The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038402	Escherichia coli O157:H7 strain BB24-1 chromosome, complete genome	5609172	137232	149516	5609172	integrase	Enterobacteria_phage(90.0%)	13	138610:138630	149679:149699
WP_001219063.1|137232_138414_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	68.9	1.4e-160
138610:138630	attL	TGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
WP_000783661.1|139125_141459_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_000856729.1|141473_141794_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459294.1|141929_142385_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244665.1|142377_142665_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	97.9	8.6e-48
WP_000980233.1|142657_143257_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	80.3	1.1e-49
WP_001149160.1|143253_143520_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283041.1|144070_144805_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	97.5	2.2e-127
WP_000638631.1|144801_145302_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446145.1|145375_145948_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.4e-94
WP_000704989.1|146588_148109_+	cytidine deaminase	NA	A0A0N9QQ67	Chrysochromulina_ericina_virus	46.2	2.7e-07
WP_000021256.1|148110_148284_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001218978.1|148328_149516_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	92.0	5.3e-208
149679:149699	attR	TGGCGGAAGATCACAGGAGTC	NA	NA	NA	NA
>prophage 2
NZ_CP038402	Escherichia coli O157:H7 strain BB24-1 chromosome, complete genome	5609172	1239968	1255784	5609172	tail,holin,transposase	Enterobacteria_phage(33.33%)	19	NA	NA
WP_162829202.1|1239968_1241181_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001108081.1|1241806_1242373_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1242347_1242959_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1242955_1243621_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1243617_1244241_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1244493_1245237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1245322_1245490_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143068.1|1245897_1247751_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000284517.1|1247900_1248116_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1248120_1248465_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1248821_1249202_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1249198_1249546_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001023396.1|1250163_1250433_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1250593_1251016_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1251145_1252204_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1252282_1252933_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1253115_1253706_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1254207_1254456_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1255301_1255784_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 3
NZ_CP038402	Escherichia coli O157:H7 strain BB24-1 chromosome, complete genome	5609172	1534681	1540107	5609172	integrase	Enterobacteria_phage(50.0%)	6	1523669:1523685	1542303:1542319
1523669:1523685	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1534681_1535251_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1535250_1535718_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1535704_1536385_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1536394_1537531_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1537705_1538863_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1539174_1540107_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1542303:1542319	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 4
NZ_CP038402	Escherichia coli O157:H7 strain BB24-1 chromosome, complete genome	5609172	1784388	1869263	5609172	head,portal,capsid,protease,transposase,terminase,tail,tRNA,holin	Enterobacteria_phage(46.07%)	97	NA	NA
WP_000569336.1|1784388_1785315_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1785319_1786051_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1786031_1786139_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1786198_1786900_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063643.1|1786920_1788207_-	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1788240_1788495_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1788513_1788648_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1788651_1788894_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1788981_1789344_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1789340_1789697_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1790030_1790207_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1790208_1791156_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1791152_1791374_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_077631611.1|1791472_1791754_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	98.9	5.5e-47
WP_000548547.1|1791764_1791956_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1791928_1792111_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186785.1|1792110_1792788_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	99.1	2.3e-131
WP_000100847.1|1792784_1793570_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995407.1|1793575_1793872_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	98.0	5.2e-48
WP_000361826.1|1793947_1794091_-	host cell division inhibitory peptide Kil	NA	A0A0P0ZC96	Stx2-converting_phage	97.9	3.5e-18
WP_001198858.1|1794083_1794224_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	3.3e-21
WP_000065373.1|1794296_1794665_-	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	7.6e-65
WP_000095081.1|1794845_1795469_-	hypothetical protein	NA	A0A2D1GLY1	Escherichia_phage	96.6	2.8e-107
WP_000198445.1|1795530_1795914_-	hypothetical protein	NA	Q08J47	Stx2-converting_phage	100.0	3.9e-64
WP_000745483.1|1796402_1796567_-	hypothetical protein	NA	G9L672	Escherichia_phage	100.0	5.1e-21
WP_000957426.1|1796569_1797616_-	serine/threonine protein kinase	NA	G9L673	Escherichia_phage	100.0	5.2e-207
WP_001221211.1|1797609_1798071_-	hypothetical protein	NA	G9L674	Escherichia_phage	100.0	1.3e-77
WP_000885203.1|1798138_1798480_-	DUF3024 domain-containing protein	NA	A0A1I9LJN9	Stx_converting_phage	100.0	3.9e-63
WP_000250473.1|1798540_1799248_-	helix-turn-helix transcriptional regulator	NA	G9L676	Escherichia_phage	100.0	1.5e-133
WP_001180318.1|1799326_1799554_+	helix-turn-helix domain-containing protein	NA	G9L677	Escherichia_phage	100.0	7.8e-36
WP_000438524.1|1799692_1799989_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	98.0	4.4e-47
WP_000166961.1|1800021_1800183_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539349.1|1800169_1800991_+	replication protein	NA	B6DZ75	Enterobacteria_phage	100.0	1.5e-153
WP_162829202.1|1801521_1802735_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001000130.1|1803747_1804026_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103679.1|1804158_1804374_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1804384_1804621_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_001310475.1|1804577_1805024_+	recombination protein NinB	NA	A0A1U9AJ79	Stx1_converting_phage	100.0	2.4e-81
WP_000153268.1|1805020_1805548_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|1805544_1805727_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000290551.1|1806002_1806680_+	phage antirepressor Ant	NA	Q4A1A4	Enterobacteria_phage	97.8	2.2e-126
WP_001004018.1|1806754_1807477_+	phage antirepressor KilAC domain-containing protein	NA	B6DZ83	Enterobacteria_phage	100.0	3.5e-130
WP_001107998.1|1807476_1808082_+	recombination protein NinG	NA	B6DZ84	Enterobacteria_phage	100.0	6.6e-98
WP_000144759.1|1808078_1808273_+	protein ninH	NA	Q6H9W6	Enterobacteria_phage	100.0	8.4e-31
WP_001204852.1|1808265_1808700_+	antitermination protein	NA	Q777W5	Enterobacteria_phage	100.0	3.6e-82
WP_000691354.1|1809206_1810154_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1810163_1810433_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_064261944.1|1810932_1812783_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.8	0.0e+00
WP_024164617.1|1813221_1813437_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000731259.1|1813441_1813786_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000992137.1|1813836_1814370_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|1814640_1815210_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1815209_1815356_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1815583_1815769_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|1816193_1816421_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|1816462_1816828_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_001303051.1|1817117_1817681_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_001303049.1|1817677_1819339_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_000172999.1|1819402_1821340_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1821384_1821606_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_015994249.1|1821551_1824137_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	100.0	0.0e+00
WP_000125984.1|1824133_1824460_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|1824470_1824821_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|1824817_1825264_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|1825260_1825605_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275464.1|1825670_1826387_+	immunoglobulin domain-containing protein	NA	B6DZA6	Enterobacteria_phage	100.0	1.2e-127
WP_000710952.1|1826401_1826776_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|1826871_1827081_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|1827128_1830371_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|1830363_1830705_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152183.1|1830704_1831403_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	6.6e-134
WP_001302649.1|1831419_1831740_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1831847_1832021_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|1832091_1833015_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|1833068_1833806_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_050546863.1|1833751_1834384_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_015994252.1|1834643_1838123_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	100.0	0.0e+00
WP_001230508.1|1838190_1838790_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268879.1|1838854_1840024_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	100.0	4.3e-85
WP_171879920.1|1840025_1840295_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	98.9	1.9e-44
WP_072142879.1|1840455_1840872_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1840953_1841595_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1841757_1842006_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1842520_1844206_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1844202_1844922_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1844968_1845439_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000998048.1|1845820_1847359_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1847408_1847756_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1847752_1848133_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001087225.1|1848516_1850520_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_171879921.1|1850540_1851653_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	2.4e-162
WP_000528951.1|1851645_1852377_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1852395_1853925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1853935_1855024_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1856264_1856582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1856643_1860273_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1867229_1869263_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 5
NZ_CP038402	Escherichia coli O157:H7 strain BB24-1 chromosome, complete genome	5609172	1894912	1932163	5609172	head,portal,capsid,integrase,lysis,terminase,plate,tail,tRNA,holin	Escherichia_phage(40.0%)	53	1896693:1896720	1927837:1927864
WP_000807362.1|1894912_1895812_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1896217_1896535_+	hypothetical protein	NA	NA	NA	NA	NA
1896693:1896720	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985261.1|1896799_1897813_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_001306384.1|1897928_1898228_-	helix-turn-helix transcriptional regulator	NA	Q1JS63	Enterobacteria_phage	100.0	2.5e-50
WP_000043869.1|1898342_1898618_+	hypothetical protein	NA	Q1JS62	Enterobacteria_phage	100.0	1.3e-48
WP_001005166.1|1898628_1898799_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	6.7e-24
WP_000217679.1|1898795_1899296_+	hypothetical protein	NA	S4TTB7	Salmonella_phage	100.0	1.0e-91
WP_000557701.1|1899359_1899584_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	98.6	3.0e-32
WP_001277943.1|1899583_1899886_+	DUF5405 family protein	NA	U5N0U2	Enterobacteria_phage	95.0	1.9e-45
WP_001113260.1|1899885_1900110_+	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	5.5e-34
WP_000027665.1|1900106_1900382_+	DUF5405 family protein	NA	M1TAP2	Escherichia_phage	98.9	6.6e-45
WP_000268557.1|1900371_1902660_+	replication endonuclease	NA	Q858T4	Yersinia_virus	97.6	0.0e+00
WP_001302990.1|1903068_1903224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001310277.1|1903260_1903569_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	40.2	1.7e-12
WP_000746343.1|1903546_1904497_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.0	3.8e-39
WP_000042038.1|1904621_1905059_-	hypothetical protein	NA	S4TUD6	Salmonella_phage	92.3	1.6e-69
