001115148.1|877296_877860_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000820134.1|877856_878228_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_001255032.1|878224_878830_+	type II secretion system minor pseudopilin GspJ	NA	NA	NA	NA	NA
WP_000633162.1|878826_879804_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_000094984.1|879800_880979_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000942790.1|880980_881517_+	GspM family type II secretion system protein YghD	NA	NA	NA	NA	NA
WP_001280497.1|881797_882640_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_085959019.1|882727_883941_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_085959019.1|885684_886898_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_001069820.1|888265_889138_-	GTPase family protein	NA	NA	NA	NA	NA
WP_085959019.1|889288_890501_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_000241623.1|890471_891371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085959019.1|892653_893867_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_001419555.1|895090_895699_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029786874.1|895787_895973_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_085959019.1|896025_897238_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_000236756.1|897314_897509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221524.1|897708_898278_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270999.1|898445_898829_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013319.1|898825_899206_+	hypothetical protein	NA	NA	NA	NA	NA
WP_085959019.1|899237_900450_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_001369053.1|900757_900955_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000624681.1|902992_903343_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	1.8e-39
WP_000422686.1|903339_903765_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	2.0e-48
WP_171880628.1|904418_905123_-	DUF3491 domain-containing protein	NA	NA	NA	NA	NA
WP_085959019.1|905147_906361_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_171880617.1|906381_907101_-	DUF3491 domain-containing protein	NA	NA	NA	NA	NA
WP_085959019.1|907097_908311_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
912710:912727	attL	ATCTTCAAGATAGGTATA	NA	NA	NA	NA
WP_000609742.1|918486_919161_-	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_000953023.1|919209_920199_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	4.9e-98
WP_001121630.1|920806_922456_-	type III secretion system effector EspL2	NA	NA	NA	NA	NA
WP_000247601.1|924686_924863_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000605048.1|925436_925985_+	Ail/Lom family protein	NA	Q9LA63	Enterobacterial_phage	32.4	9.8e-16
WP_000631719.1|928306_928654_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
WP_001358695.1|928650_929325_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	2.4e-11
WP_001218882.1|930315_931581_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	3.0e-76
WP_000234483.1|931959_932667_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_000839816.1|933064_935200_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001049791.1|935249_936506_-	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_001419193.1|936707_937787_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|937851_938127_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001301529.1|938154_939207_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000786908.1|939367_940087_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107568.1|940086_940413_+	YggL family protein	NA	NA	NA	NA	NA
WP_000984796.1|940596_941316_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394114.1|941491_942538_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000745247.1|942654_943662_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000239959.1|943813_944950_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174762.1|944942_945536_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277224.1|945543_945834_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|945830_946397_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997795.1|946414_947119_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001055622.1|947136_948117_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017110.1|948307_948724_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001053178.1|948723_949287_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593272.1|949398_950346_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001222509.1|950358_951090_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286494.1|951169_951877_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_000858396.1|951971_952469_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001418166.1|952545_953940_-	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001062128.1|954376_955531_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001303650.1|955834_956050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297406.1|956185_956317_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001295380.1|956325_958302_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
958279:958296	attR	TATACCTATCTTGAAGAT	NA	NA	NA	NA
WP_000758914.1|958447_959179_+	lipoprotein	NA	NA	NA	NA	NA
WP_000105566.1|959314_960235_+	agmatinase	NA	NA	NA	NA	NA
WP_000701842.1|960440_961199_-|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
>prophage 2
NZ_CP038386	Escherichia coli O157:H7 strain DEC5D chromosome, complete genome	5195683	1573075	1578501	5195683	integrase	Enterobacteria_phage(50.0%)	6	1562063:1562079	1580697:1580713
1562063:1562079	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1573075_1573645_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403518.1|1573644_1574112_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.0	1.8e-63
WP_000960724.1|1574098_1574779_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1574788_1575925_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958698.1|1576099_1577257_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	99.7	1.4e-221
WP_000368131.1|1577568_1578501_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1580697:1580713	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038386	Escherichia coli O157:H7 strain DEC5D chromosome, complete genome	5195683	1824511	1833957	5195683		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569336.1|1824511_1825438_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1825442_1826174_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1826154_1826262_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1826321_1827053_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001359340.1|1827274_1828960_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.8	5.1e-305
WP_000598641.1|1828956_1829676_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1829722_1830193_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001359339.1|1830234_1830696_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	2.4e-76
WP_001087225.1|1830820_1832824_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001359338.1|1832820_1833957_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
>prophage 4
NZ_CP038386	Escherichia coli O157:H7 strain DEC5D chromosome, complete genome	5195683	1995136	2072464	5195683	capsid,head,protease,portal,tail,holin,integrase,terminase,transposase	Enterobacteria_phage(30.23%)	70	1995129:1995188	2042910:2044168
1995129:1995188	attL	TGTAGTGGTCAAGTAATACTGGCCACGGTTTTACAGTAAAAATGATATCTGTTCTCTGAC	NA	NA	NA	NA
