The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038389	Escherichia coli O157:H7 strain DEC5B chromosome, complete genome	5294183	878246	938259	5294183	transposase,protease,integrase	Enterobacteria_phage(21.43%)	42	894963:894979	938463:938479
WP_001034544.1|878246_882806_+|protease	lipoprotein metalloprotease SslE	protease	NA	NA	NA	NA
WP_000895883.1|883132_883942_+	prepilin peptidase PppA	NA	NA	NA	NA	NA
WP_001345954.1|884007_884418_+	type II secretion system pilot lipoprotein GspS-beta	NA	NA	NA	NA	NA
WP_000312634.1|884435_885395_+	type II secretion system protein GspC	NA	NA	NA	NA	NA
WP_000498829.1|885424_887485_+	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_000249366.1|887484_888978_+	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_001173397.1|888977_890201_+	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_001087296.1|890217_890673_+	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_001115148.1|890676_891240_+	type II secretion system minor pseudopilin GspH	NA	NA	NA	NA	NA
WP_000820135.1|891236_891611_+	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_000633162.1|892118_893096_+	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_000094984.1|893092_894271_+	type II secretion system protein GspL	NA	NA	NA	NA	NA
WP_000942790.1|894272_894809_+	GspM family type II secretion system protein YghD	NA	NA	NA	NA	NA
894963:894979	attL	CCGGACTCGGAATCGAA	NA	NA	NA	NA
WP_001280497.1|895089_895932_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839256.1|896016_896214_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_077629000.1|896225_896513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001016257.1|896619_897366_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	31.6	3.5e-24
WP_001359388.1|897380_898922_-|transposase	IS21-like element ISEc12 family transposase	transposase	K4I413	Acidithiobacillus_phage	46.4	6.4e-129
WP_001285587.1|899761_900130_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692345.1|900203_900425_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001186192.1|900493_900970_-	RadC family protein	NA	NA	NA	NA	NA
WP_085959019.1|901189_902402_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_001234730.1|902821_903640_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	2.1e-46
WP_001323397.1|903794_903953_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_085959019.1|904073_905287_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_001342960.1|905671_905878_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000236756.1|907029_907224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000221524.1|907423_907993_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270999.1|908160_908544_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013320.1|908540_908966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001369053.1|909210_909408_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000624681.1|911445_911796_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	1.8e-39
WP_000422686.1|911792_912218_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	99.0	2.0e-48
WP_001239082.1|912871_922543_-	lymphostatin Efa1/LifA	NA	NA	NA	NA	NA
WP_000609742.1|924417_925092_-	type III secretion system effector cysteine methyltransferase NleE	NA	NA	NA	NA	NA
WP_000953023.1|925140_926130_-	type III secretion system effector arginine glycosyltransferase NleB	NA	Q8HAB2	Salmonella_phage	58.5	4.9e-98
WP_148713461.1|926696_927925_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	7.2e-176
WP_000247601.1|931365_931542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000605048.1|932114_932663_+	Ail/Lom family protein	NA	Q9LA63	Enterobacterial_phage	32.4	9.8e-16
WP_000631719.1|934984_935332_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	72.0	1.0e-42
WP_001358695.1|935328_936003_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	30.1	2.4e-11
WP_001218882.1|936993_938259_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	3.0e-76
938463:938479	attR	CCGGACTCGGAATCGAA	NA	NA	NA	NA
>prophage 2
NZ_CP038389	Escherichia coli O157:H7 strain DEC5B chromosome, complete genome	5294183	1353246	1393113	5294183	integrase,terminase,plate,tail,holin	Salmonella_phage(53.66%)	51	1352985:1353002	1394378:1394395
1352985:1353002	attL	TTCACACATATCACAATT	NA	NA	NA	NA
WP_001138341.1|1353246_1354644_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001291430.1|1354640_1354841_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000627623.1|1354837_1356229_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.3	2.4e-212
WP_001101053.1|1356267_1356978_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000638863.1|1356983_1357253_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	63.5	5.1e-26
WP_001177149.1|1357295_1357847_-	YfbU family protein	NA	NA	NA	NA	NA
WP_032176876.1|1357852_1358362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000065470.1|1358447_1360511_-	DNA polymerase	NA	Q775A3	Bordetella_phage	67.5	3.7e-273
WP_000769008.1|1361239_1361788_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.4	1.3e-65
WP_001113511.1|1361803_1363105_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.7	1.0e-132
WP_000051354.1|1363107_1364010_-	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_000801675.1|1364006_1364156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000049985.1|1364789_1365413_-	helix-turn-helix domain-containing protein	NA	A0A1I9KG86	Aeromonas_phage	44.3	5.7e-36
WP_000170998.1|1365533_1365746_+	helix-turn-helix transcriptional regulator	NA	A0A0R6PHL1	Moraxella_phage	42.9	7.9e-06
WP_001284070.1|1365749_1367936_+	replication protein	NA	B6SCY1	Bacteriophage	72.7	3.2e-174
WP_001244506.1|1368224_1368647_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	63.3	8.8e-41
WP_001174014.1|1368678_1369020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000781776.1|1369465_1369807_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001194118.1|1369810_1370287_+	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	95.6	4.6e-86
WP_000779566.1|1370270_1370795_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	66.9	4.5e-42
WP_000162796.1|1370856_1371429_+|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	1.4e-60
WP_001130793.1|1371431_1373054_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_000113491.1|1373053_1374520_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	91.8	3.9e-261
WP_000184969.1|1374410_1375145_+	hypothetical protein	NA	A0A0M4REK0	Salmonella_phage	87.6	2.1e-98
WP_000873187.1|1375159_1376380_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.5	2.2e-201
WP_001066724.1|1376383_1376890_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.9	1.4e-69
WP_000627473.1|1376901_1377843_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.6	1.4e-155
WP_160393966.1|1377839_1378073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125670.1|1378071_1378479_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.1	2.2e-68
WP_000008722.1|1378475_1379030_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	71.2	1.4e-65
WP_001142480.1|1379016_1379406_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	96.1	2.5e-66
WP_000503647.1|1379380_1379944_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	75.7	1.3e-79
WP_000046916.1|1379947_1381093_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.8	6.1e-161
WP_000109255.1|1381103_1381544_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	74.7	1.6e-56
WP_000393959.1|1381547_1382000_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.0	3.0e-55
WP_000990875.1|1382177_1384166_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	74.7	1.1e-271
WP_001349561.1|1384165_1384753_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	89.1	3.1e-84
WP_000155117.1|1384752_1385055_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	92.0	2.8e-49
WP_000081736.1|1385057_1386122_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.4	1.9e-156
WP_000832849.1|1386124_1386472_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	81.1	3.5e-27
WP_000044737.1|1386479_1387034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000213605.1|1387037_1387208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001007931.1|1387270_1388023_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.5	2.2e-87
WP_001270638.1|1388022_1388376_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	89.7	9.0e-55
WP_001197082.1|1388375_1389575_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	83.4	1.7e-185
WP_000049950.1|1389571_1390252_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	2.6e-103
WP_000164526.1|1390251_1390947_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	66.7	1.2e-26
WP_001174922.1|1390948_1391395_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.1	1.0e-50
WP_000805565.1|1391366_1391960_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	63.9	5.9e-59