WP_000551925.1|1905057_1905252_+	hypothetical protein	NA	S4TRZ0	Salmonella_phage	89.1	8.5e-23
WP_001177885.1|1905282_1905552_-	hypothetical protein	NA	Q2P9X2	Enterobacteria_phage	89.9	3.8e-29
WP_000038195.1|1905764_1906799_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	96.2	4.5e-195
WP_000156861.1|1906798_1908571_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085969.1|1908744_1909599_+|capsid	GPO family capsid scaffolding protein	capsid	Q94MI4	Enterobacteria_phage	95.8	5.8e-132
WP_001248573.1|1909653_1910727_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.7	6.7e-202
WP_000203439.1|1910730_1911474_+|terminase	terminase endonuclease subunit	terminase	Q94MK6	Enterobacteria_phage	98.4	8.6e-124
WP_000988633.1|1911573_1912083_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846399.1|1912082_1912286_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000123125.1|1912289_1912571_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	98.9	6.3e-43
WP_171879922.1|1912570_1913068_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	98.8	5.8e-92
WP_000736588.1|1913082_1913508_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	94.3	2.1e-58
WP_000040660.1|1913495_1913921_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	97.2	1.8e-65
WP_001300730.1|1913892_1914066_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917172.1|1914028_1914496_+|tail	phage tail protein	tail	U5N0S7	Enterobacteria_phage	97.4	7.4e-81
WP_001001774.1|1914488_1914941_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	99.3	1.4e-76
WP_001093756.1|1915007_1915643_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.6	4.5e-113
WP_000127172.1|1915639_1915987_+	GPW/gp25 family protein	NA	A0A0F7L9X3	Escherichia_phage	99.1	8.5e-58
WP_001121492.1|1915991_1916900_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.0	8.3e-161
WP_001285344.1|1916892_1917504_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	4.9e-117
WP_000216996.1|1917500_1918922_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	80.1	1.5e-196
WP_001008242.1|1918942_1919386_+|tail	tail fiber assembly protein	tail	M1SNQ2	Escherichia_phage	97.3	1.6e-80
WP_000368070.1|1919357_1919960_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	98.5	5.9e-107
WP_001145598.1|1919959_1920448_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	99.3	3.7e-83
WP_000905091.1|1920478_1921072_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.0	1.3e-103
WP_001286714.1|1921131_1922322_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	1.5e-223
WP_001251408.1|1922334_1922853_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031307.1|1922909_1923185_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	98.9	2.2e-40
WP_000785970.1|1923217_1923337_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_000069920.1|1923329_1925777_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	95.7	0.0e+00
WP_000978915.1|1925791_1926271_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	99.4	1.5e-84
WP_000882987.1|1926270_1927434_+	phage late control D family protein	NA	A0A0F7LDZ2	Escherichia_phage	98.7	3.5e-204
WP_000468308.1|1927515_1927734_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1928008_1929370_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
1927837:1927864	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001301848.1|1929517_1929850_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|1930040_1930763_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|1930759_1932163_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 6
NZ_CP038402	Escherichia coli O157:H7 strain BB24-1 chromosome, complete genome	5609172	2015387	2095272	5609172	head,capsid,protease,integrase,lysis,transposase,terminase,tail,holin	Stx2-converting_phage(60.71%)	98	2006338:2006352	2021761:2021775
2006338:2006352	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007946.1|2015387_2016566_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|2016546_2016738_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|2016815_2017160_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|2017347_2017698_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001289930.1|2018564_2019512_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|2019508_2019730_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|2019828_2020110_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548528.1|2020120_2020312_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|2020284_2020467_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186848.1|2020463_2021144_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	100.0	1.6e-132
WP_001302855.1|2021140_2021926_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
2021761:2021775	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_000995486.1|2021931_2022228_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|2022302_2022446_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2022414_2022579_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|2022651_2023020_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394301.1|2023202_2023463_-	hypothetical protein	NA	A0A0P0ZC97	Stx2-converting_phage	100.0	1.1e-44
WP_000088203.1|2023521_2023794_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|2023771_2023954_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|2024522_2025044_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|2025545_2026241_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|2026315_2026531_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|2026672_2026969_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|2027001_2027163_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|2027149_2027971_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_162829202.1|2029179_2030392_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001171554.1|2030784_2031165_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2031161_2031509_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2031558_2033097_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001220560.1|2033185_2033797_+	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_000344569.1|2034260_2034593_+	hypothetical protein	NA	A0A0P0ZCF4	Stx2-converting_phage	100.0	3.3e-59
WP_000103678.1|2034725_2034941_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_001449504.1|2034951_2035188_+	restriction alleviation protein, Lar family	NA	Q687G3	Enterobacteria_phage	100.0	9.3e-40
WP_001303571.1|2035144_2035591_+	recombination protein NinB	NA	Q8VNP6	Enterobacteria_phage	100.0	2.4e-81
WP_000153268.1|2035587_2036115_+	phage N-6-adenine-methyltransferase	NA	Q9EYC2	Enterobacteria_phage	100.0	1.6e-100
WP_001254256.1|2036111_2036294_+	NinE family protein	NA	A0A0N7C1X3	Escherichia_phage	100.0	5.7e-29
WP_000208500.1|2036568_2037333_+	phage antirepressor Ant	NA	A0A0P0ZB11	Stx2-converting_phage	100.0	1.4e-121
WP_001004016.1|2037407_2038130_+	phage antirepressor KilAC domain-containing protein	NA	A0A0P0ZCB2	Stx2-converting_phage	100.0	6.0e-130
WP_001108004.1|2038129_2038735_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|2038731_2039403_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|2039393_2039882_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|2040531_2041491_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|2041502_2041772_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|2042068_2042392_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143113.1|2042635_2044573_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	100.0	0.0e+00
WP_000143458.1|2044709_2044889_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2044929_2045202_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|2045278_2045494_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|2045493_2045991_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|2045987_2046425_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|2046627_2047125_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|2047121_2047379_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|2047841_2048069_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|2048110_2048476_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958396.1|2048767_2049331_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_162829202.1|2049999_2051213_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000173023.1|2052365_2054303_+|capsid	phage major capsid protein	capsid	A0A0P0ZAJ3	Stx2-converting_phage	100.0	0.0e+00
WP_001063023.1|2054347_2054569_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000125990.1|2057095_2057422_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZBH1	Stx2-converting_phage	100.0	9.2e-54
WP_001007905.1|2057431_2057782_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|2057778_2058225_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2058221_2058566_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2058624_2059341_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2059346_2059721_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2059816_2060026_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_015994262.1|2060077_2063320_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2063312_2063654_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001303038.1|2063653_2064352_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	100.0	1.5e-133
WP_001302649.1|2064368_2064689_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2064796_2064970_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2065040_2065964_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|2066017_2066755_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_050546863.1|2066700_2067333_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_171879924.1|2067578_2071058_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	99.7	0.0e+00
WP_001230314.1|2071124_2071724_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	100.0	1.8e-111
WP_000268993.1|2071788_2073102_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	100.0	2.8e-85
WP_001023452.1|2073103_2073373_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	100.0	6.4e-45
WP_000491542.1|2073513_2074389_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2074613_2075264_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2076587_2077754_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2077872_2078346_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2078544_2079603_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2079774_2080104_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2080204_2080387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2080875_2080989_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2081001_2081196_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2081654_2082023_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2082096_2082318_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2082380_2082857_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2082871_2083351_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2083432_2084254_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2084474_2084885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2084900_2085584_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2085719_2086790_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2086786_2087692_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000638172.1|2087688_2088570_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829204.1|2088553_2089767_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000966626.1|2090138_2092286_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2093733_2095272_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 7
NZ_CP038402	Escherichia coli O157:H7 strain BB24-1 chromosome, complete genome	5609172	2119657	2160807	5609172	head,portal,capsid,integrase,transposase,terminase,tail,holin	Escherichia_phage(35.0%)	50	2099928:2099942	2123782:2123796
2099928:2099942	attL	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000533600.1|2119657_2120680_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2120679_2120883_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2120941_2123413_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2123508_2123697_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2123693_2123882_-	cell division inhibitor	NA	NA	NA	NA	NA
2123782:2123796	attR	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000367376.1|2124362_2124515_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2124789_2125434_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2125531_2125759_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2125755_2126181_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2126249_2127287_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2127198_2127741_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2127775_2128474_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2128495_2128720_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2128716_2129073_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2129105_2129258_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2129254_2129566_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2129692_2130256_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2130365_2130470_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2130656_2130869_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2131036_2131315_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2131316_2132366_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2132378_2132738_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2132734_2133424_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000023257.1|2134963_2136814_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2136895_2138109_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2138419_2138635_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2138639_2138984_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2139034_2139568_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2139723_2139906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2139918_2140050_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2140277_2140463_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2140989_2141304_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2141385_2141610_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2142004_2142514_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2144398_2144605_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2144601_2146194_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_001254002.1|2146183_2147689_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2147725_2148073_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2148130_2148397_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2148378_2149119_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2149132_2149564_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2149590_2150004_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082473.1|2149984_2152564_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000847298.1|2152560_2152890_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001302968.1|2152889_2153588_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000194760.1|2153598_2154342_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_140408398.1|2154287_2154920_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.0	4.9e-104
