The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038421	Escherichia coli O157:H7 strain 7636 chromosome, complete genome	5458638	1221129	1244666	5458638	tail,transposase,holin,integrase	Enterobacteria_phage(33.33%)	27	1212775:1212789	1245537:1245551
1212775:1212789	attL	AAATCAGCGAATAAA	NA	NA	NA	NA
WP_000540864.1|1221129_1222335_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_000428092.1|1222336_1223650_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001059531.1|1223646_1225278_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_001052051.1|1225278_1225677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000361847.1|1225774_1226188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064234917.1|1226583_1227870_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001418122.1|1227945_1228281_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_001254939.1|1228283_1229039_-|transposase	IS30 family transposase	transposase	NA	NA	NA	NA
WP_001108081.1|1229374_1229941_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_001223948.1|1229915_1230527_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1230523_1231189_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1231185_1231809_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1232061_1232805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1232890_1233058_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143068.1|1233465_1235319_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000284517.1|1235468_1235684_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1235688_1236033_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1236389_1236770_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|1236766_1237114_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_162829202.1|1237614_1238828_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001023396.1|1239045_1239315_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_000442132.1|1239475_1239898_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	97.0	5.7e-72
WP_001301665.1|1240027_1241086_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_001144077.1|1241164_1241815_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1241997_1242588_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1243089_1243338_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1244183_1244666_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
1245537:1245551	attR	AAATCAGCGAATAAA	NA	NA	NA	NA
>prophage 2
NZ_CP038421	Escherichia coli O157:H7 strain 7636 chromosome, complete genome	5458638	1522250	1527676	5458638	integrase	Enterobacteria_phage(50.0%)	6	1511238:1511254	1529872:1529888
1511238:1511254	attL	GGTTGTCGATACCAATA	NA	NA	NA	NA
WP_000950857.1|1522250_1522820_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1522819_1523287_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1523273_1523954_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1523963_1525100_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1525274_1526432_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
WP_000368131.1|1526743_1527676_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1529872:1529888	attR	GGTTGTCGATACCAATA	NA	NA	NA	NA
>prophage 3
NZ_CP038421	Escherichia coli O157:H7 strain 7636 chromosome, complete genome	5458638	1773366	1850575	5458638	tRNA,lysis,terminase,portal,holin,tail,capsid,head	Stx2-converting_phage(42.67%)	86	NA	NA
WP_000569336.1|1773366_1774293_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1774297_1775029_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1775009_1775117_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1775176_1775878_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1775898_1777185_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1777218_1777473_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1777491_1777626_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1777629_1777872_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1777959_1778322_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1778318_1778675_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1779008_1779185_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1779186_1780134_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1780130_1780352_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1780450_1780732_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1780742_1780934_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1780906_1781089_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1781088_1781766_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1781762_1782548_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1782553_1782850_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1782925_1783216_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_077828126.1|1783719_1785327_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.3	1.1e-94
WP_000712399.1|1785433_1786126_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182876.1|1786489_1787029_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000147884.1|1787025_1788045_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	9.7e-110
WP_000788906.1|1788041_1788743_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145928.1|1788739_1789024_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_001481254.1|1789251_1789449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|1789492_1789774_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141214.1|1789864_1789966_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053021.1|1789962_1790418_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224907.1|1790417_1790588_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1790580_1790871_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|1790867_1791230_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1791226_1791367_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1791452_1791887_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_000691354.1|1792393_1793341_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1793350_1793620_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_064234927.1|1794119_1796057_+	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	97.2	0.0e+00
WP_000143464.1|1796193_1796373_+	DUF1378 family protein	NA	G9L6J3	Escherichia_phage	100.0	1.3e-25
WP_001290231.1|1796413_1796686_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|1796762_1796978_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001135289.1|1796977_1797475_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000092313.1|1797471_1797909_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_000839224.1|1798111_1798609_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1798605_1798863_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|1799325_1799553_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_000279809.1|1799594_1799960_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	98.3	5.8e-65
WP_000958396.1|1800251_1800815_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_001301491.1|1800811_1802473_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|1802536_1804474_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|1804518_1804740_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_072618968.1|1804685_1807751_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	84.1	0.0e+00
WP_000125988.1|1807753_1808080_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|1808089_1808440_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|1808436_1808883_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|1808879_1809224_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|1809289_1810006_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|1810020_1810395_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|1810490_1810700_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|1810747_1813990_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|1813982_1814324_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152183.1|1814323_1815022_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	6.6e-134