WP_085959019.1|1995136_1996350_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_000502860.1|1996776_1997415_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.0	2.1e-54
WP_001419103.1|1997785_1999933_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000973176.1|2001604_2002150_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2002146_2002890_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2002901_2003981_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986329.1|2004042_2004978_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2005434_2006352_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2006453_2007404_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|2009790_2010507_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060244.1|2010849_2012304_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2012405_2013722_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2014036_2015089_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_001302302.1|2023822_2024620_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533608.1|2024855_2025881_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	56.7	2.9e-101
WP_000094838.1|2025880_2026084_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000990641.1|2026142_2028560_-	exonuclease	NA	V5UQJ3	Shigella_phage	60.1	6.0e-174
WP_000199480.1|2028652_2028841_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449169.1|2028837_2029026_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000559929.1|2029567_2030083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379559.1|2030196_2030349_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_001003381.1|2030542_2030950_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476994.1|2031027_2031255_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705361.1|2031238_2031760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054513.1|2031740_2032706_+	hypothetical protein	NA	U5P0A0	Shigella_phage	59.6	2.2e-55
WP_001151172.1|2032746_2033154_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	1.8e-62
WP_000101550.1|2033594_2034554_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_000813254.1|2034925_2035081_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001004959.1|2035246_2035897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|2035877_2036981_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_000975564.1|2037135_2037396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2037465_2037744_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001265288.1|2037745_2038795_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	2.0e-110
WP_001217436.1|2038807_2039179_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_000090265.1|2039168_2039540_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.0	1.0e-53
WP_000265268.1|2039692_2040511_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000261911.1|2041131_2041845_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001419488.1|2042612_2042948_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	83.8	1.0e-44
WP_085959019.1|2042917_2044131_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_000411813.1|2046016_2046223_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
2042910:2044168	attR	TGTAGTGGTCAAGTAATACTGGCCACGGTTTTACAGTAAAAATGATATCTGTTCTCTGACTCTTCCGGCGTCAGCCCTCCGTTATAATGGTGAGGCCTGACGCTATTGTAATAATTCAGAATATAACTGCTGATTTGCTGCCGGGCCACGTCTTTGCCTGTGTAGCCATCGGTTGGCACCCATTCTGTTTTCAGACTGCGGAAGAAGCGTTCCATTGGACTGTTATCCCAGCAGTTTCCCCGTCGGCTGACACTTTGCTTTATCCTGTAACGCCAGAGAAGTTGTTGATATTTCAGTCCTGTATATTGACTTCCCTGGTCGCTATGGAACATGACGTCCCGCGGCTGACCACGCACCTCATACGCCATCCGCAGGGCACTGCTTATCAGGGCAGTATCGGCATTCGCTGACAGGCTCCAGCCGATAACCCTGCGGGCAAAAAGATCCATGACGACCGCCAGATAGCACCAGCGATTTCCTGCCCAGATATACGTAATATCTCCGCACCATACCCTATCTGGCTCGGGCACAGCGAACTGGCGCTCAAGCAGATTCGGCAGGCAGGTATGTTCCTGACGAGCATTTTTGTACTGATGTTTTCCGGGCTGACAACTGCTCAGGTTCAGATATTTCATCAGACGCCCGGCACGGTAACGGCTCATCGGGACGCCGTTTTGGGTCAGCATTTCAGCCAGCGTGCGCGCCCCCGCAGAGCCCCTACTTTGGTTCCACGCCCGGCGTATTTCGCTGCACAACCTGACTCGCGCCGGATTAACCGTATCGCGTCGTTTTCGCCAGTACTGGTAACTGCTGCGGTGTATTTCCAGAGCAGAACAGAGGCTGACAACTGAGTGGCTGTCACTCAGTCTGGCAACTATCGTGAACCGTTCAGCGAGTCGGACATCAAGAGCGCGGTAGCCTTTTTTAATATCGTATTGTGTTCCTCCAGGCGGCGAACCTGCTTTTCCAGTTCGCGGATACGTTGCTGGTCTGGAGTAATAGGTGTGGCAGAGGGCGCAATCCCCTGACGCTCTCGCCTGAGCTGGCGCACCCAACTCTCAAGCGTGGTAGAACCGACATTCATCGCTTCACTGGCTTGTCGATATGAGTAGCCCTTATCAACAATTAGCTGTGCACATTCCAGCCTGAATTCAGGGGTGAAAGTACGTTTGGTTTTCTTGTTCATTAAGTCACCTGTTTTGTGTTGTGGTGAGGATATCACCTTTAATCAGGTGGCCAAATTTACTGTGCCACTACAG	NA	NA	NA	NA
WP_000731214.1|2046227_2047217_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	64.4	6.8e-108
WP_001092850.1|2047259_2047793_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	3.9e-102
WP_032140280.1|2048347_2048434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122991286.1|2048655_2048841_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	6.0e-18
WP_000347012.1|2049527_2049665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|2049801_2049987_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000235436.1|2050388_2050898_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001418004.1|2050869_2052798_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	3.9e-261
WP_000259002.1|2052781_2052988_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831776.1|2052984_2054577_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001253995.1|2054566_2056072_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256821.1|2056108_2056456_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_000522655.1|2056513_2057542_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.5e-113
WP_000201512.1|2057593_2057977_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|2057969_2058323_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974984.1|2058338_2058872_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.9e-56
WP_000683079.1|2058868_2059264_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235113.1|2059271_2060024_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	2.7e-133
WP_000479105.1|2060037_2060469_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000533426.1|2060495_2060909_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	1.3e-41
WP_000082511.1|2060889_2063469_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.1	0.0e+00
WP_000847304.1|2063465_2063795_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001419081.1|2063794_2064493_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	3.1e-131
WP_000194791.1|2064498_2065242_+|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	98.8	2.7e-149
WP_050546863.1|2065187_2065820_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649829.1|2066010_2066538_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_000515116.1|2066671_2070148_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	94.0	0.0e+00
WP_001230271.1|2070215_2070815_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	96.0	2.0e-107
WP_000279045.1|2070879_2072193_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	97.5	6.9e-76
WP_001023480.1|2072194_2072464_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	7.1e-44
>prophage 5
NZ_CP038386	Escherichia coli O157:H7 strain DEC5D chromosome, complete genome	5195683	2447160	2517149	5195683	capsid,head,integrase,portal,tail,holin,protease,terminase,transposase	Enterobacteria_phage(33.87%)	86	2451264:2451279	2483512:2483527
WP_001260837.1|2447160_2447982_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2448081_2448165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2448257_2448593_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2448989_2450243_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2450349_2451243_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