WP_001230509.1|2158702_2159302_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_088136976.1|2159366_2160536_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	99.5	1.1e-83
WP_001023396.1|2160537_2160807_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
>prophage 8
NZ_CP038402	Escherichia coli O157:H7 strain BB24-1 chromosome, complete genome	5609172	2218389	2239688	5609172	tail,integrase,transposase	Enterobacteria_phage(72.0%)	29	2232824:2232837	2242830:2242843
WP_032161583.1|2218389_2219526_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|2219476_2219800_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_162829202.1|2221005_2222219_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_072141434.1|2222275_2222455_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	88.1	9.8e-26
WP_000290456.1|2222454_2222967_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2223021_2223387_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2223395_2223551_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2226353_2226842_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2226998_2227571_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2227614_2228145_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2229236_2229551_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2229555_2230515_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2230591_2233414_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2232824:2232837	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2233420_2233786_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2233782_2234400_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2234411_2234711_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2234707_2234974_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2234970_2235174_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2235197_2235614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2235706_2235820_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2235816_2236059_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2236070_2236349_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2236359_2236710_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2236731_2236935_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2237006_2237144_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2237233_2237638_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2237653_2238304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2238333_2238681_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001303019.1|2238686_2239688_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	59.1	3.5e-104
2242830:2242843	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 9
NZ_CP038402	Escherichia coli O157:H7 strain BB24-1 chromosome, complete genome	5609172	2430418	2483473	5609172	head,portal,capsid,integrase,transposase,terminase,plate,tail,tRNA,holin	Enterobacteria_phage(66.04%)	68	2437753:2437777	2474223:2474247
WP_001144201.1|2430418_2432347_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.1	9.4e-130
WP_001700733.1|2432350_2432893_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|2432989_2433187_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2433239_2433596_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2433718_2433763_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018588.1|2434045_2435029_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672328.1|2435043_2437431_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|2437435_2437735_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2437753:2437777	attL	GGCCGCTCTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_000078916.1|2438040_2438181_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_001302981.1|2438371_2438632_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000069998.1|2438792_2439398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132850.1|2439550_2440660_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	93.0	1.1e-191
WP_000005394.1|2440817_2442002_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	99.2	3.6e-225
WP_000290466.1|2442001_2442514_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	96.5	3.3e-90
WP_000665308.1|2442568_2442934_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	97.5	3.8e-56
WP_000333495.1|2442942_2443098_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000853421.1|2443084_2445892_+|tail	phage tail tape measure protein	tail	A0A0A7NRZ9	Enterobacteria_phage	95.6	0.0e+00
WP_000979945.1|2445904_2446393_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	99.4	1.4e-85
WP_000905082.1|2446419_2447019_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	82.2	8.9e-87
WP_000983063.1|2447046_2447589_+|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	63.0	3.3e-56
WP_000368062.1|2447588_2448191_+|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	89.5	6.2e-96
WP_001008232.1|2448162_2448606_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	6.3e-82
WP_000217005.1|2448626_2450132_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	62.7	6.6e-155
WP_000071724.1|2450128_2450737_-|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	74.9	1.5e-86
WP_001111970.1|2450729_2451626_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	97.3	7.4e-154
WP_001067548.1|2451629_2451959_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	100.0	2.2e-55
WP_001449632.1|2451976_2452543_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	95.7	4.7e-98
WP_000356344.1|2452554_2453190_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	99.5	2.4e-114
WP_000920579.1|2453182_2453650_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	98.1	9.3e-84
WP_000780572.1|2453787_2454195_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	99.3	9.0e-67
WP_000072327.1|2454191_2454584_-	M15 family metallopeptidase	NA	A0A0A7NQ86	Enterobacteria_phage	100.0	5.8e-71
WP_000104350.1|2454580_2454904_-|holin	phage holin family protein	holin	A0A0A7NRY9	Enterobacteria_phage	99.1	1.6e-50
WP_000864901.1|2454906_2455107_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	100.0	3.5e-32
WP_000063103.1|2455106_2455601_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	99.4	1.2e-89
WP_000632347.1|2455702_2456503_-|terminase	terminase	terminase	A0A0A7NPX9	Enterobacteria_phage	92.5	1.6e-131
WP_001055118.1|2456548_2457601_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	100.0	6.8e-199
WP_001262673.1|2457623_2458460_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	100.0	2.7e-150
WP_000613768.1|2458614_2460366_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	99.8	0.0e+00
WP_000087812.1|2460365_2461412_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	100.0	1.5e-206
WP_001594304.1|2461899_2462169_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000211267.1|2462533_2462845_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	83.5	2.2e-41
WP_000708312.1|2462849_2463809_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	98.4	1.5e-176
WP_001001609.1|2463885_2466726_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	90.1	0.0e+00
WP_000564228.1|2466722_2467112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310326.1|2467108_2467726_-	ash family protein	NA	K7PLX4	Enterobacteria_phage	51.1	2.2e-11
WP_000104308.1|2467737_2468037_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	1.4e-40
WP_000153707.1|2468033_2468300_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2468296_2468500_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_029238958.1|2468523_2468844_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021666.1|2469033_2469147_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	89.2	2.0e-08
WP_000514277.1|2469143_2469386_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	100.0	2.3e-38
WP_000158974.1|2469397_2469685_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	75.8	6.6e-32
WP_000917809.1|2469695_2470034_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	87.1	2.3e-52
WP_162829202.1|2470210_2471423_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000904674.1|2471736_2472045_+	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	52.1	8.7e-22
WP_001247210.1|2472133_2473072_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	51.5	5.1e-81
WP_000403439.1|2473074_2473575_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001689686.1|2473675_2474113_+	DUF1640 domain-containing protein	NA	NA	NA	NA	NA
WP_000956513.1|2474305_2475286_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2474223:2474247	attR	GGCCGCTCTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_001154193.1|2475348_2475900_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029463.1|2475899_2476649_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
WP_001209780.1|2476726_2477191_+	lipoprotein	NA	S5MM68	Bacillus_phage	37.7	9.5e-12
WP_001302301.1|2477437_2478151_+	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001171554.1|2478537_2478918_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2478914_2479262_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2479311_2480850_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001270809.1|2482103_2482295_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_001082219.1|2482426_2483473_-	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	2.5e-84
>prophage 10
NZ_CP038402	Escherichia coli O157:H7 strain BB24-1 chromosome, complete genome	5609172	2599039	2741044	5609172	head,portal,capsid,protease,integrase,transposase,terminase,tail,holin	Stx2-converting_phage(40.19%)	153	2627730:2627751	2687136:2687157
WP_001260835.1|2599039_2599861_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2599960_2600044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2600136_2600472_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2600868_2602122_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2602228_2603122_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2603256_2604477_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2604601_2605297_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2605249_2606542_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2606699_2607314_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2607356_2608211_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2608212_2608830_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2608840_2611264_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2611324_2613751_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2613949_2614255_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2614362_2615073_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2615075_2615636_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2615670_2616012_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2616146_2616473_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2617461_2617713_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2617785_2620257_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2620349_2620541_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2620537_2620726_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2621126_2621291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2621294_2621513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2621584_2621884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2622236_2622515_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2622516_2622708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2622728_2623100_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2623197_2623500_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2623496_2623922_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095670.1|2623944_2624907_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.0	1.8e-81
WP_000788936.1|2624913_2625654_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	89.8	2.3e-124
WP_001118159.1|2626464_2626860_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2626916_2627501_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2627616_2627721_+	hypothetical protein	NA	NA	NA	NA	NA
2627730:2627751	attL	CGATATGGGAATTCCCATATCG	NA	NA	NA	NA