WP_001115568.1|1391959_1392529_-	hypothetical protein	NA	K7PH60	Enterobacterial_phage	57.5	2.3e-44
WP_000904994.1|1392558_1393113_+	site-specific DNA recombinase	NA	A0A1S6L009	Salmonella_phage	89.0	2.2e-87
1394378:1394395	attR	TTCACACATATCACAATT	NA	NA	NA	NA
>prophage 3
NZ_CP038389	Escherichia coli O157:H7 strain DEC5B chromosome, complete genome	5294183	1616421	1621847	5294183	integrase	Enterobacteria_phage(50.0%)	6	1604671:1604687	1624043:1624059
1604671:1604687	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1616421_1616991_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1616990_1617458_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1617444_1618125_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257009.1|1618134_1619271_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1619445_1620603_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368112.1|1620914_1621847_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.7	4.6e-167
1624043:1624059	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP038389	Escherichia coli O157:H7 strain DEC5B chromosome, complete genome	5294183	1866244	1875690	5294183		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569336.1|1866244_1867171_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1867175_1867907_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1867887_1867995_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1868054_1868786_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001359340.1|1869007_1870693_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.8	5.1e-305
WP_000598641.1|1870689_1871409_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1871455_1871926_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001359339.1|1871967_1872429_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	2.4e-76
WP_001087225.1|1872553_1874557_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001359338.1|1874553_1875690_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
>prophage 5
NZ_CP038389	Escherichia coli O157:H7 strain DEC5B chromosome, complete genome	5294183	2032731	2195607	5294183	transposase,integrase,lysis,terminase,capsid,tail,protease,portal,head,holin	Enterobacteria_phage(34.69%)	168	2032724:2032783	2144581:2145838
2032724:2032783	attL	TGTAGTGGTCAAGTAATACTGGCCACGGTTTTACAGTAAAAATGATATCTGTTCTCTGAC	NA	NA	NA	NA
WP_085959019.1|2032731_2033945_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_000502860.1|2034371_2035010_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.0	2.1e-54
WP_000649219.1|2035380_2037003_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_106377009.1|2037110_2038338_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	3.0e-174
WP_000973176.1|2040535_2041081_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2041077_2041821_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2041832_2042912_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986329.1|2042973_2043909_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2044365_2045283_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2045384_2046335_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_000532909.1|2048721_2049438_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001060246.1|2049780_2051235_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2051336_2052653_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2052967_2054020_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_138976433.1|2054281_2062264_-	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_001302302.1|2062753_2063551_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533628.1|2063786_2064812_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.0	2.9e-101
WP_000096342.1|2064811_2065015_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_063183380.1|2065073_2067554_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	61.3	8.6e-59
WP_001090194.1|2067647_2067839_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2067835_2068024_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001299931.1|2068424_2068589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171942.1|2068592_2068811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379669.1|2068970_2069126_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.5e-06
WP_000362152.1|2069392_2069812_-	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	4.0e-25
WP_000391946.1|2069912_2070194_+	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	8.5e-24
WP_000693883.1|2070177_2070603_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262354.1|2070674_2071745_+	hypothetical protein	NA	A0A088CD36	Shigella_phage	64.6	2.7e-62
WP_001151226.1|2071785_2072208_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	8.8e-65
WP_000209148.1|2072557_2072776_+	DUF4014 family protein	NA	A0A1I9LJM2	Stx_converting_phage	91.7	5.2e-29
WP_000224233.1|2072777_2073041_+	hypothetical protein	NA	A0A2P0P958	Salmonella_phage	72.4	8.8e-31
WP_000967411.1|2073939_2074152_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	92.9	1.4e-26
WP_032175188.1|2074319_2074592_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	3.2e-12
WP_024173616.1|2074593_2075643_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	53.7	4.7e-107
WP_000904119.1|2075655_2076015_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.0	3.6e-35
WP_000640046.1|2076023_2076575_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	68.0	1.2e-66
WP_000917767.1|2076799_2076997_+	hypothetical protein	NA	Q9MC00	Enterobacteria_phage	100.0	2.1e-29
WP_000935529.1|2077147_2078197_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	89.7	1.4e-183
WP_000871291.1|2078787_2079123_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001213059.1|2080390_2080573_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_001346898.1|2080610_2080802_+	DUF826 domain-containing protein	NA	NA	NA	NA	NA
WP_000411813.1|2081377_2081584_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
WP_000731214.1|2081588_2082578_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	64.4	6.8e-108
WP_001092861.1|2082620_2083154_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.9	5.3e-99
WP_000459345.1|2083313_2083451_+	hypothetical protein	NA	Q687G2	Enterobacteria_phage	97.8	1.3e-17
WP_001082561.1|2083452_2083920_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	77.4	2.8e-56
WP_000347012.1|2084270_2084408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|2084544_2084730_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000235451.1|2085124_2085634_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	33.3	1.2e-12
WP_024173782.1|2085605_2087534_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.7	7.4e-260
WP_000258997.1|2087517_2087724_+|head	phage head-stabilizing protein	head	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001486464.1|2087720_2089313_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.9	7.1e-184
WP_001253988.1|2089302_2090808_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.6e-100
WP_000256821.1|2090844_2091192_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_171881601.1|2091249_2092278_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	7.8e-115
WP_000201528.1|2092329_2092704_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204544.1|2092696_2093050_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	69.2	2.5e-41
WP_000975037.1|2093064_2093640_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	58.7	7.5e-51
WP_000683071.1|2093636_2094032_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	87.0	4.2e-61
WP_001143013.1|2094039_2094792_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.6	1.7e-127
WP_000479086.1|2094805_2095237_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	4.8e-42
WP_000533431.1|2095263_2095677_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	82.8	3.0e-41
WP_000082325.1|2095657_2098258_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	91.0	0.0e+00
WP_000847284.1|2098254_2098584_+|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	91.7	5.4e-54
WP_001152612.1|2098583_2099282_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000194782.1|2099287_2100031_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	94.3	4.4e-144
WP_000090901.1|2099967_2100600_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	98.6	1.9e-95
WP_000515484.1|2100660_2104143_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	88.3	0.0e+00
WP_096962458.1|2104209_2104809_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	96.5	9.1e-108
WP_171881603.1|2104873_2106088_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZDE7	Stx2-converting_phage	98.0	8.1e-79
WP_001101705.1|2106089_2106398_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	96.6	3.1e-43
WP_148713461.1|2106368_2107597_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	98.3	7.2e-176