2451264:2451279	attL	CCCGAAAAATGTGCTG	NA	NA	NA	NA
WP_000225276.1|2451377_2452598_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2452722_2453418_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2453370_2454663_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148719.1|2454820_2455435_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2455477_2456332_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2456333_2456951_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000642739.1|2456961_2459358_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	3.7e-208
WP_000041706.1|2459445_2461872_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.8	5.5e-212
WP_000778147.1|2462070_2462376_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2462483_2463194_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2463196_2463757_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2463791_2464133_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001358609.1|2464267_2464594_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001358608.1|2464799_2466014_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	3.1e-46
WP_000836042.1|2466025_2467045_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.5	1.1e-17
WP_001531709.1|2467102_2467207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001206152.1|2467232_2468528_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	7.4e-155
WP_000005551.1|2468547_2468799_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.9e-15
WP_000048562.1|2468870_2471342_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	57.4	1.4e-53
WP_001090185.1|2471421_2471625_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449178.1|2471621_2471810_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_000559928.1|2472358_2472874_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001414141.1|2472988_2473141_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000104592.1|2473406_2474123_-	helix-turn-helix domain-containing protein	NA	H9C160	Pectobacterium_phage	40.8	6.7e-49
WP_000471546.1|2474172_2474388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693859.1|2474384_2474810_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000770544.1|2474834_2475800_+	hypothetical protein	NA	U5P0A0	Shigella_phage	65.0	4.3e-59
WP_001151255.1|2475840_2476266_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	91.4	4.8e-63
WP_000935420.1|2476692_2476905_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	94.3	5.8e-33
WP_000256993.1|2476937_2477156_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	86.1	1.1e-26
WP_000224233.1|2477157_2477421_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000207995.1|2477431_2478301_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	77.2	1.0e-120
WP_001278454.1|2478416_2478521_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001278454.1|2478523_2478628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018421.1|2478817_2479030_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	8.1e-27
WP_001302544.1|2479071_2479257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001417850.1|2479197_2479476_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.6e-11
WP_001265028.1|2479477_2480524_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.5	1.4e-108
WP_001217410.1|2480536_2480911_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
WP_000762928.1|2480907_2481729_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	4.1e-82
WP_000216629.1|2482325_2482493_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000023170.1|2482807_2484745_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
2483512:2483527	attR	CCCGAAAAATGTGCTG	NA	NA	NA	NA
WP_001213059.1|2484892_2485075_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001289717.1|2485112_2485382_+	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_000284518.1|2485457_2485673_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_000731256.1|2485677_2486022_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	98.2	2.9e-58
WP_000992167.1|2486072_2486606_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_001056806.1|2486876_2487446_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2487445_2487592_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2487819_2488005_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000105085.1|2488429_2488657_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	98.7	1.1e-34
WP_000235436.1|2489051_2489561_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001418004.1|2489532_2491461_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.0	3.9e-261
WP_000259002.1|2491444_2491651_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831776.1|2491647_2493240_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	4.2e-184
WP_001253995.1|2493229_2494735_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256821.1|2494771_2495119_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_000522655.1|2495176_2496205_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.5e-113
WP_000201512.1|2496256_2496640_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|2496632_2496986_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974984.1|2497001_2497535_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	1.9e-56
WP_000683079.1|2497531_2497927_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235113.1|2497934_2498687_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.4	2.7e-133
WP_000479105.1|2498700_2499132_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
WP_000533426.1|2499158_2499572_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	1.3e-41
WP_171880620.1|2499552_2502132_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.6	0.0e+00
WP_000847345.1|2502128_2502458_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_001152612.1|2502457_2503156_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_001419351.1|2503160_2503904_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.4	6.1e-146
WP_071781836.1|2503840_2504473_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.6	1.6e-94
WP_171880621.1|2504533_2507932_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	88.2	0.0e+00
WP_001230346.1|2507998_2508598_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	97.5	7.5e-110
WP_014640517.1|2508662_2509976_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.6	2.6e-75
WP_001023432.1|2509977_2510247_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q9EYE9	Enterobacteria_phage	97.8	5.4e-44
WP_001131642.1|2510359_2510935_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121226.1|2511645_2512296_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_000343700.1|2512445_2513654_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.7	1.6e-47
WP_001120551.1|2513703_2513946_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347489.1|2514077_2515361_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2515449_2516910_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2516945_2517149_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 6
NZ_CP038386	Escherichia coli O157:H7 strain DEC5D chromosome, complete genome	5195683	2789220	2837898	5195683	tail,holin,protease,terminase,transposase	Escherichia_phage(34.38%)	57	NA	NA