WP_000887477.1|2627909_2628122_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2628289_2628568_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2628569_2629619_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2629631_2629991_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2629987_2630677_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2631313_2631742_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_024748470.1|2632220_2634071_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_024180155.1|2634510_2634726_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731257.1|2634730_2635024_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	8.3e-46
WP_001171554.1|2635099_2635480_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2635476_2635824_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2635873_2637412_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000992137.1|2637575_2638109_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2638379_2638949_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2638948_2639095_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2639322_2639508_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2639932_2640160_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_015994246.1|2640201_2640567_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_001303051.1|2640856_2641420_+|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_001303049.1|2641416_2643078_+|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_000172999.1|2643141_2645079_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2645123_2645345_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2645290_2647792_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000125984.1|2647871_2648198_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|2648208_2648559_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573374.1|2648555_2649002_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2648998_2649343_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2649401_2650118_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2650123_2650498_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2650593_2650803_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064261924.1|2650855_2654098_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2654090_2654432_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179515.1|2654431_2655130_+|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	100.0	6.6e-134
WP_046671488.1|2655140_2655884_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_050439450.1|2655829_2656462_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_001304109.1|2656804_2657980_+	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_129137390.1|2657931_2660277_+	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001228304.1|2660344_2660944_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_024748516.1|2661095_2662409_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	7.2e-81
WP_001023474.1|2662410_2662680_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_001025672.1|2663706_2665032_-	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_000998048.1|2667696_2669235_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2669284_2669632_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2669628_2670009_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001303943.1|2670348_2670627_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001414184.1|2671054_2671201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303944.1|2671337_2671985_-	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001144877.1|2672168_2672759_+	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001310425.1|2674265_2674916_+	T3SS effector NleG family protein	NA	B6ETE1	Enterobacteria_phage	32.4	1.9e-26
WP_001500821.1|2676215_2677346_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	50.9	4.9e-102
WP_000113189.1|2677323_2677572_-	excisionase	NA	NA	NA	NA	NA
WP_000102181.1|2677636_2680081_-	exonuclease	NA	V5UQJ3	Shigella_phage	58.5	2.2e-176
WP_000092782.1|2680173_2680362_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450222.1|2680358_2680547_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000380314.1|2681034_2681187_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	2.5e-06
WP_000367559.1|2681356_2681746_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_024213789.1|2681848_2682124_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000693888.1|2682107_2682533_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095667.1|2682555_2683509_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000790456.1|2683515_2684256_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	85.6	7.8e-117
WP_000450888.1|2684285_2685056_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
WP_001118161.1|2685071_2685467_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_001302146.1|2685523_2685880_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_000063625.1|2685928_2686141_+	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_000137941.1|2686176_2686548_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000610379.1|2686544_2686907_+	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_001278450.1|2687022_2687127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|2687315_2687528_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
2687136:2687157	attR	CGATATGGGAATTCCCATATCG	NA	NA	NA	NA
WP_000998188.1|2687824_2687992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001304183.1|2688057_2688336_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000904137.1|2689399_2689774_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_000762904.1|2689770_2690592_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
WP_000917735.1|2690818_2691016_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000483497.1|2691166_2692225_+	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_024748518.1|2692716_2694567_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	99.2	0.0e+00
WP_024164617.1|2695005_2695221_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_000075112.1|2695220_2695718_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	99.4	9.9e-92
WP_001208680.1|2695934_2696120_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001303878.1|2696646_2696961_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000074669.1|2697042_2697267_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.5	2.7e-20
WP_001303046.1|2697308_2697674_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958387.1|2697962_2698526_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2698522_2700184_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000172999.1|2700247_2702185_+|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2702229_2702451_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2702396_2704898_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2704977_2705304_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2705313_2705664_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2705660_2706107_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2706103_2706448_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2706506_2707223_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2707228_2707603_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2707698_2707908_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_000212915.1|2707960_2711203_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_000807954.1|2711195_2711537_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152216.1|2711536_2712235_+|tail	phage minor tail protein L	tail	A0A0P0ZD77	Stx2-converting_phage	99.6	2.5e-133
WP_046671488.1|2712245_2712989_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	98.4	7.7e-149
WP_171879942.1|2712934_2713567_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	98.1	1.6e-102
WP_000514788.1|2713813_2717293_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_001230509.1|2717360_2717960_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_065763502.1|2718024_2719338_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.6	6.3e-77
WP_001023426.1|2719339_2719609_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	97.8	1.6e-43
WP_001079499.1|2725693_2726200_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056491.1|2726245_2726746_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2726831_2727011_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2727391_2728198_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2728197_2729391_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983855.1|2729402_2730764_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	39.8	7.3e-36
WP_000763503.1|2730764_2732360_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194607.1|2732359_2733922_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2734013_2734058_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2734195_2735077_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2735073_2735694_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|2735721_2737305_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2737517_2738390_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2738429_2739020_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2739016_2739775_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2739994_2741044_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 11
NZ_CP038402	Escherichia coli O157:H7 strain BB24-1 chromosome, complete genome	5609172	3011317	3090578	5609172	head,portal,capsid,terminase,tail,holin	Escherichia_phage(36.05%)	104	NA	NA
WP_000214712.1|3011317_3011521_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|3011556_3013017_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|3013105_3014389_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001120551.1|3014520_3014763_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|3014924_3015566_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|3015647_3016277_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|3016349_3016925_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|3017038_3017308_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_024748460.1|3017309_3018623_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.6	6.9e-76
WP_001230509.1|3018687_3019287_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.5	3.3e-110
WP_000514788.1|3019354_3022834_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.6	0.0e+00
WP_129137391.1|3023080_3023713_-|tail	tail assembly protein	tail	Q6H9T3	Enterobacteria_phage	95.7	3.5e-102
WP_001303043.1|3023658_3024402_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	95.5	3.7e-143
WP_001303044.1|3024412_3025111_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.7	8.1e-132
WP_000847298.1|3025110_3025440_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000533440.1|3028029_3028443_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000479046.1|3028469_3028892_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000235090.1|3028905_3029658_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000683063.1|3029665_3030061_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000975020.1|3030057_3030591_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000753016.1|3030605_3030959_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000158906.1|3030970_3031369_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3031410_3032436_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3032491_3032824_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3032833_3034153_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3034133_3035735_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3035731_3035938_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027230.1|3035934_3037860_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|3037834_3038380_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|3038766_3038991_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|3039072_3039387_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3039912_3040098_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|3040320_3040467_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|3040466_3041036_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3041306_3041840_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3041890_3042235_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_024164617.1|3042239_3042455_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	7.7e-33
WP_171879930.1|3042893_3044744_-	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	99.5	0.0e+00
WP_001302123.1|3045221_3045653_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|3046103_3046817_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|3046952_3047150_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|3047374_3047929_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|3047991_3048297_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|3048309_3049359_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|3049360_3049633_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|3049754_3050099_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|3050218_3050431_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|3050664_3051222_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|3051223_3051442_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|3051569_3051881_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|3051873_3052101_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|3052097_3052379_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|3052411_3053128_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|3053161_3053623_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_001262402.1|3053615_3054659_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000693878.1|3054727_3055153_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747948.1|3055136_3055379_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001416688.1|3055770_3056109_+	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000380316.1|3056402_3056555_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_000394548.1|3056566_3057205_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_001133037.1|3057205_3057415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|3057979_3058168_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199475.1|3058164_3058353_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102123.1|3058445_3059690_+	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_001120551.1|3060400_3060643_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001500906.1|3061554_3061851_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	1.3e-43