WP_001302649.1|1815038_1815359_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|1815466_1815640_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|1815710_1816634_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|1816687_1817425_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_050546863.1|1817370_1818003_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_064234929.1|1818262_1821742_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.6	0.0e+00
WP_001230508.1|1821808_1822408_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000268876.1|1822472_1823786_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	3.3e-78
WP_001023445.1|1823787_1824057_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
WP_072142879.1|1824217_1824634_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1824715_1825357_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1825518_1825767_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1826281_1827967_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1827963_1828683_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1828729_1829200_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1829241_1829703_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1829827_1831831_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1831827_1832964_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1832956_1833688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1833706_1835236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1835246_1836335_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1837575_1837893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1837954_1841584_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_001301615.1|1848541_1850575_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.4e-54
>prophage 4
NZ_CP038421	Escherichia coli O157:H7 strain 7636 chromosome, complete genome	5458638	1876206	1914273	5458638	tRNA,lysis,plate,terminase,portal,holin,tail,capsid,head,integrase	Escherichia_phage(62.22%)	50	1877987:1878014	1909947:1909974
WP_000807362.1|1876206_1877106_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1877511_1877829_+	hypothetical protein	NA	NA	NA	NA	NA
1877987:1878014	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985260.1|1878093_1879107_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|1879222_1879522_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1879643_1879919_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|1879929_1880100_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217670.1|1880096_1880597_+	hypothetical protein	NA	M1SV55	Escherichia_phage	100.0	2.6e-92
WP_000557698.1|1880660_1880885_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277898.1|1880884_1881184_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113265.1|1881186_1881411_+	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_000027664.1|1881407_1881683_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268574.1|1881672_1883955_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000063136.1|1884044_1885268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|1885314_1885767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000844437.1|1885766_1887734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038161.1|1888051_1889086_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156848.1|1889085_1890858_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_001085952.1|1891031_1891886_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_001248594.1|1891944_1893018_+|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_000203418.1|1893021_1893765_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_000988633.1|1893864_1894374_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846406.1|1894373_1894577_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123123.1|1894580_1894862_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1894861_1895359_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736555.1|1895373_1895799_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_000040644.1|1895786_1896212_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_001300730.1|1896183_1896357_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917144.1|1896319_1896787_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001001809.1|1896779_1897232_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.0	2.0e-75
WP_001093728.1|1897298_1897934_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_000127154.1|1897930_1898278_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001121479.1|1898282_1899191_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_001285352.1|1899183_1899795_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_000217053.1|1899791_1900991_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	98.2	1.0e-214
WP_001008233.1|1901011_1901455_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001057694.1|1901426_1902029_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_000983068.1|1902028_1902562_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	98.3	4.8e-100
WP_000905094.1|1902589_1903183_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001684736.1|1903242_1904433_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	2.0e-223
WP_001251408.1|1904445_1904964_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1905020_1905296_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001496926.1|1905328_1905448_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_000069957.1|1905440_1907888_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_000978913.1|1907902_1908382_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000882933.1|1908381_1909545_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000468308.1|1909626_1909845_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1910118_1911480_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
1909947:1909974	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001301848.1|1911627_1911960_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|1912150_1912873_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|1912869_1914273_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 5
NZ_CP038421	Escherichia coli O157:H7 strain 7636 chromosome, complete genome	5458638	1997497	2073508	5458638	lysis,protease,terminase,holin,capsid,portal,tail,transposase,head,integrase	Stx2-converting_phage(55.56%)	95	1988448:1988462	2003866:2003880
1988448:1988462	attL	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_001007946.1|1997497_1998676_+|integrase	site-specific integrase	integrase	A0A0P0ZCE7	Stx2-converting_phage	100.0	1.1e-232
WP_000132739.1|1998656_1998848_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|1998925_1999270_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|1999457_1999808_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_001289930.1|2000669_2001617_-	ead/Ea22-like family protein	NA	A0A0P0ZBW7	Stx2-converting_phage	100.0	4.7e-183
WP_000763383.1|2001613_2001835_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|2001933_2002215_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548528.1|2002225_2002417_-	DUF1382 family protein	NA	A0A0P0ZC60	Stx2-converting_phage	100.0	5.6e-27
WP_000682306.1|2002389_2002572_-	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	100.0	4.3e-29
WP_000186812.1|2002568_2003249_-	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	100.0	1.6e-132