WP_000422055.1|2789220_2790270_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2790489_2791248_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278896.1|2791244_2791835_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2791874_2792747_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001419072.1|2792959_2794543_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2794570_2795191_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2795187_2796069_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2796206_2796251_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194629.1|2796342_2797905_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2797904_2799500_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983857.1|2799500_2800862_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2800873_2802067_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443044.1|2802066_2802873_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2803253_2803433_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2803518_2804019_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079491.1|2804064_2804571_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000938103.1|2807030_2807600_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2807665_2808577_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2808683_2808806_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_106423857.1|2810815_2811010_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	87.2	1.1e-09
WP_000767050.1|2810954_2811497_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
WP_001023357.1|2811717_2811987_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	100.0	3.8e-45
WP_000279199.1|2811988_2813149_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	97.9	6.3e-81
WP_000214114.1|2813213_2813846_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.7	5.2e-69
WP_085959019.1|2813842_2815056_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_085959019.1|2815475_2816689_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_001419048.1|2817077_2817641_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	9.2e-86
WP_001359494.1|2817756_2818287_-	HNH endonuclease	NA	H6WZK7	Escherichia_phage	92.6	2.6e-90
WP_000074669.1|2818328_2818553_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|2818634_2818949_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208681.1|2819476_2819662_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_000075122.1|2819878_2820376_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	1.3e-91
WP_024164617.1|2820375_2820591_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000023143.1|2821029_2822880_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000216644.1|2823194_2823362_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	68.6	1.2e-09
WP_001059384.1|2824398_2825088_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000140002.1|2825084_2825450_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001265289.1|2825450_2826506_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_010917803.1|2826507_2826786_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_000975564.1|2826855_2827116_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|2827334_2827547_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|2827825_2828584_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2829282_2829447_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450692.1|2829443_2830178_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_158000104.1|2830211_2830754_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.0	2.2e-84
WP_000020556.1|2830665_2831706_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705622.1|2831677_2832229_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2832212_2832440_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2832516_2832924_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2833188_2833488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2833560_2833779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2833801_2834209_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2834186_2834420_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|2834413_2834581_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2834978_2835167_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2835163_2835355_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048548.1|2835447_2837898_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.4	3.5e-57
>prophage 7
NZ_CP038386	Escherichia coli O157:H7 strain DEC5D chromosome, complete genome	5195683	3376524	3421404	5195683	integrase,portal,tail,lysis,holin,protease,terminase	Enterobacteria_phage(50.0%)	63	3376109:3376123	3421478:3421492
3376109:3376123	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247931.1|3376524_3377223_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3377453_3378335_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3378503_3378665_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3379161_3380181_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3380214_3381195_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001101707.1|3381371_3381641_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
WP_000279047.1|3381642_3382956_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	97.7	2.4e-76
WP_001230272.1|3383020_3383620_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	95.5	7.7e-107
WP_171880622.1|3383689_3387103_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.7	0.0e+00
WP_000090845.1|3387163_3387772_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.1e-100
WP_001419734.1|3387708_3388452_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	4.5e-149
WP_001152339.1|3388457_3389156_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3389165_3389495_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371991.1|3389494_3392560_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.1	0.0e+00
WP_001161009.1|3392531_3392861_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3392869_3393256_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3393316_3394060_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3394070_3394472_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677100.1|3394468_3395047_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	9.4e-102
WP_001283153.1|3395058_3395334_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3395326_3395650_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_000985949.1|3397708_3399217_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.6	4.5e-289
WP_001072975.1|3399216_3399429_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934091.1|3399425_3401528_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.6	0.0e+00
WP_000349509.1|3401527_3402019_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3402693_3402846_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092264.1|3402833_3403301_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	98.1	2.5e-76
WP_000075144.1|3403297_3403795_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
WP_000284524.1|3403794_3404010_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3404152_3404551_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3404631_3404790_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3404875_3405619_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3405804_3406494_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3406508_3406631_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750160.1|3406968_3407928_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3408139_3408805_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108059.1|3408801_3409422_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.6	4.1e-95
WP_000567000.1|3409414_3409585_-	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
WP_001254218.1|3409581_3409764_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000736913.1|3409760_3410201_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145894.1|3410274_3410565_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	97.9	3.1e-45