WP_000267292.1|3061930_3064432_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3064377_3064599_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3064643_3066581_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001303049.1|3066644_3068306_-|terminase	terminase large subunit	terminase	B6DZ98	Enterobacteria_phage	99.8	0.0e+00
WP_001303051.1|3068302_3068866_-|terminase	terminase small subunit	terminase	B6DZ97	Enterobacteria_phage	99.5	2.8e-90
WP_015994246.1|3069155_3069521_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	100.0	1.5e-65
WP_000095736.1|3069562_3069790_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3070214_3070400_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3070627_3070774_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3070773_3071343_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3071613_3072147_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3072197_3072542_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3072546_3072762_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|3072911_3074765_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|3075561_3076620_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|3076770_3076968_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3077209_3077740_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3077748_3078108_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3078120_3079167_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|3079168_3079447_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3079516_3079774_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|3079994_3080207_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3080485_3081244_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3081942_3082107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3082103_3082685_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|3082871_3083414_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3083325_3084366_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3084337_3084889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3084872_3085100_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3085176_3085584_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3085847_3086147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3086219_3086438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3086460_3086868_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3086845_3087079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3087072_3087240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3087637_3087826_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3087822_3088014_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048549.1|3088106_3090578_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.6	1.5e-58
>prophage 12
NZ_CP038402	Escherichia coli O157:H7 strain BB24-1 chromosome, complete genome	5609172	3138695	3232377	5609172	head,portal,capsid,integrase,lysis,holin,transposase,terminase,tail,tRNA,protease	Enterobacteria_phage(49.06%)	99	3161883:3161898	3226280:3226295
WP_001299679.1|3138695_3139952_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3140165_3140789_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3140788_3141640_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3141790_3142738_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3142862_3144542_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3144596_3144875_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3145152_3145737_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3145853_3146945_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001310261.1|3150763_3152683_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_001295616.1|3153389_3154001_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3154100_3155015_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3155110_3156847_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_171876993.1|3157004_3158218_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.3	8.4e-169
WP_000197865.1|3158555_3159626_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3159635_3160934_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3161296_3162829_+	SpoVR family protein	NA	NA	NA	NA	NA
3161883:3161898	attL	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_000234823.1|3162880_3163600_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3163821_3165363_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3165508_3166039_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3166084_3167353_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3167352_3167772_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3168144_3169056_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3169262_3169724_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3169800_3170460_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3170531_3170825_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3170836_3170995_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3171065_3171467_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3171569_3171938_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3172457_3173153_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3173176_3173989_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3173992_3174259_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3175490_3176075_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3176573_3177527_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3177713_3179198_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3179500_3181039_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3181088_3181436_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3181432_3181813_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3181888_3182137_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3182193_3182862_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3183359_3183542_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3183620_3184121_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3184157_3184664_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3184682_3185573_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_000885630.1|3185692_3186274_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3186273_3189189_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3189253_3189853_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3189919_3193318_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3193378_3194011_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3193947_3194691_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3194696_3195395_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3195394_3195724_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3195720_3198270_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3198262_3198697_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3198678_3199101_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3199116_3199857_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3199864_3200260_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000975100.1|3200256_3200835_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.3e-79
WP_000752995.1|3200846_3201200_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3201211_3201610_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063233.1|3201651_3202677_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.5	5.6e-190
WP_001295978.1|3202731_3203064_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3203073_3204393_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3204373_3205975_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3205971_3206178_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3206174_3208100_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3208074_3208620_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3209008_3209203_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3209367_3209574_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3209859_3210270_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3210561_3210855_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3210945_3211128_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3211344_3211821_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3211807_3212113_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3212434_3213124_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3213120_3213261_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3213257_3213620_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3213616_3213907_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3213899_3214070_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3214069_3214525_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3215026_3216553_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3216610_3216733_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3216797_3217130_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3217197_3217500_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3217496_3218198_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088657.1|3219122_3219359_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3219348_3220491_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3220604_3221855_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3222026_3222680_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3222689_3223151_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3223204_3224311_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3224346_3224988_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3224991_3226362_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
3226280:3226295	attR	AAGAAGAGAAAGCCCG	NA	NA	NA	NA
WP_001265474.1|3226530_3227202_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3227201_3228662_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3229262_3229544_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3229799_3230342_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3230547_3230961_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3230973_3231309_-|head	head decoration protein	head	NA	NA	NA	NA
WP_000907465.1|3231321_3232377_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 13
NZ_CP038402	Escherichia coli O157:H7 strain BB24-1 chromosome, complete genome	5609172	3238469	3297120	5609172	head,portal,capsid,integrase,transposase,terminase,tail,holin	Enterobacteria_phage(26.32%)	72	3282687:3282707	3303777:3303797
WP_032174463.1|3238469_3239687_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.8	6.1e-127
WP_162829200.1|3239685_3240898_+|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	100.0	1.5e-170
WP_001301987.1|3241260_3242382_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3242430_3243657_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3243906_3245043_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3245026_3245890_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3246253_3247615_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3247675_3247951_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3250259_3253661_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3254251_3256600_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3256619_3256709_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3256721_3256958_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3256903_3257641_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3257694_3258573_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3258875_3258986_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3259095_3259350_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3259366_3260065_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807954.1|3260064_3260406_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_000212915.1|3260398_3263641_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	99.4	0.0e+00
WP_001453698.1|3263693_3263903_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3263998_3264373_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3264378_3265095_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|3265153_3265498_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3265494_3265941_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3265937_3266288_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3266297_3266624_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3266703_3269205_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3269150_3269372_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000172999.1|3269416_3271354_-|capsid	phage major capsid protein	capsid	B6DZ99	Enterobacteria_phage	100.0	0.0e+00
WP_001304106.1|3271417_3273079_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958387.1|3273075_3273639_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|3273931_3274297_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001302977.1|3274338_3274524_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3274653_3274794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3275150_3275375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3275439_3275646_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3275873_3276020_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3276019_3276589_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3276859_3277393_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3277443_3277788_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3277792_3278008_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3278083_3278353_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3278390_3278573_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023147.1|3278720_3280658_-	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	76.6	4.8e-291