WP_001131654.1|2107807_2108383_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	81.6	1.2e-80
WP_001118092.1|2108673_2109255_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	54.3	4.6e-48
WP_001359536.1|2109327_2109957_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	5.1e-77
WP_001143784.1|2110038_2110680_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_000533608.1|2111188_2112214_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	56.7	2.9e-101
WP_000094838.1|2112213_2112417_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000990640.1|2112475_2114893_-	exonuclease	NA	V5UQJ3	Shigella_phage	60.1	7.8e-174
WP_000199480.1|2114985_2115174_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449169.1|2115170_2115359_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000559926.1|2115900_2116416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000379559.1|2116529_2116682_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_001003381.1|2116874_2117282_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	46.2	2.5e-24
WP_000476994.1|2117359_2117587_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705361.1|2117570_2118092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000054513.1|2118072_2119038_+	hypothetical protein	NA	U5P0A0	Shigella_phage	59.6	2.2e-55
WP_001151172.1|2119078_2119486_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.5	1.8e-62
WP_000101550.1|2119926_2120886_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_000813254.1|2121257_2121413_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001004956.1|2121578_2122229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000401168.1|2122209_2123313_+	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_077629088.1|2123467_2123728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010917803.1|2123797_2124076_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_171881605.1|2124077_2125127_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	4.1e-111
WP_000090263.1|2125453_2125825_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	1.2e-52
WP_000265266.1|2125977_2126796_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000261910.1|2127416_2128130_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000411813.1|2131062_2131269_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	1.2e-30
WP_000731214.1|2131273_2132263_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	64.4	6.8e-108
WP_001092850.1|2132305_2132839_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.7	3.9e-102
WP_032140280.1|2133393_2133480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122991286.1|2133701_2133887_+	hypothetical protein	NA	A0A0P0ZCT3	Stx2-converting_phage	96.7	6.0e-18
WP_000736383.1|2133972_2134197_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000347012.1|2134553_2134691_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|2134827_2135013_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000235436.1|2135414_2135924_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_171881607.1|2135895_2137824_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	4.3e-260
WP_000259002.1|2137807_2138014_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_171881608.1|2138010_2139603_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.7	9.3e-184
WP_171881610.1|2139592_2141098_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_000256844.1|2141134_2141482_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_000522652.1|2141539_2142568_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	3.5e-115
WP_000201512.1|2142619_2143003_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204554.1|2142995_2143349_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.5e-41
WP_000974987.1|2143364_2143898_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	65.1	1.5e-56
WP_000683079.1|2143894_2144290_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_085959019.1|2144588_2145802_-|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_000479105.1|2146324_2146756_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.8	3.7e-42
2144581:2145838	attR	TGTAGTGGTCAAGTAATACTGGCCACGGTTTTACAGTAAAAATGATATCTGTTCTCTGACTCTTCCGGCGTCAGCCCTCCGTTATAATGGTGAGGCCTGACGCTATTGTAATAATTCAGAATATAACTGCTGATTTGCTGCCGGGCCACGTCTTTGCCTGTGTAGCCATCGGTTGGCACCCATTCTGTTTTCAGACTGCGGAAGAAGCGTTCCATTGGACTGTTATCCCAGCAGTTTCCCCGTCGGCTGACACTTTGCTTTATCCTGTAACGCCAGAGAAGTTGTTGATATTTCAGTCCTGTATATTGACTTCCCTGGTCGCTATGGAACATGACGTCCCGCGGCTGACCACGCACCTCATACGCCATCCGCAGGGCACTGCTTATCAGGGCAGTATCGGCATTCGCTGACAGGCTCCAGCCGATAACCCTGCGGGCAAAAAGATCCATGACGACCGCCAGATAGCACCAGCGATTTCCTGCCCAGATATACGTAATATCTCCGCACCATACCCTATCTGGCTCGGGCACAGCGAACTGGCGCTCAAGCAGATTCGGCAGGCAGGTATGTTCCTGACGAGCATTTTTGTACTGATGTTTTCCGGGCTGACAACTGCTCAGGTTCAGATATTTCATCAGACGCCCGGCACGGTAACGGCTCATCGGGACGCCGTTTTGGGTCAGCATTTCAGCCAGCGTGCGCGCCCCCGCAGAGCCCCTACTTTGGTTCCACGCCCGGCGTATTTCGCTGCACAACCTGACTCGCGCCGGATTAACCGTATCGCGTCGTTTTCGCCAGTACTGGTAACTGCTGCGGTGTATTTCCAGAGCAGAACAGAGGCTGACAACTGAGTGGCTGTCACTCAGTCTGGCAACTATCGTGAACCGTTCAGCGAGTCGGACATCAAGAGCGCGGTAGCCTTTTTTAATATCGTATTGTGTTCCTCCAGGCGGCGAACCTGCTTTTCCAGTTCGCGGATACGTTGCTGGTCTGGAGTAATAGGTGTGGCAGAGGGCGCAATCCCCTGACGCTCTCGCCTGAGCTGGCGCACCCAACTCTCAAGCGTGGTAGAACCGACATTCATCGCTTCACTGGCTTGTCGATATGAGTAGCCCTTATCAACAATTAGCTGTGCACATTCCAGCCTGAATTCAGGGGTGAAAGTACGTTTGGTTTTCTTGTTCATTAAGTCACCTGTTTTGTGTTGTGGTGAGGATATCACCTTTAATCAGGTGGCCAAATTTACTGTGCCACTACA	NA	NA	NA	NA
WP_000533419.1|2146782_2147196_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	81.2	1.0e-41
WP_000082474.1|2147176_2149756_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.0	0.0e+00
WP_000847304.1|2149752_2150082_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_001357740.1|2150081_2150780_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000194791.1|2150785_2151529_+|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	98.8	2.7e-149
WP_050546863.1|2151474_2152107_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000649829.1|2152297_2152825_-	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_096962458.1|2156499_2157099_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	96.5	9.1e-108
WP_000268875.1|2157163_2158477_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q9EYE8	Enterobacteria_phage	99.5	7.4e-78
WP_001023389.1|2158478_2158748_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	6.4e-45
WP_071781885.1|2158873_2159605_-	molecular chaperone Tir	NA	NA	NA	NA	NA
WP_000022457.1|2159929_2160583_-	type III secretion system effector ADP-ribosyltransferase EspJ	NA	NA	NA	NA	NA
WP_001079074.1|2161719_2162250_-	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_001007753.1|2162592_2163243_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001240083.1|2163499_2164135_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_000740078.1|2164135_2165140_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920132.1|2165247_2165661_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_001339045.1|2165793_2166465_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826733.1|2166464_2167823_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_000218228.1|2167930_2168782_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824350.1|2169373_2170558_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	53.1	7.6e-98
WP_001313057.1|2171123_2171489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000365587.1|2171528_2172116_+	phosphohydrolase	NA	NA	NA	NA	NA
WP_001157239.1|2172182_2173601_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000786000.1|2173581_2174052_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_001212226.1|2174040_2174961_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922685.1|2175133_2176051_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|2176129_2176312_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001302088.1|2176482_2178177_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000844800.1|2179257_2179485_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000867217.1|2179647_2179836_+	protein DsrB	NA	NA	NA	NA	NA
WP_000104009.1|2179879_2180503_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000942326.1|2180792_2181578_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|2181585_2181855_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253441.1|2181864_2182602_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
WP_001302429.1|2182601_2182967_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282098.1|2182969_2183383_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001295641.1|2183379_2184384_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133106.1|2184388_2184853_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000620072.1|2184957_2186085_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000807584.1|2186081_2186525_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000213294.1|2186543_2187917_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001282715.1|2187916_2188603_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067950.1|2188595_2189591_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_000994435.1|2189583_2191242_-	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_001274299.1|2191456_2191771_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000484256.1|2192119_2193259_+	T3SS effector leucine-rich repeat protein EspR4	NA	NA	NA	NA	NA