WP_000788868.1|3410561_3411263_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.1	2.9e-129
WP_000185433.1|3411259_3412159_-	replication protein	NA	K7P7F0	Enterobacteria_phage	99.7	2.5e-173
WP_000251069.1|3412191_3412485_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_001194218.1|3412604_3412820_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000028392.1|3412923_3413556_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_000618044.1|3413552_3413957_+	hypothetical protein	NA	A0A088CQ79	Enterobacteria_phage	98.5	5.6e-69
WP_000340011.1|3414308_3414632_+	antitermination protein	NA	A4KWR8	Enterobacteria_phage	99.1	1.0e-52
WP_000281856.1|3414632_3415115_-	super-infection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_000213973.1|3415381_3415582_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	9.3e-33
WP_001198861.1|3415805_3415970_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3415938_3416082_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995449.1|3416155_3416452_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_001418384.1|3416457_3417243_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000186844.1|3417239_3417920_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3417916_3418099_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3418071_3418263_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_001386642.1|3418273_3418555_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763358.1|3418653_3418875_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	95.9	1.6e-33
WP_000120060.1|3419085_3419688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3419930_3420098_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3420137_3420356_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3420333_3421404_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3421478:3421492	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 8
NZ_CP038386	Escherichia coli O157:H7 strain DEC5D chromosome, complete genome	5195683	3647110	3712342	5195683	capsid,head,tRNA,integrase,portal,tail,lysis,holin,protease,terminase,transposase	Enterobacteria_phage(61.82%)	75	3655588:3655634	3702136:3702182
WP_000420895.1|3647110_3648247_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383931.1|3648512_3650750_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001301880.1|3650736_3653709_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224578.1|3653709_3654600_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177464.1|3654782_3655544_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3655588:3655634	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001359465.1|3655986_3656424_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000361110.1|3656448_3657033_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201812.1|3657531_3658485_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226369.1|3658671_3660156_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000239881.1|3660700_3661369_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885620.1|3661423_3662008_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.1e-102
WP_000279124.1|3662007_3664914_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	4.2e-57
WP_001230405.1|3664978_3665578_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	8.8e-111
WP_000515299.1|3665644_3669043_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.6	0.0e+00
WP_000090855.1|3669103_3669712_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.6	2.2e-101
WP_000140753.1|3669648_3670392_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	5.9e-149
WP_001152525.1|3670397_3671096_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000847379.1|3671095_3671425_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000235332.1|3671421_3673749_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	92.5	0.0e+00
WP_000840184.1|3673758_3673983_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	100.0	4.4e-31
WP_000459484.1|3673975_3674410_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	97.5	5.0e-63
WP_000479153.1|3674391_3674814_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|3674829_3675570_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683105.1|3675577_3675973_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975054.1|3675969_3676548_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	3.5e-80
WP_000753019.1|3676559_3676913_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	2.6e-62
WP_000710708.1|3676924_3677320_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	91.7	1.3e-54
WP_000063260.1|3677361_3678387_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	3.4e-187
WP_001299443.1|3678442_3678775_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123237.1|3678784_3680104_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.0e-232
WP_001359455.1|3680084_3681686_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000198149.1|3681682_3681889_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027277.1|3681885_3683811_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_001300120.1|3684718_3684913_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3685077_3685284_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001417742.1|3685569_3685980_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	97.8	3.9e-70
WP_000738495.1|3686271_3686565_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_122993458.1|3686655_3686838_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.7	1.1e-16
WP_001180487.1|3687054_3687531_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3687517_3687823_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097226.1|3688144_3688834_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	49.4	1.5e-58
WP_000971093.1|3688830_3688971_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3688967_3689330_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3689326_3689617_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3689609_3689780_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053021.1|3689779_3690235_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072141214.1|3690231_3690333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|3690423_3690705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145438.1|3691173_3691458_-	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	95.7	1.1e-42
WP_000788830.1|3691454_3692156_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	3.2e-128
WP_000147923.1|3692152_3693172_-	replication protein	NA	M1FN81	Enterobacteria_phage	67.0	2.8e-109
WP_001182879.1|3693168_3693708_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	6.8e-62
WP_000184665.1|3693738_3693966_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_000712399.1|3694076_3694769_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001417737.1|3694875_3696483_+	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000233576.1|3697071_3697278_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|3697353_3697650_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3697655_3698441_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186801.1|3698437_3699118_+	YqaJ viral recombinase family protein	NA	B6DZ61	Enterobacteria_phage	98.2	3.9e-131
WP_000149536.1|3699114_3699276_+	DUF1317 family protein	NA	A0A1U8QQC1	Enterobacteria_phage	96.0	1.3e-21
WP_001419148.1|3699268_3699781_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	64.2	4.6e-52