WP_000216629.1|3280972_3281140_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3281736_3282558_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3282554_3282929_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3282687:3282707	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265159.1|3282941_3283991_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001341388.1|3283992_3284271_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3284438_3284651_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3284839_3284944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3285059_3285647_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3285649_3285841_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3285842_3286280_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3286266_3286584_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3286537_3286855_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3286844_3287147_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3287143_3287425_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3287457_3288174_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3288207_3288750_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3288661_3289699_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693962.1|3289767_3290193_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3290176_3290500_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3290624_3291101_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3291416_3291569_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3291683_3292199_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3292331_3292721_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3292782_3293052_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3293020_3294139_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3294305_3295100_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3295096_3296143_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3296298_3297120_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3303777:3303797	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 14
NZ_CP038402	Escherichia coli O157:H7 strain BB24-1 chromosome, complete genome	5609172	3548097	3600995	5609172	head,portal,capsid,integrase,holin,transposase,terminase,tail,protease	Escherichia_phage(29.27%)	60	3550032:3550047	3602760:3602775
WP_000003653.1|3548097_3548685_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3548681_3549389_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3549407_3551201_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3550032:3550047	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3551197_3552316_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023407.1|3554308_3554578_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_000268855.1|3554579_3555893_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	2.0e-83
WP_001230444.1|3555957_3556557_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_000515109.1|3556624_3560098_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_000649827.1|3560231_3560759_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	55.8	4.8e-52
WP_050546863.1|3560949_3561582_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3561527_3562271_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001302968.1|3562281_3562980_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	2.9e-129
WP_000847298.1|3562979_3563309_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_000082473.1|3563305_3565885_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	79.9	0.0e+00
WP_000533402.1|3565865_3566279_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3566305_3566737_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3566750_3567491_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3567472_3567739_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3567796_3568144_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3568180_3569686_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000831796.1|3569675_3571268_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3571264_3571471_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001302857.1|3571454_3573383_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000235436.1|3573354_3573864_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000411791.1|3574614_3574821_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3575076_3575349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3575508_3576042_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3576262_3576376_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3576597_3576783_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3577310_3577625_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3577829_3579043_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|3579218_3581069_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3581835_3582549_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3583169_3583988_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3584139_3584511_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3584500_3584872_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3584884_3585934_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3585935_3586214_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3586381_3586537_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3586638_3586776_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3587141_3587915_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3588266_3588680_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3588695_3589466_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3589487_3590234_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3590240_3591332_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3591410_3591866_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3592072_3592498_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3592481_3592754_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3592862_3593264_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3593291_3593483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3593482_3593770_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3594047_3594203_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3594344_3594734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3594920_3595106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3595679_3595868_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3595864_3596056_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3596149_3598621_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3598688_3598931_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3598908_3599928_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3600335_3600995_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3602760:3602775	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 15
NZ_CP038402	Escherichia coli O157:H7 strain BB24-1 chromosome, complete genome	5609172	3720203	3780015	5609172	protease,integrase,transposase	Moraxella_phage(20.0%)	50	3725990:3726005	3778261:3778276
WP_000998072.1|3720203_3721742_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.2	2.7e-297
WP_000333617.1|3722247_3722475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000885242.1|3722509_3723013_-	CdiI family contact-dependent growth inhibition immunity protein	NA	NA	NA	NA	NA
WP_000017595.1|3724180_3724702_-	DUF2569 domain-containing protein	NA	NA	NA	NA	NA
WP_000767171.1|3724965_3725241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410312.1|3725209_3725818_-	hypothetical protein	NA	NA	NA	NA	NA
3725990:3726005	attL	CTCAATGGCTTTATCC	NA	NA	NA	NA
WP_000792318.1|3726048_3726303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001043260.1|3728165_3728981_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_000251875.1|3729067_3729370_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|3729263_3729515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000480968.1|3729753_3730590_-	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001082319.1|3730589_3731393_-	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_001303007.1|3731678_3732887_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.5	1.5e-234
WP_000599533.1|3733252_3734458_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|3734901_3735222_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460649.1|3735214_3735601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|3735608_3736295_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|3736272_3736896_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_001089072.1|3736977_3738183_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000428546.1|3738295_3738889_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_001303003.1|3739402_3740611_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	99.8	2.0e-234
WP_000015617.1|3740714_3740852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000765181.1|3740890_3741121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000266539.1|3741117_3741606_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000990243.1|3741837_3742293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303001.1|3742297_3742807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000877779.1|3742829_3743087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000118523.1|3744464_3744728_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001258566.1|3744724_3745579_-	VENN motif pre-toxin domain-containing protein	NA	NA	NA	NA	NA
WP_000832132.1|3745648_3746062_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912479.1|3746071_3746521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003689.1|3746703_3747081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001477171.1|3747132_3747786_-	DNA/RNA non-specific endonuclease	NA	NA	NA	NA	NA
WP_001449592.1|3748295_3748739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001310368.1|3749151_3750009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001449593.1|3750005_3750206_-	VENN motif pre-toxin domain-containing protein	NA	NA	NA	NA	NA
WP_000779468.1|3750438_3750978_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001075571.1|3750977_3760607_-	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	33.8	3.2e-29
WP_001200020.1|3760619_3762386_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.5	6.0e-22
WP_000090034.1|3762846_3763776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081278.1|3763765_3764506_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_000273844.1|3765912_3768333_+	NTPase	NA	NA	NA	NA	NA
WP_000282071.1|3768637_3769201_-	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000335694.1|3770175_3771609_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_000579535.1|3771827_3772025_-	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_014639577.1|3772251_3772548_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000271854.1|3773660_3775478_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000279872.1|3775665_3776868_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.4	2.9e-44
WP_000934041.1|3777387_3779664_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
3778261:3778276	attR	CTCAATGGCTTTATCC	NA	NA	NA	NA
WP_000520781.1|3779694_3780015_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
>prophage 16
NZ_CP038402	Escherichia coli O157:H7 strain BB24-1 chromosome, complete genome	5609172	3904700	3942795	5609172	portal,protease,integrase,lysis,tail,holin	Enterobacteria_phage(52.5%)	47	3904285:3904299	3942869:3942883
3904285:3904299	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3904700_3905399_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3905629_3906511_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3906679_3906841_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3907337_3908357_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3908390_3909371_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3909547_3909817_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3909818_3911135_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3911194_3911794_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000090841.1|3915338_3915947_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3915883_3916627_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3916632_3917331_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3917340_3917670_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3917669_3920735_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3920706_3921036_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3921044_3921431_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3921491_3922235_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3922245_3922647_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3922643_3923222_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3923233_3923509_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3923501_3923825_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136598.1|3923911_3925939_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_127446149.1|3925883_3926219_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3926340_3927465_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3927392_3927605_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_001139679.1|3930868_3931021_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3931008_3931476_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3931472_3931970_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3931969_3932185_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3932327_3932726_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3932806_3932965_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3933050_3933794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3933977_3934667_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3934681_3934804_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3935141_3936101_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028857.1|3936312_3936978_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.1	9.4e-130