WP_000501085.1|2193396_2193696_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_085949497.1|2194460_2195607_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
>prophage 6
NZ_CP038389	Escherichia coli O157:H7 strain DEC5B chromosome, complete genome	5294183	2419732	2465004	5294183	integrase,plate,tail,terminase,capsid,portal,head,holin,tRNA	Enterobacteria_phage(81.82%)	55	2427067:2427091	2462578:2462602
WP_001144201.1|2419732_2421661_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	9.4e-130
WP_001700733.1|2421664_2422207_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|2422303_2422501_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2422553_2422910_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2423032_2423077_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018588.1|2423359_2424343_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672328.1|2424357_2426745_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|2426749_2427049_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2427067:2427091	attL	GGCCGCTCTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_000078916.1|2427350_2427491_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_000488107.1|2427681_2427942_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000513526.1|2428143_2429211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000132798.1|2429480_2430581_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	99.7	1.6e-206
WP_000005404.1|2430738_2431923_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	98.2	6.9e-224
WP_000290456.1|2431922_2432435_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2432489_2432855_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2432863_2433019_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000853409.1|2433005_2435813_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	91.9	0.0e+00
WP_000979955.1|2435825_2436314_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2436470_2437043_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001414827.1|2437086_2437665_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	89.0	2.0e-96
WP_000631344.1|2437673_2438576_-	macro domain-containing protein	NA	A0A0M4QWS3	Salmonella_phage	63.9	6.8e-99
WP_000108497.1|2438572_2440732_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	96.2	6.0e-109
WP_000071706.1|2440734_2441265_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	98.2	1.6e-92
WP_001111935.1|2441257_2442154_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.7	5.7e-154
WP_001067548.1|2442157_2442487_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001476003.1|2442504_2443071_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	98.4	1.1e-99
WP_000356352.1|2443082_2443718_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.1	1.5e-113
WP_000920594.1|2443710_2444178_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	100.0	2.6e-86
WP_000780488.1|2444315_2444723_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	96.3	9.4e-64
WP_000104350.1|2445108_2445432_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864907.1|2445434_2445635_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	98.5	6.7e-31
WP_000063083.1|2445634_2446129_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	98.8	5.1e-88
WP_000632343.1|2446231_2447032_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	99.2	1.1e-140
WP_001055089.1|2447077_2448130_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	97.1	6.6e-194
WP_001262673.1|2448153_2448990_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_000613743.1|2449144_2450896_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	97.8	0.0e+00
WP_000087812.1|2450895_2451942_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_000654460.1|2452551_2453358_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_000213784.1|2453589_2453901_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	93.2	2.3e-46
WP_000686542.1|2453905_2454865_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	94.0	1.0e-169
WP_000123436.1|2454941_2457764_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	95.9	0.0e+00
WP_000599411.1|2457770_2458136_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	97.5	3.9e-61
WP_000153684.1|2458277_2458523_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	91.4	3.4e-37
WP_000985159.1|2458519_2458723_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	88.1	1.0e-26
WP_000021664.1|2458810_2458924_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	3.1e-09
WP_000357024.1|2458920_2459163_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.5e-37
WP_021511909.1|2459174_2459453_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	79.3	5.3e-34
WP_000917800.1|2459463_2459802_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	83.6	1.3e-47
WP_000163908.1|2459816_2460095_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000094527.1|2460186_2460498_+	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	55.9	8.8e-22
WP_001247217.1|2460586_2461540_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.1	1.5e-80
WP_001418580.1|2462018_2462468_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956513.1|2462660_2463641_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2462578:2462602	attR	GGCCGCTCTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_001154193.1|2463703_2464255_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029463.1|2464254_2465004_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
>prophage 7
NZ_CP038389	Escherichia coli O157:H7 strain DEC5B chromosome, complete genome	5294183	2584919	2649555	5294183	transposase,tail,protease,head,holin	Stx2-converting_phage(30.43%)	70	NA	NA
WP_001260835.1|2584919_2585741_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2585840_2585924_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2586016_2586352_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2586748_2588002_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019529.1|2588108_2589002_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2589136_2590357_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2590481_2591177_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071782109.1|2591129_2592422_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148719.1|2592579_2593194_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526514.1|2593236_2594091_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2594092_2594710_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_072141521.1|2594720_2597144_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000041707.1|2597204_2599631_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2599829_2600135_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2600242_2600953_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2600955_2601516_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2601550_2601892_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001358609.1|2602026_2602353_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000836042.1|2603784_2604804_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.5	1.1e-17
WP_077629120.1|2604861_2604990_+	transporter	NA	NA	NA	NA	NA
WP_000005552.1|2606305_2606557_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048438.1|2606629_2609101_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	57.0	1.9e-58
WP_001090200.1|2609193_2609385_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2609381_2609570_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2609970_2610135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171904.1|2610138_2610357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2610428_2610728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2611080_2611359_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2611360_2611552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2611572_2611944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2612041_2612344_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693946.1|2612340_2612766_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2612788_2613751_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000450876.1|2614523_2615294_+	DUF1627 domain-containing protein	NA	A0A088CE47	Shigella_phage	67.7	2.0e-83
WP_001118159.1|2615309_2615705_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2615761_2616346_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2616461_2616566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2616754_2616967_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2617134_2617413_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265174.1|2617414_2618464_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.6e-107