WP_001386642.1|3699835_3700117_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763385.1|3700215_3700434_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|3700481_3700760_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_001359450.1|3700958_3702122_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	6.3e-198
WP_001359679.1|3702456_3703089_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
3702136:3702182	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001255114.1|3703091_3703607_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691070.1|3703617_3704625_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001419152.1|3704637_3707247_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000988382.1|3707277_3707970_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|3708189_3708732_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729155.1|3709211_3710078_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3710079_3710292_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143558.1|3710399_3710921_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912351.1|3710956_3712342_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 9
NZ_CP038386	Escherichia coli O157:H7 strain DEC5D chromosome, complete genome	5195683	4046422	4099141	5195683	capsid,head,protease,tail,lysis,holin,integrase,terminase	Enterobacteria_phage(38.71%)	66	4047767:4047812	4095240:4095285
WP_001130496.1|4046422_4047604_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.6	1.1e-144
4047767:4047812	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000950786.1|4050012_4050993_-	NleB family type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	50.5	5.9e-88
WP_001132163.1|4051992_4052583_-	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001144082.1|4052765_4053392_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.7e-25
WP_001117988.1|4054131_4054704_-	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	52.7	2.1e-45
WP_001024023.1|4054815_4055085_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	97.8	8.4e-45
WP_000741872.1|4055086_4056403_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	94.5	3.5e-67
WP_001233141.1|4056462_4057062_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515317.1|4057132_4060546_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.3	0.0e+00
WP_000090854.1|4060606_4061209_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	86.1	1.2e-88
WP_000140754.1|4061145_4061889_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.0	2.7e-149
WP_001152569.1|4061894_4062593_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	96.6	1.3e-129
WP_000847379.1|4062592_4062922_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840280.1|4062918_4065498_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	92.9	0.0e+00
WP_000459456.1|4065490_4065925_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479189.1|4065906_4066329_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	86.4	1.3e-60
WP_001419284.1|4066344_4067085_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	96.3	1.2e-128
WP_000683050.1|4067092_4067488_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	96.2	7.2e-69
WP_000155463.1|4067484_4068018_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	71.4	2.0e-61
WP_001204539.1|4068029_4068383_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	68.4	7.4e-41
WP_000201530.1|4068375_4068750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522651.1|4068801_4069830_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000256840.1|4069887_4070235_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	2.0e-22
WP_001253897.1|4070271_4071777_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.7	6.1e-100
WP_100661945.1|4072398_4073904_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	69.1	3.3e-207
WP_000235440.1|4073905_4074415_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	7.2e-13
WP_013009113.1|4074816_4075041_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001302690.1|4075121_4075436_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_072020783.1|4075962_4076145_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	1.4e-14
WP_000075122.1|4076361_4076859_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	1.3e-91
WP_024164617.1|4076858_4077074_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000026511.1|4077511_4079353_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	77.9	3.6e-288
WP_001419325.1|4079649_4079781_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000512795.1|4080276_4080801_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	97.1	3.8e-94
WP_001028867.1|4080791_4081463_-	serine/threonine protein phosphatase	NA	H6WZJ4	Escherichia_phage	95.0	1.1e-125
WP_001107957.1|4081459_4082065_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	98.0	8.1e-96
WP_000566862.1|4082057_4082228_-	protein ninF	NA	K7PMD9	Enterobacterial_phage	96.4	9.3e-26
WP_001254239.1|4082224_4082407_-	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	100.0	1.9e-29
WP_000153282.1|4082403_4082931_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	2.8e-100
WP_000736913.1|4082927_4083368_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145894.1|4083441_4083732_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	97.9	3.1e-45
WP_000788868.1|4083728_4084430_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.1	2.9e-129
WP_000185433.1|4084426_4085326_-	replication protein	NA	K7P7F0	Enterobacteria_phage	99.7	2.5e-173
WP_000251069.1|4085358_4085652_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_001194218.1|4085771_4085987_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000028392.1|4086090_4086723_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_000618044.1|4086719_4087124_+	hypothetical protein	NA	A0A088CQ79	Enterobacteria_phage	98.5	5.6e-69
WP_000340011.1|4087475_4087799_+	antitermination protein	NA	A4KWR8	Enterobacteria_phage	99.1	1.0e-52
WP_000281856.1|4087799_4088282_-	super-infection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_000213973.1|4088548_4088749_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	9.3e-33
WP_001198861.1|4088972_4089137_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|4089105_4089249_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995449.1|4089322_4089619_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_001418384.1|4089624_4090410_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000186844.1|4090406_4091087_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|4091083_4091266_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|4091238_4091430_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_001386642.1|4091440_4091722_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763359.1|4091820_4092042_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	94.5	4.6e-33
WP_001289865.1|4092038_4092545_+	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	86.7	3.1e-56
WP_000103020.1|4092541_4093306_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.5	4.5e-51
WP_001281200.1|4093406_4093751_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	99.1	5.9e-59
WP_000023577.1|4094064_4095225_+|integrase	site-specific integrase	integrase	K7P7R5	Enterobacteria_phage	99.5	7.2e-226
WP_000893281.1|4095429_4096683_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	4.4e-96
4095240:4095285	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4096694_4097798_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749889.1|4098085_4099141_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.6	2.9e-117
>prophage 10
NZ_CP038386	Escherichia coli O157:H7 strain DEC5D chromosome, complete genome	5195683	4116686	4176158	5195683	tRNA,transposase,plate	uncultured_Caudovirales_phage(40.0%)	45	NA	NA