WP_001108055.1|3936974_3937595_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3937587_3937758_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3937754_3937937_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3938634_3939315_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3939311_3939494_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3939466_3939658_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3939668_3939950_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3940048_3940270_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3940480_3941083_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3941325_3941493_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3941532_3941751_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3942024_3942795_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3942869:3942883	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 17
NZ_CP038402	Escherichia coli O157:H7 strain BB24-1 chromosome, complete genome	5609172	4483384	4562588	5609172	head,portal,capsid,integrase,lysis,holin,transposase,terminase,plate,tail,protease	Shigella_phage(44.07%)	95	4520502:4520548	4558686:4558732
WP_000998048.1|4483384_4484923_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|4484972_4485320_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|4485316_4485697_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000803998.1|4485960_4486224_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|4486223_4486364_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147284.1|4486433_4486625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000389022.1|4487449_4487992_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730972.1|4488066_4488654_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716386.1|4488711_4489380_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131063.1|4489405_4491931_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001265657.1|4491920_4493564_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001301550.1|4493532_4494243_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|4494555_4494885_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|4495132_4495747_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070685.1|4496164_4496854_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643340.1|4496850_4497807_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667043.1|4497803_4500002_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.7	1.5e-38
WP_000121344.1|4500011_4500968_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000171065.1|4501146_4502274_-	MFS transporter	NA	NA	NA	NA	NA
WP_001303808.1|4502415_4503474_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_010917758.1|4503719_4504622_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001301751.1|4505324_4505603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000361969.1|4505769_4506492_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000687183.1|4506590_4507490_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000205213.1|4508165_4509122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000016225.1|4509254_4511588_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	72.5	0.0e+00
WP_000562750.1|4511601_4511925_-	DUF5375 family protein	NA	NA	NA	NA	NA
WP_001071227.1|4511924_4512146_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000973389.1|4512142_4512700_-	ash family protein	NA	Q7M2A7	Enterobacteria_phage	64.9	9.3e-30
WP_001244581.1|4512696_4512957_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	65.1	1.3e-23
WP_000154958.1|4513890_4514643_+	septation initiation protein	NA	NA	NA	NA	NA
WP_000968317.1|4514639_4515191_+	Polarity suppression protein	NA	NA	NA	NA	NA
WP_001185340.1|4515196_4515469_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000350115.1|4515878_4516445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000647284.1|4516444_4517035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000999326.1|4517065_4517698_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000251694.1|4517690_4518149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303996.1|4518148_4518766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000082144.1|4518738_4519155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130487.1|4519158_4520340_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
4520502:4520548	attL	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000246059.1|4521302_4522046_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355484.1|4522870_4523644_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	38.5	2.4e-36
WP_000905124.1|4523704_4524259_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	87.8	2.8e-87
WP_001145350.1|4524289_4524700_+	hypothetical protein	NA	A0A0F7LBW5	Escherichia_phage	97.6	6.5e-65
WP_001008234.1|4524720_4525164_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	100.0	2.2e-82
WP_000368084.1|4525135_4525738_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	90.5	1.2e-99
WP_000554706.1|4525737_4526508_-|tail	tail fiber protein	tail	U5P0I1	Shigella_phage	94.4	2.7e-51
WP_000383550.1|4526511_4527096_-	YmfQ family protein	NA	O22003	Shigella_phage	98.5	7.8e-112
WP_000785302.1|4527086_4528145_-|plate	baseplate J/gp47 family protein	plate	Q8SBG4	Shigella_phage	98.9	1.6e-200
WP_000424732.1|4528131_4528557_-	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_001259066.1|4528556_4529105_-|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	97.8	3.6e-95
WP_000219910.1|4530164_4531493_-	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	98.9	2.5e-246
WP_000807197.1|4531553_4533389_-|tail	phage tail tape measure protein	tail	Q8SBG9	Shigella_phage	99.7	1.5e-307
WP_000661054.1|4533530_4533800_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	100.0	3.5e-43
WP_000090993.1|4533799_4534156_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_000155727.1|4534155_4535652_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	98.6	4.2e-271
WP_000497751.1|4535635_4535806_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	100.0	9.3e-26
WP_000779288.1|4535814_4536375_-	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	99.5	6.8e-105
WP_000224836.1|4536371_4536878_-	hypothetical protein	NA	Q8SBH5	Shigella_phage	92.9	2.9e-83
WP_000702395.1|4536852_4537263_-|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	93.4	5.7e-69
WP_000924828.1|4537259_4537583_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	100.0	3.5e-53
WP_000766100.1|4537661_4538891_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	99.3	7.6e-226
WP_000999805.1|4538901_4539504_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	100.0	6.8e-111
WP_000923141.1|4539496_4540723_-|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	98.8	4.1e-240
WP_000838374.1|4540712_4540874_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128484532.1|4540870_4542367_-|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	98.8	5.3e-290
WP_000929189.1|4542600_4543095_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	98.8	1.9e-87
WP_001135207.1|4543220_4543571_-	HNH endonuclease	NA	M1FQV2	Enterobacteria_phage	98.3	2.1e-64
WP_000738423.1|4544096_4544390_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	91.8	2.0e-44
WP_001228695.1|4544480_4544663_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.3	2.9e-17
WP_001197766.1|4544879_4545356_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	96.2	3.0e-85
WP_001120501.1|4545359_4545695_-|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	99.1	2.0e-59
WP_001449601.1|4545831_4546125_-	site-specific DNA-methyltransferase	NA	Q8SBE2	Shigella_phage	90.7	1.5e-42
WP_001310393.1|4546403_4546637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000484663.1|4546780_4547320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001008431.1|4547533_4548286_-	antitermination protein	NA	Q8SBE4	Shigella_phage	98.0	1.7e-135
WP_001360050.1|4548299_4549289_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061444.1|4549296_4550106_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_000767113.1|4550125_4550515_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_000210141.1|4550511_4550838_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	97.2	3.9e-52
WP_001303054.1|4550834_4551488_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	2.1e-126
WP_072141203.1|4551487_4551982_-	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	98.1	1.6e-86
WP_000104949.1|4551978_4552920_-	helix-turn-helix domain-containing protein	NA	S5FM81	Shigella_phage	99.7	3.3e-144
WP_001250269.1|4552909_4553089_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515845.1|4553264_4553816_-	protein YmfL	NA	S5FXP0	Shigella_phage	99.5	3.4e-101
WP_001191674.1|4553808_4554069_-	helix-turn-helix transcriptional regulator	NA	S5FKP1	Shigella_phage	100.0	7.1e-41
WP_001020634.1|4554166_4554859_+	helix-turn-helix transcriptional regulator	NA	S5FUZ3	Shigella_phage	100.0	1.0e-126
WP_000917896.1|4555114_4555411_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	100.0	1.2e-52
WP_000008235.1|4556087_4556624_+	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_001242749.1|4556614_4556977_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_000206732.1|4556976_4557282_+	hypothetical protein	NA	U5P0J0	Shigella_phage	100.0	6.8e-51
WP_000051887.1|4557508_4558672_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893282.1|4558876_4560130_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
4558686:4558732	attR	ATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|4560141_4561245_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4561532_4562588_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 18
NZ_CP038402	Escherichia coli O157:H7 strain BB24-1 chromosome, complete genome	5609172	4581374	4654624	5609172	plate,tRNA,protease,transposase	uncultured_Caudovirales_phage(20.0%)	60	NA	NA
WP_000027427.1|4581374_4582547_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4582627_4582813_+	protein YncO	NA	NA	NA	NA	NA
WP_000247943.1|4582727_4582991_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000509142.1|4583192_4587416_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	2.4e-21
WP_000103335.1|4587491_4589633_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_001142958.1|4589842_4590361_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4591057_4591558_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4591592_4591817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000056994.1|4591867_4593259_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4593349_4593763_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4593766_4595617_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4595580_4596663_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001113707.1|4596687_4597968_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080153.1|4597964_4598489_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246433.1|4598491_4599823_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_000343292.1|4599827_4600589_+	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_171879934.1|4600597_4603387_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	28.3	1.1e-81
WP_000088854.1|4603383_4604127_+	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_001240517.1|4604131_4605544_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_001310198.1|4605680_4609115_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001087743.1|4609125_4610535_+	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001284958.1|4610500_4610980_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000002701.1|4611000_4611222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000964776.1|4611300_4611897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302684.1|4611899_4612349_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_001301976.1|4614163_4614895_-	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.5	9.9e-40
WP_000917883.1|4614959_4615427_+	ribonuclease HI	NA	J9Q745	Salmonella_phage	58.7	1.0e-50
WP_001301721.1|4615423_4616146_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001052715.1|4616179_4616935_+	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_000644686.1|4617006_4618365_+	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_000211693.1|4618412_4619183_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001230983.1|4619260_4620061_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000648586.1|4620301_4621216_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000997018.1|4621212_4622016_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.6	5.4e-39
WP_001140187.1|4627775_4628351_-	D-glycero-beta-D-manno-heptose 1,7-bisphosphate 7-phosphatase	NA	NA	NA	NA	NA
WP_000593994.1|4628538_4629570_+	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	40.2	7.2e-36
WP_001294606.1|4629562_4630216_+	methionine ABC transporter permease MetI	NA	NA	NA	NA	NA
WP_000874227.1|4630255_4631071_+	methionine ABC transporter substrate-binding lipoprotein MetQ	NA	NA	NA	NA	NA
WP_001202328.1|4631188_4631593_+	Rcs stress response system protein RcsF	NA	NA	NA	NA	NA
WP_000094000.1|4631589_4632297_+|tRNA	tRNA (N6-threonylcarbamoyladenosine(37)-N6)-methyltransferase TrmO	tRNA	NA	NA	NA	NA