WP_001217457.1|2618476_2618836_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	68.4	4.1e-39
WP_000023174.1|2621065_2622916_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_029785460.1|2623350_2623566_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_000731236.1|2623570_2623915_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992167.1|2623965_2624499_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	98.9	7.4e-101
WP_001056806.1|2624769_2625339_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2625338_2625485_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2625712_2625898_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000074670.1|2626322_2626550_-	YlcI/YnfO family protein	NA	A0A0P0ZCA1	Stx2-converting_phage	97.3	5.6e-34
WP_001063096.1|2627727_2627949_+	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_000125988.1|2630151_2630478_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2630487_2630838_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2630834_2631281_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133390.1|2631277_2631622_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.2	4.6e-56
WP_171881612.1|2631680_2632397_+|tail	phage tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.6	1.1e-128
WP_001030063.1|2632402_2632777_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2632872_2633082_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_171881591.1|2634875_2636369_+|tail	phage tail tape measure protein	tail	B6ETF7	Enterobacteria_phage	99.4	5.7e-268
WP_000807954.1|2636361_2636703_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179476.1|2636702_2637140_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	99.2	1.9e-62
WP_000514796.1|2637328_2640805_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	88.9	0.0e+00
WP_001228242.1|2640872_2641472_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	6.3e-101
WP_000268937.1|2641536_2642751_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	95.0	5.6e-80
WP_001023362.1|2642752_2643022_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_106377009.1|2643220_2644448_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	3.0e-174
WP_001131642.1|2644471_2645047_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121227.1|2645757_2646408_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	98.6	4.6e-121
WP_000343702.1|2646557_2647766_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	45.2	8.1e-47
WP_001120551.1|2647815_2648058_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000214712.1|2649351_2649555_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 8
NZ_CP038389	Escherichia coli O157:H7 strain DEC5B chromosome, complete genome	5294183	2922883	2992453	5294183	transposase,integrase,capsid,tail,protease,terminase,head,holin	Stx2-converting_phage(29.17%)	74	2946265:2946278	2993271:2993284
WP_000422055.1|2922883_2923933_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2924152_2924911_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278896.1|2924907_2925498_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2925537_2926410_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2926622_2928206_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2928233_2928854_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2928850_2929732_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2929869_2929914_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2930005_2931568_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2931567_2933163_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983859.1|2933163_2934525_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2934536_2935730_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443044.1|2935729_2936536_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2936916_2937096_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2937181_2937682_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079491.1|2937727_2938234_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000938103.1|2940694_2941264_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2941329_2942241_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2942347_2942470_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025663.1|2944062_2945385_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	83.9	2.1e-221
WP_106423857.1|2945727_2945922_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	87.2	1.1e-09
WP_000767050.1|2945866_2946409_-	hypothetical protein	NA	Q9LA55	Enterobacteria_phage	68.6	8.4e-52
2946265:2946278	attL	TTAACCAGGATTCT	NA	NA	NA	NA
WP_001358682.1|2946629_2946812_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	98.3	9.1e-27
WP_106377009.1|2946958_2948186_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	3.0e-174
WP_000268961.1|2948236_2949397_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	98.2	2.8e-81
WP_029783341.1|2949461_2950100_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U8QHD6	Enterobacteria_phage	61.7	5.2e-69
WP_085959019.1|2950118_2951331_+|transposase	IS3-like element ISEc31 family transposase	transposase	Q716C2	Shigella_phage	57.4	7.5e-101
WP_171881618.1|2951413_2954890_-	host specificity protein J	NA	Q6H9T2	Enterobacteria_phage	99.7	0.0e+00
WP_122993462.1|2955128_2955761_-|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	98.6	5.8e-105
WP_001418561.1|2955706_2956450_-|tail	phage tail protein	tail	H6WZM4	Escherichia_phage	97.6	2.5e-147
WP_001368648.1|2956455_2957154_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	6.8e-131
WP_000807954.1|2957153_2957495_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001453698.1|2960800_2961010_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030066.1|2961105_2961480_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	98.4	1.1e-63
WP_001275469.1|2961485_2962202_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	99.2	8.6e-129
WP_000141141.1|2962268_2962613_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	98.2	3.6e-56
WP_000573390.1|2962609_2963056_-	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	99.3	5.2e-76
WP_001007889.1|2963052_2963403_-|head	phage head closure protein	head	A0A0P0ZDP7	Stx2-converting_phage	100.0	2.7e-59
WP_000125996.1|2963413_2963740_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	99.1	1.6e-53
WP_001063096.1|2966266_2966488_-	hypothetical protein	NA	H6WZL1	Escherichia_phage	100.0	3.4e-36
WP_171881620.1|2966532_2968470_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	98.3	0.0e+00
WP_001359496.1|2968533_2970195_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.1	0.0e+00
WP_001359495.1|2970191_2970755_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	94.1	1.2e-85
WP_001359494.1|2970870_2971401_-	HNH endonuclease	NA	H6WZK7	Escherichia_phage	92.6	2.6e-90
WP_000074669.1|2971442_2971667_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303878.1|2971748_2972063_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208681.1|2972590_2972776_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	78.7	2.9e-20
WP_000075132.1|2972992_2973490_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_024164617.1|2973489_2973705_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000023145.1|2974142_2975993_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	95.8	0.0e+00
WP_001059384.1|2977512_2978202_-	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_000140002.1|2978198_2978564_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	1.6e-38
WP_001265289.1|2978564_2979620_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.6	2.9e-88
WP_010917803.1|2979621_2979900_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2979969_2980227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961821.1|2980447_2980660_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	72.9	1.3e-16
WP_001449026.1|2980938_2981697_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2982395_2982560_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450692.1|2982556_2983291_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	84.7	7.7e-109
WP_157825328.1|2983324_2983867_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2983778_2984819_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705622.1|2984790_2985342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2985325_2985553_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2985629_2986037_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2986301_2986601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171897.1|2986673_2986892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2986914_2987322_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2987299_2987533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|2987526_2987694_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2988091_2988280_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2988276_2988468_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048269.1|2988560_2991032_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.4	3.6e-57