WP_000027429.1|4116686_4117859_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4117939_4118125_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4118039_4118303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145881.1|4118504_4120265_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4120267_4121404_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001419315.1|4122149_4122659_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000339432.1|4122727_4124236_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_071529145.1|4124417_4125068_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000509136.1|4125273_4129506_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103347.1|4129581_4131723_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	8.2e-26
WP_001142958.1|4131932_4132451_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|4133147_4133648_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4133682_4133907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000611742.1|4135439_4135853_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4135856_4137707_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4137670_4138753_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001080154.1|4140053_4140578_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246448.1|4140580_4141912_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343294.1|4141916_4142678_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000614382.1|4142686_4145458_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.8	3.6e-82
WP_000088854.1|4145454_4146198_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240517.1|4146202_4147615_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001303798.1|4147723_4151158_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087743.1|4151168_4152578_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001284959.1|4152543_4153023_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001414527.1|4153043_4153196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|4153343_4153940_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|4153942_4154392_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001086136.1|4154869_4155670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001301976.1|4156206_4156938_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_000917883.1|4157002_4157470_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001307587.1|4157466_4158189_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|4158222_4158978_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644686.1|4159049_4160408_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211697.1|4160455_4161226_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4161303_4162104_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648586.1|4162344_4163259_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997018.1|4163255_4164059_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_001140187.1|4169807_4170383_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593987.1|4170570_4171602_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	5.5e-36
WP_001294606.1|4171594_4172248_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874227.1|4172287_4173103_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202328.1|4173220_4173625_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094000.1|4173621_4174329_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260720.1|4174439_4176158_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP038386	Escherichia coli O157:H7 strain DEC5D chromosome, complete genome	5195683	4588993	4648003	5195683	protease,transposase	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|4588993_4590346_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4590439_4590991_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4591146_4592520_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853752.1|4592695_4593694_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.9	7.4e-70
WP_000596020.1|4593726_4594722_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4594708_4595731_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|4595744_4597247_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4597386_4598343_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4598652_4599183_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4599262_4599613_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4599606_4599858_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4600069_4600411_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060934.1|4600413_4604193_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4604189_4605923_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001419263.1|4606128_4606767_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4607089_4608433_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4608511_4608718_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|4609042_4609597_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|4609659_4610598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886883.1|4610809_4611550_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|4611739_4613683_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4613800_4614181_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4614269_4615130_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4615237_4616203_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4616310_4616973_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4617017_4618430_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4618738_4619359_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119482.1|4619576_4620215_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826434.1|4620349_4621558_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.3	1.8e-208
WP_000604943.1|4621565_4621997_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4622619_4623414_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4623484_4623934_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4623975_4624203_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4624207_4624522_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216678.1|4624528_4624924_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4625250_4625526_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4625654_4626341_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|4626340_4627195_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4627204_4627855_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4627868_4628333_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4628342_4628648_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001350568.1|4628663_4630061_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_001295191.1|4630415_4631480_+	L-ascorbate 6-phosphate lactonase	NA	NA	NA	NA	NA
WP_000133631.1|4631587_4632343_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569693.1|4632339_4633089_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4633270_4633600_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4633748_4634024_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_000943960.1|4635848_4637012_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4637014_4637653_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4637662_4638061_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012577.1|4638078_4638738_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511947.1|4638788_4639487_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4639505_4639907_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4640033_4640765_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076300.1|4640945_4643387_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	3.2e-66