WP_001260720.1|4632407_4634126_+|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001302206.1|4634178_4635003_+	YaeF family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_000239181.1|4635202_4635913_-	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_000635546.1|4635926_4636337_-|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001185286.1|4636333_4636879_-	YaeQ family protein	NA	NA	NA	NA	NA
WP_000417058.1|4637044_4637245_+	YaeP family protein	NA	NA	NA	NA	NA
WP_000062312.1|4637231_4637492_+	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000176537.1|4637544_4638840_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000901098.1|4638904_4639294_-	VOC family protein	NA	NA	NA	NA	NA
WP_001020954.1|4639350_4641492_-	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000055741.1|4641590_4642550_-	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001294772.1|4642562_4646045_-	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.8e-209
WP_000569419.1|4646081_4646678_-	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	3.9e-26
WP_000139661.1|4646674_4647823_-	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000565963.1|4647822_4648611_-	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|4648614_4649070_-	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_001139282.1|4649174_4650200_-	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000758956.1|4650203_4650689_-	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001240896.1|4650809_4653242_-	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_001295561.1|4653271_4654624_-|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
>prophage 19
NZ_CP038402	Escherichia coli O157:H7 strain BB24-1 chromosome, complete genome	5609172	4994591	5007166	5609172	integrase	Enterobacteria_phage(81.82%)	15	4993625:4993640	5012119:5012134
4993625:4993640	attL	TTTCGATGAACAGCAC	NA	NA	NA	NA
WP_001301682.1|4994591_4995419_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	40.4	4.3e-55
WP_044815386.1|4995636_4995831_-	hypothetical protein	NA	Q38404	Enterobacteria_phage	100.0	1.5e-24
WP_000783684.1|4996186_4998520_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	99.1	0.0e+00
WP_000856729.1|4998534_4998855_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459287.1|4998990_4999446_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	98.2	4.7e-64
WP_001244670.1|4999438_4999726_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	96.8	2.5e-47
WP_171879939.1|4999718_5000309_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	89.6	7.7e-59
WP_001149160.1|5000305_5000572_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_001283041.1|5001122_5001857_+	hypothetical protein	NA	Q7M2A2	Enterobacteria_phage	97.5	2.2e-127
WP_000638631.1|5001853_5002354_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_000446145.1|5002427_5003000_+	Polarity suppression protein	NA	Q7M2A1	Enterobacteria_phage	96.2	1.4e-94
WP_000095622.1|5003325_5004570_+	DNA cytosine methyltransferase	NA	F2Y148	Organic_Lake_phycodnavirus	31.1	9.3e-46
WP_001453880.1|5004607_5005342_-	type II restriction endonuclease	NA	NA	NA	NA	NA
WP_000936844.1|5005418_5005724_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000772662.1|5005891_5007166_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	41.0	4.1e-73
5012119:5012134	attR	TTTCGATGAACAGCAC	NA	NA	NA	NA
>prophage 20
NZ_CP038402	Escherichia coli O157:H7 strain BB24-1 chromosome, complete genome	5609172	5039586	5098614	5609172	protease,transposase	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|5039586_5040939_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|5041032_5041584_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|5041739_5043113_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|5043288_5044287_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|5044319_5045315_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|5045301_5046324_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|5046337_5047840_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|5047979_5048936_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|5049245_5049776_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|5049855_5050206_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|5050199_5050451_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|5050662_5051004_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_171879940.1|5051006_5054786_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|5054782_5056516_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|5056721_5057360_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|5057682_5059026_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|5059121_5059328_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175296.1|5059652_5060207_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|5060269_5061208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|5061419_5062160_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589488.1|5062349_5064293_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_001302935.1|5064410_5064791_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|5064879_5065740_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|5065847_5066813_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|5066920_5067583_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|5067627_5069040_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|5069348_5069969_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|5070186_5070825_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|5070959_5072168_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|5072175_5072607_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|5073229_5074024_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|5074094_5074544_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|5074585_5074813_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|5074817_5075132_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|5075138_5075534_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|5075860_5076136_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|5076264_5076951_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|5076950_5077805_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|5077814_5078465_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|5078478_5078943_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|5078952_5079258_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|5079273_5080671_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|5082197_5082953_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|5082949_5083699_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|5083880_5084210_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|5084358_5084634_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|5084750_5086376_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|5086459_5087623_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|5087625_5088264_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|5088273_5088672_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|5088689_5089349_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|5089399_5090098_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|5090116_5090518_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|5090644_5091376_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|5091556_5093998_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|5094036_5094462_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|5094666_5095965_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|5096068_5096266_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|5096347_5097352_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|5097354_5098614_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 21
NZ_CP038402	Escherichia coli O157:H7 strain BB24-1 chromosome, complete genome	5609172	5237619	5252284	5609172	tail,tRNA,integrase	Enterobacteria_phage(43.75%)	19	5233460:5233475	5250989:5251004
5233460:5233475	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5237619_5239035_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5239117_5240101_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5240266_5240509_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5240642_5241680_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5241768_5242866_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5242927_5243176_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5243336_5243978_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5244059_5244689_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5244761_5245334_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5245445_5245715_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_000268945.1|5245716_5247030_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.2	2.5e-81
WP_001230514.1|5247094_5247694_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5249015_5249552_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5249542_5249893_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5249889_5250174_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5250509_5250707_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5251051_5251333_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5250989:5251004	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5251380_5251554_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5251750_5252284_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP038404	Escherichia coli O157:H7 strain BB24-1 plasmid pBB24-1, complete sequence	95604	24314	87069	95604	transposase,integrase,protease	Macacine_betaherpesvirus(26.32%)	56	11888:11903	53423:53438
11888:11903	attL	GTGTTTTTCTGGCCGG	NA	NA	NA	NA
WP_001066920.1|24314_25055_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|25339_26317_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|26724_26925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|26921_27542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|27538_28222_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|28680_28899_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|28900_29206_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|29206_30013_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829202.1|30735_31949_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000852148.1|32024_32780_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	99.6	1.1e-142
WP_000772446.1|33367_34534_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|34533_35505_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|36113_37016_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|37019_37325_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|37401_38085_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
WP_001104869.1|38085_38307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358893.1|38200_38755_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001310284.1|39449_40022_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_010891293.1|40117_40420_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271685.1|40466_40889_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027495.1|40885_41077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303399.1|41195_41585_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|42072_42303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199442.1|42354_43716_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001302171.1|43762_44326_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
WP_001492078.1|44411_44855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547965.1|44924_45131_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290823.1|45156_45609_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_000005995.1|45665_45899_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117168.1|45964_47923_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000845908.1|47977_48412_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276250.1|48408_49170_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001302184.1|49401_49560_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001453090.1|51782_52214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581718.1|53972_63482_+	toxin B	NA	NA	NA	NA	NA
53423:53438	attR	CCGGCCAGAAAAACAC	NA	NA	NA	NA
WP_001171554.1|64476_64857_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|64853_65201_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|65250_66789_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000205767.1|68190_68937_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.3	1.1e-09
WP_000704522.1|68995_69856_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000840472.1|69958_70519_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001302189.1|70651_70864_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233853.1|71108_71570_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	5.5e-20
WP_001302200.1|71615_71825_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766796.1|71862_72201_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083831.1|72440_72695_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001370046.1|72930_73005_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130945.1|72997_73855_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001178089.1|74766_75051_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421248.1|75050_75326_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001105064.1|75420_75627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302179.1|76967_77153_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000592771.1|77329_79540_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|79583_79973_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_001034097.1|81198_85101_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	5.5e-238
WP_000998048.1|85530_87069_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