WP_000113189.1|2991096_2991345_+	excisionase	NA	NA	NA	NA	NA
WP_000113677.1|2991322_2992453_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	2.2e-102
2993271:2993284	attR	AGAATCCTGGTTAA	NA	NA	NA	NA
>prophage 9
NZ_CP038389	Escherichia coli O157:H7 strain DEC5B chromosome, complete genome	5294183	3542990	3588515	5294183	integrase,lysis,terminase,tail,protease,portal,holin	Enterobacteria_phage(46.43%)	65	3542575:3542589	3588589:3588603
3542575:3542589	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247931.1|3542990_3543689_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3543919_3544801_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3544969_3545131_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3545620_3546640_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3546673_3547654_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001101707.1|3547830_3548100_-|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	9.3e-44
WP_171881624.1|3548101_3549418_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	96.6	1.9e-73
WP_001233143.1|3549477_3550077_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	7.2e-105
WP_171881626.1|3550147_3553561_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.8	0.0e+00
WP_000090845.1|3553621_3554230_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.1e-100
WP_001419734.1|3554166_3554910_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	4.5e-149
WP_001152339.1|3554915_3555614_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3555623_3555953_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371993.1|3555952_3559018_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	99.0	0.0e+00
WP_001161009.1|3558989_3559319_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3559327_3559714_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3559774_3560518_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3560528_3560930_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677100.1|3560926_3561505_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.5	9.4e-102
WP_001283153.1|3561516_3561792_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3561784_3562108_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136584.1|3562194_3564222_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.5	0.0e+00
WP_000985947.1|3564166_3565675_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.8	1.6e-289
WP_001072975.1|3565674_3565887_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3565883_3567986_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3567985_3568477_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3569151_3569304_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092264.1|3569291_3569759_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	98.1	2.5e-76
WP_000075144.1|3569755_3570253_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	1.9e-90
WP_000284524.1|3570252_3570468_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3570610_3571009_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3571089_3571248_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3571333_3572077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3572261_3572951_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3572965_3573088_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3573425_3574385_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3574596_3575262_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108059.1|3575258_3575879_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.6	4.1e-95
WP_000567000.1|3575871_3576042_-	protein ninF	NA	Q716C4	Shigella_phage	98.2	4.6e-25
WP_001254218.1|3576038_3576221_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000736902.1|3576217_3576658_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	99.3	1.6e-80
WP_000145926.1|3576731_3577022_-	protein ren	NA	O48423	Enterobacteria_phage	100.0	9.6e-47
WP_000788871.1|3577018_3577720_-	Replication protein 14	NA	A0A0P0ZD31	Stx2-converting_phage	100.0	3.4e-130
WP_000185506.1|3577716_3578616_-	replication protein	NA	A0A0K2FJ31	Enterobacteria_phage	99.7	5.5e-173
WP_000438491.1|3578648_3578948_-	hypothetical protein	NA	A0A0P0ZBJ0	Stx2-converting_phage	96.0	2.0e-47
WP_000067727.1|3579089_3579305_-	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_096246228.1|3579380_3580076_+	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	99.1	4.3e-133
WP_000854877.1|3580248_3580545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000478871.1|3580556_3580841_+	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_000088205.1|3581273_3581546_+	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	98.9	2.2e-40
WP_000392419.1|3581830_3582280_+	hypothetical protein	NA	I6RSN8	Salmonella_phage	87.9	3.3e-70
WP_000065351.1|3582475_3582844_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	4.5e-65
WP_001198861.1|3582916_3583081_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3583049_3583193_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995449.1|3583266_3583563_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_001418384.1|3583568_3584354_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000186844.1|3584350_3585031_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3585027_3585210_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3585182_3585374_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_001386642.1|3585384_3585666_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763363.1|3585764_3585986_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120060.1|3586196_3586799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3587041_3587209_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3587248_3587467_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533657.1|3587444_3588515_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	99.7	1.5e-201
3588589:3588603	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 10
NZ_CP038389	Escherichia coli O157:H7 strain DEC5B chromosome, complete genome	5294183	3815490	3880733	5294183	transposase,integrase,lysis,capsid,tail,protease,terminase,portal,head,holin,tRNA	Enterobacteria_phage(58.18%)	76	3823968:3824014	3870527:3870573
WP_171881632.1|3815490_3816627_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_000383932.1|3816892_3819130_+	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_001301880.1|3819116_3822089_+	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_001224578.1|3822089_3822980_+	DUF4434 family protein	NA	NA	NA	NA	NA
WP_001177459.1|3823162_3823924_+	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
3823968:3824014	attL	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001298108.1|3824366_3824804_+	acetyltransferase	NA	NA	NA	NA	NA
WP_000361110.1|3824828_3825413_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201812.1|3825911_3826865_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226371.1|3827051_3828536_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000239881.1|3829080_3829749_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000885620.1|3829803_3830388_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.3	1.1e-102
WP_024183490.1|3830387_3833303_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	4.2e-57
WP_001230405.1|3833367_3833967_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	98.5	8.8e-111
WP_000515427.1|3834033_3837432_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.2	0.0e+00
WP_000090845.1|3837492_3838101_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.1e-100
WP_001419734.1|3838037_3838781_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	4.5e-149
WP_001152525.1|3838786_3839485_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000847379.1|3839484_3839814_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840251.1|3839810_3842372_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	89.4	0.0e+00
WP_000459483.1|3842364_3842799_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	5.8e-64
WP_000479153.1|3842780_3843203_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001418463.1|3843218_3843959_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	99.2	6.6e-132
WP_000683105.1|3843966_3844362_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975055.1|3844358_3844937_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000753020.1|3844948_3845302_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	97.4	1.3e-61
WP_000710708.1|3845313_3845709_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	91.7	1.3e-54