WP_001177639.1|4643425_4643851_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4644055_4645354_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4645457_4645655_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4645736_4646741_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4646743_4648003_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 12
NZ_CP038386	Escherichia coli O157:H7 strain DEC5D chromosome, complete genome	5195683	4785727	4838819	5195683	capsid,head,tRNA,portal,tail,lysis,holin,integrase,terminase,transposase	Enterobacteria_phage(47.54%)	65	4781567:4781582	4823925:4823940
4781567:4781582	attL	ATGCTGGTGGCAGGAA	NA	NA	NA	NA
WP_000918366.1|4785727_4787143_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|4787225_4788209_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|4788374_4788617_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543816.1|4788750_4789788_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|4789876_4790974_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217539.1|4791035_4791284_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	100.0	1.1e-38
WP_001143778.1|4791444_4792086_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	98.1	4.1e-106
WP_077632221.1|4792167_4792797_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|4792869_4793442_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001024006.1|4793553_4793823_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	100.0	2.2e-45
WP_171880623.1|4793824_4795138_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	98.9	1.2e-75
WP_001230413.1|4795202_4795802_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.5	6.7e-111
WP_000515705.1|4795869_4799265_-	host specificity protein J	NA	A0A0K2FI38	Escherichia_phage	89.4	0.0e+00
WP_032283758.1|4799325_4799973_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.4	2.0e-108
WP_000194750.1|4799870_4800614_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	9.5e-147
WP_171880624.1|4800619_4801318_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.3	1.8e-131
WP_000847355.1|4801317_4801647_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	96.3	1.5e-56
WP_171880625.1|4801643_4804217_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	83.1	0.0e+00
WP_000533402.1|4804197_4804611_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001299690.1|4804637_4805069_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000235036.1|4805087_4805834_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.0	1.9e-123
WP_085959019.1|4805959_4807173_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_171880626.1|4807494_4808028_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.6	7.7e-58
WP_001204556.1|4808042_4808396_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.1e-41
WP_062881302.1|4808388_4808772_-	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_000522599.1|4808823_4809852_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	2.3e-114
WP_000256823.1|4809909_4810257_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	58.1	8.9e-23
WP_171880627.1|4810293_4811799_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.6e-100
WP_001369121.1|4811788_4813381_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_000259002.1|4813377_4813584_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_064460394.1|4813567_4815496_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	7.2e-263
WP_001405844.1|4815467_4815974_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	48.5	1.6e-33
WP_032175848.1|4816401_4816635_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	7.3e-21
WP_000079508.1|4816692_4817103_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001082537.1|4817410_4817875_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	84.2	1.0e-61
WP_000459345.1|4817876_4818014_-	hypothetical protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
WP_001092893.1|4818173_4818707_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	8.1e-100
WP_001015161.1|4818743_4819301_-	hypothetical protein	NA	Q08JA0	Stx2-converting_phage	82.6	9.5e-51
WP_000284510.1|4819304_4819520_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000143004.1|4819670_4821524_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.0	0.0e+00
WP_001339373.1|4822341_4822494_-	restriction endonuclease subunit M	NA	A0A2R2Z327	Escherichia_phage	98.0	3.4e-19
WP_001047111.1|4822803_4823556_-	antitermination protein	NA	K7PGU5	Enterobacteria_phage	98.8	2.6e-136
WP_024183555.1|4823569_4824559_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	98.5	1.5e-192
4823925:4823940	attR	ATGCTGGTGGCAGGAA	NA	NA	NA	NA
WP_000067574.1|4824566_4825364_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	99.2	9.8e-150
WP_000767094.1|4825383_4825773_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	97.7	7.8e-68
WP_000210164.1|4825769_4826096_-	LexA family transcriptional regulator	NA	A0A0N7KZF7	Stx2-converting_phage	100.0	9.2e-54
WP_001355692.1|4826092_4826746_-	phage N-6-adenine-methyltransferase	NA	A0A0P0ZCC0	Stx2-converting_phage	100.0	1.1e-127
WP_001358752.1|4826745_4827240_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	100.0	8.6e-88
WP_000061538.1|4827236_4828076_-	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	90.8	4.2e-127
WP_000620696.1|4828072_4828297_-	hypothetical protein	NA	A5LH70	Enterobacteria_phage	100.0	5.7e-39
WP_001087332.1|4828293_4829439_-	Rha family phage regulatory protein	NA	K7PLX4	Enterobacteria_phage	83.6	6.3e-174
WP_000515857.1|4829435_4829987_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	99.5	1.7e-100
WP_001191678.1|4829979_4830240_-	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	98.8	2.7e-40
WP_001345148.1|4830337_4831030_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	96.1	8.3e-121
WP_000135683.1|4831752_4832115_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	99.2	4.3e-60
WP_000081287.1|4832180_4833005_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008205.1|4833132_4833669_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	97.8	1.5e-98
WP_001242711.1|4833659_4834271_+	hypothetical protein	NA	A0A0P0ZFU9	Escherichia_phage	74.1	8.3e-56
WP_000509524.1|4834234_4834948_+	ead/Ea22-like family protein	NA	A5VWB1	Enterobacteria_phage	68.2	1.4e-38
WP_001289977.1|4834944_4835673_+	ead/Ea22-like family protein	NA	A5VWB3	Enterobacteria_phage	84.5	1.7e-44
WP_000628752.1|4836186_4836978_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	53.0	2.7e-67
WP_001061339.1|4836977_4837550_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	97.9	6.7e-108
WP_001093918.1|4837586_4837868_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
WP_000654815.1|4837915_4838089_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|4838285_4838819_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP038388	Escherichia coli O157:H7 strain DEC5D plasmid pDEC5D-3, complete sequence	57827	24978	33597	57827	transposase	Stx2-converting_phage(50.0%)	6	NA	NA
WP_085959019.1|24978_26192_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_072141484.1|27683_28124_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	52.5	1.2e-24
WP_000099187.1|28205_29744_-|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.8	1.8e-293
WP_000612550.1|29792_30140_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	98.3	4.8e-61
WP_000839179.1|30136_30541_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000124031.1|30618_33597_-|transposase	Tn3-like element TnEc1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	53.4	2.4e-297