WP_000063260.1|3845750_3846776_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.1	3.4e-187
WP_001299443.1|3846831_3847164_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	100.0	1.7e-55
WP_000123236.1|3847173_3848493_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.4	9.0e-233
WP_001359455.1|3848473_3850075_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	100.0	5.9e-312
WP_000198149.1|3850071_3850278_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027288.1|3850274_3852200_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.4	0.0e+00
WP_000453580.1|3852174_3852720_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	100.0	2.8e-95
WP_001300120.1|3853108_3853303_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3853467_3853674_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001417742.1|3853959_3854370_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	97.8	3.9e-70
WP_000738495.1|3854661_3854955_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_122993458.1|3855045_3855228_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.7	1.1e-16
WP_001180487.1|3855444_3855921_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3855907_3856213_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097226.1|3856534_3857224_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	49.4	1.5e-58
WP_000971093.1|3857220_3857361_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3857357_3857720_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3857716_3858007_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3857999_3858170_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053021.1|3858169_3858625_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072141214.1|3858621_3858723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|3858813_3859095_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001481254.1|3859138_3859336_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145437.1|3859563_3859848_-	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	95.7	1.1e-42
WP_000788830.1|3859844_3860546_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	3.2e-128
WP_000147923.1|3860542_3861562_-	replication protein	NA	M1FN81	Enterobacteria_phage	67.0	2.8e-109
WP_001182879.1|3861558_3862098_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.7	6.8e-62
WP_000184665.1|3862128_3862356_-	helix-turn-helix domain-containing protein	NA	Q76H55	Enterobacteria_phage	69.0	3.8e-22
WP_000712399.1|3862466_3863159_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001417737.1|3863265_3864873_+	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000233576.1|3865461_3865668_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|3865743_3866040_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3866045_3866831_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_086378269.1|3866827_3867508_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.1	4.6e-132
WP_000682295.1|3867504_3867666_+	DUF1317 family protein	NA	A0A0N7CHV0	Escherichia_phage	96.0	1.0e-21
WP_000129285.1|3867658_3868216_+	phage N-6-adenine-methyltransferase	NA	E5AGF8	Erwinia_phage	62.3	2.0e-61
WP_001386642.1|3868226_3868508_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763385.1|3868606_3868825_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	100.0	7.5e-36
WP_000488407.1|3868872_3869151_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	97.8	4.9e-48
WP_001359450.1|3869349_3870513_+|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.0	6.3e-198
WP_000805428.1|3870847_3871480_+	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
3870527:3870573	attR	AATGGCGCGCCCTGCAGGATTCGAACCTGCGGCCCACGACTTAGAAG	NA	NA	NA	NA
WP_001255114.1|3871482_3871998_-	fimbria assembly protein	NA	NA	NA	NA	NA
WP_000691072.1|3872008_3873016_-	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001359449.1|3873028_3875638_-	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000988383.1|3875668_3876361_-	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_000776555.1|3876580_3877123_-	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000729155.1|3877602_3878469_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000190288.1|3878470_3878683_+	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_001143558.1|3878790_3879312_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000912351.1|3879347_3880733_-|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
>prophage 11
NZ_CP038389	Escherichia coli O157:H7 strain DEC5B chromosome, complete genome	5294183	4212119	4266366	5294183	integrase,lysis,capsid,tail,terminase,protease,portal,head,holin	Enterobacteria_phage(42.19%)	68	4213464:4213509	4262465:4262510
WP_001130496.1|4212119_4213301_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.6	1.1e-144
4213464:4213509	attL	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000950785.1|4215709_4216690_-	NleB family type III secretion system effector arginine glycosyltransferase	NA	Q8HAB2	Salmonella_phage	50.2	7.7e-88
WP_001132166.1|4217689_4218280_-	bfpT-regulated chaperone	NA	NA	NA	NA	NA
WP_001144082.1|4218462_4219089_+	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.7e-25
WP_001117988.1|4219829_4220402_-	T3SS effector NleG family protein	NA	H6WZN1	Escherichia_phage	52.7	2.1e-45
WP_001024023.1|4220513_4220783_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	97.8	8.4e-45
WP_000741872.1|4220784_4222101_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	H6WZM9	Escherichia_phage	94.5	3.5e-67
WP_001233143.1|4222160_4222760_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.5	7.2e-105
WP_171881635.1|4222830_4226244_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	96.9	0.0e+00
WP_000090845.1|4226304_4226913_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	1.1e-100
WP_001419734.1|4226849_4227593_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	4.5e-149
WP_001152525.1|4227598_4228297_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.8	8.9e-131
WP_000847379.1|4228296_4228626_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_000840251.1|4228622_4231184_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	89.4	0.0e+00
WP_000459483.1|4231176_4231611_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	5.8e-64
WP_000479189.1|4231592_4232015_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	86.4	1.3e-60
WP_001419284.1|4232030_4232771_-|tail	phage tail protein	tail	A0A2I6TC77	Escherichia_phage	96.3	1.2e-128
WP_000683050.1|4232778_4233174_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	96.2	7.2e-69
WP_000155464.1|4233170_4233704_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	71.9	6.7e-62
WP_001204539.1|4233715_4234069_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	68.4	7.4e-41
WP_000201530.1|4234061_4234436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000522651.1|4234487_4235516_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.6	2.7e-115
WP_000256844.1|4235573_4235921_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	57.0	2.6e-22
WP_171881610.1|4235957_4237463_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.0	1.6e-100
WP_171881636.1|4237452_4238691_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	62.2	1.1e-142
WP_000259002.1|4239040_4239247_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_171881607.1|4239230_4241159_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	4.3e-260
WP_000235436.1|4241130_4241640_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_013009113.1|4242041_4242266_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001302690.1|4242346_4242661_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_072020783.1|4243187_4243370_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	1.4e-14
WP_000075132.1|4243586_4244084_-	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_024164617.1|4244083_4244299_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000026511.1|4244736_4246578_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	77.9	3.6e-288
WP_001419325.1|4246874_4247006_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000512794.1|4247507_4248026_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	97.1	6.5e-94
WP_001028868.1|4248016_4248688_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	95.0	1.9e-125
WP_001107957.1|4248684_4249290_-	recombination protein NinG	NA	A0A1I9LJQ2	Stx_converting_phage	98.0	8.1e-96
WP_000566862.1|4249282_4249453_-	protein ninF	NA	K7PMD9	Enterobacterial_phage	96.4	9.3e-26
WP_001254239.1|4249449_4249632_-	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	100.0	1.9e-29
WP_000153282.1|4249628_4250156_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	2.8e-100
WP_000736913.1|4250152_4250593_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_000145894.1|4250666_4250957_-	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	97.9	3.1e-45
WP_000788904.1|4250953_4251655_-	hypothetical protein	NA	A0A0P0ZD31	Stx2-converting_phage	98.7	8.4e-129
WP_000185426.1|4251651_4252551_-	replication protein	NA	K7P7F0	Enterobacteria_phage	97.7	2.1e-169
WP_000251069.1|4252583_4252877_-	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_001194218.1|4252996_4253212_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000028392.1|4253315_4253948_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_000618044.1|4253944_4254349_+	hypothetical protein	NA	A0A088CQ79	Enterobacteria_phage	98.5	5.6e-69
WP_000340011.1|4254700_4255024_+	antitermination protein	NA	A4KWR8	Enterobacteria_phage	99.1	1.0e-52
WP_000281856.1|4255024_4255507_-	super-infection exclusion protein B	NA	A4KWR7	Enterobacteria_phage	100.0	1.1e-87
WP_000213973.1|4255773_4255974_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	98.5	9.3e-33
WP_001198861.1|4256197_4256362_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|4256330_4256474_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_000995449.1|4256547_4256844_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_001418384.1|4256849_4257635_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	1.8e-148
WP_000186844.1|4257631_4258312_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|4258308_4258491_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|4258463_4258655_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_001386642.1|4258665_4258947_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763359.1|4259045_4259267_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	94.5	4.6e-33
WP_001289865.1|4259263_4259770_+	ead/Ea22-like family protein	NA	K7P6T4	Enterobacteria_phage	86.7	3.1e-56
WP_000103020.1|4259766_4260531_+	DUF550 domain-containing protein	NA	S4TSR6	Salmonella_phage	53.5	4.5e-51
WP_001281200.1|4260631_4260976_+	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	99.1	5.9e-59
WP_000023578.1|4261289_4262450_+|integrase	site-specific integrase	integrase	K7P7R5	Enterobacteria_phage	99.2	2.1e-225
WP_000893282.1|4262654_4263908_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4262465:4262510	attR	TGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4263919_4265023_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4265310_4266366_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 12
NZ_CP038389	Escherichia coli O157:H7 strain DEC5B chromosome, complete genome	5294183	4285242	4310989	5294183	plate,transposase	uncultured_Caudovirales_phage(75.0%)	19	NA	NA
WP_000027427.1|4285242_4286415_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4286495_4286681_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4286595_4286859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145879.1|4287088_4288822_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	41.5	6.5e-21
WP_000420853.1|4288824_4289961_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001414559.1|4290706_4291222_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_000339432.1|4291290_4292799_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	7.1e-24
WP_171881642.1|4292980_4293742_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_000015419.1|4293835_4298068_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103342.1|4298657_4300799_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.1e-25
WP_001142958.1|4301008_4301527_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037397.1|4302223_4302724_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4302758_4302983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000611742.1|4304515_4304929_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4304932_4306783_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4306746_4307829_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4307853_4309134_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4309130_4309655_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246439.1|4309657_4310989_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 1
NZ_CP038392	Escherichia coli O157:H7 strain DEC5B plasmid pDEC5B-4, complete sequence	75328	1449	52896	75328	integrase,transposase	Shigella_phage(22.22%)	54	5191:5250	64608:64677
WP_001418814.1|1449_2232_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	89.3	6.0e-51
WP_000527007.1|2688_2946_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050553036.1|3040_3490_-	hypothetical protein	NA	A0A222YWI5	Escherichia_phage	52.6	1.1e-25
WP_085949497.1|3452_4600_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
5191:5250	attL	ACGCAACTAACAGGCGCTCTTCCTGTCATTACGATTCCGTTCGGAACCATTACACTTTTA	NA	NA	NA	NA
WP_096837492.1|5528_6149_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	38.2	5.5e-23
WP_001066941.1|9918_10659_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_157909925.1|12712_12913_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032176921.1|13792_14095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122993454.1|15219_15867_+	T3SS effector NleG family protein	NA	B6ETE1	Enterobacteria_phage	31.4	1.0e-24
WP_001119620.1|16466_17048_+	hypothetical protein	NA	NA	NA	NA	NA
WP_077631143.1|17914_18433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_106377009.1|18829_20057_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	98.0	3.0e-174
WP_029785643.1|20172_20442_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001418855.1|22329_22587_-	CopG family transcriptional regulator	NA	NA	NA	NA	NA
WP_000131019.1|23647_24505_-	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001365705.1|24497_24572_-	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000078114.1|24804_25062_-	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_000405244.1|25371_25854_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001346256.1|25844_26147_-	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_064717443.1|26468_26618_-	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001418856.1|26980_27112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_032320915.1|27296_27509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096837425.1|27638_28199_-	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_000206157.1|28253_28994_-	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	29.4	7.0e-09
WP_085947772.1|30758_31971_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.1	8.3e-100
WP_096837424.1|31975_32242_-	conjugal transfer protein TraB	NA	NA	NA	NA	NA
WP_072095570.1|32241_32946_-	type-F conjugative transfer system secretin TraK	NA	NA	NA	NA	NA
WP_001717262.1|32956_33523_-	type IV conjugative transfer system protein TraE	NA	NA	NA	NA	NA
WP_000012106.1|33544_33856_-	type IV conjugative transfer system protein TraL	NA	NA	NA	NA	NA
WP_000340270.1|33870_34236_-	type IV conjugative transfer system pilin TraA	NA	NA	NA	NA	NA
WP_001254386.1|34269_34497_-	conjugal transfer relaxosome protein TraY	NA	NA	NA	NA	NA
WP_000332493.1|34591_35278_-	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_000124982.1|35471_35855_-	relaxosome protein TraM	NA	NA	NA	NA	NA
WP_096837423.1|36165_36768_+	transglycosylase SLT domain-containing protein	NA	NA	NA	NA	NA
WP_137445206.1|37063_37885_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.6	4.4e-44
WP_000107542.1|38003_38291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001346267.1|39094_39658_-	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	37.3	8.0e-21
WP_096837421.1|39704_41066_-	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_000218642.1|41117_41348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001027488.1|42322_42514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000271728.1|42510_42933_-	DUF1380 family protein	NA	NA	NA	NA	NA
WP_010891293.1|42979_43282_-	antirestriction protein	NA	NA	NA	NA	NA
WP_000066222.1|43808_44696_-	RepB family plasmid replication initiator protein	NA	A0A1B0VDL5	Salmonella_phage	45.5	1.8e-64
WP_000600198.1|45176_45599_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	52.4	4.5e-29
WP_000457546.1|45598_46873_+	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	64.5	1.0e-156
WP_000143875.1|46955_47279_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000843285.1|47275_47713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001085425.1|47712_48744_-	ParB/RepB/Spo0J family partition protein	NA	S5WII0	Leptospira_phage	25.7	4.9e-08
WP_000172786.1|48743_49610_-	ParA family protein	NA	NA	NA	NA	NA
WP_001218555.1|49995_50535_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	41.8	2.0e-05
WP_001120171.1|50758_51010_+	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_000222786.1|51006_51294_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	49.5	3.4e-20
WP_077631139.1|51456_51654_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_085949497.1|51749_52896_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	92.6	2.3e-147
64608:64677	attR	TAAAAGTGTAATGGTTCCGAACGGAATCGTAATGACAGGAAGAGCGCCTGTTAGTTGCGTTCTTCCTGGA	NA	NA	NA	NA