WP_001302855.1|2003245_2004031_-	phage recombination protein Bet	NA	A0A0N7BTT9	Escherichia_phage	100.0	6.3e-149
2003866:2003880	attR	GGCCGTACTGGTTGG	NA	NA	NA	NA
WP_000995486.1|2004036_2004333_-	host-nuclease inhibitor protein Gam	NA	A0A0N7BTR9	Escherichia_phage	100.0	3.3e-50
WP_000372937.1|2004407_2004551_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2004519_2004684_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|2004756_2005125_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|2005307_2005559_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|2005617_2005890_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|2005867_2006050_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|2006618_2007140_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|2007641_2008337_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|2008411_2008627_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|2008768_2009065_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|2009097_2009259_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|2009245_2010067_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|2010063_2011440_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_162829202.1|2011534_2012748_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001220560.1|2012831_2013443_+	HNH endonuclease	NA	A0A0P0ZBS0	Stx2-converting_phage	100.0	5.6e-113
WP_001442362.1|2013906_2014239_+	hypothetical protein	NA	A0A0P0ZCZ1	Stx2-converting_phage	100.0	5.7e-59
WP_000814616.1|2014235_2014646_+	recombination protein NinB	NA	A0A0P0ZCW6	Stx2-converting_phage	100.0	3.2e-72
WP_001254240.1|2014642_2014834_+	NinE family protein	NA	A0A0P0ZDL7	Stx2-converting_phage	100.0	2.9e-31
WP_000211415.1|2015099_2015435_+	ORF6N domain-containing protein	NA	Q8VNP5	Enterobacteria_phage	96.4	3.0e-52
WP_000178725.1|2015696_2016371_+	phage antirepressor Ant	NA	A0A0P0ZDQ5	Stx2-converting_phage	95.1	1.8e-120
WP_001004033.1|2016445_2017168_+	phage antirepressor protein	NA	Q4A1A3	Enterobacteria_phage	98.8	1.7e-129
WP_001108004.1|2017167_2017773_+	recombination protein NinG	NA	Q5TJL9	Enterobacteria_phage	100.0	3.3e-97
WP_001028858.1|2017769_2018441_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	100.0	2.4e-133
WP_000512807.1|2018431_2018920_+	late gene antiterminator protein	NA	Q5TJL7	Enterobacteria_phage	100.0	7.0e-90
WP_000649751.1|2019569_2020529_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|2020540_2020810_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|2021106_2021430_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143111.1|2021673_2023611_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.2	0.0e+00
WP_000143458.1|2023747_2023927_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2023967_2024240_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|2024316_2024532_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_001135289.1|2024531_2025029_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	97.0	2.4e-90
WP_000092313.1|2025025_2025463_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	96.6	4.2e-70
WP_000839224.1|2025665_2026163_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|2026159_2026417_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|2026879_2027107_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_000279809.1|2027148_2027514_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	98.3	5.8e-65
WP_000958396.1|2027805_2028369_+|terminase	terminase small subunit	terminase	A0A0P0ZCQ9	Stx2-converting_phage	100.0	2.8e-90
WP_001301491.1|2028365_2030027_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2030090_2032028_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2032072_2032294_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_072618968.1|2032239_2035305_+|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	84.1	0.0e+00
WP_000125988.1|2035307_2035634_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2035643_2035994_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2035990_2036437_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2036433_2036778_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275434.1|2036843_2037560_+	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	100.0	1.6e-127
WP_000710952.1|2037574_2037949_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2038044_2038254_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|2038301_2041544_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2041536_2041878_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001152183.1|2041877_2042576_+|tail	phage minor tail protein L	tail	B6DZB1	Enterobacteria_phage	100.0	6.6e-134
WP_001302649.1|2042592_2042913_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2043020_2043194_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001416667.1|2043264_2044188_+	phage antirepressor Ant	NA	A0A0P0ZBT0	Stx2-converting_phage	100.0	7.6e-178
WP_001303040.1|2044241_2044979_+|tail	phage tail protein	tail	A0A0N7KZA3	Stx2-converting_phage	100.0	8.2e-151
WP_050546863.1|2044924_2045557_+|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_064234929.1|2045816_2049296_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	98.6	0.0e+00
WP_001230508.1|2049362_2049962_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_072618967.1|2050026_2051340_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	96.8	2.4e-76
WP_001023353.1|2051341_2051611_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	98.9	3.8e-45
WP_000491542.1|2051751_2052627_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2052851_2053502_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2054825_2055992_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2056110_2056584_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2056782_2057841_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2058012_2058342_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2058442_2058625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2059111_2059225_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2059237_2059432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2059890_2060259_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2060332_2060554_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2060616_2061093_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2061107_2061587_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2061668_2062490_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2062710_2063121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000775497.1|2063136_2063820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2063955_2065026_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2065022_2065928_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000638172.1|2065924_2066806_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829204.1|2066789_2068003_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_001442379.1|2068374_2070522_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2071969_2073508_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
>prophage 6
NZ_CP038421	Escherichia coli O157:H7 strain 7636 chromosome, complete genome	5458638	2097893	2139048	5458638	terminase,capsid,holin,portal,tail,transposase,head,integrase	Escherichia_phage(34.88%)	53	2078164:2078178	2102018:2102032
2078164:2078178	attL	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000533600.1|2097893_2098916_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2098915_2099119_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034474.1|2099177_2101649_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000199485.1|2101744_2101933_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2101929_2102118_-	cell division inhibitor	NA	NA	NA	NA	NA
2102018:2102032	attR	CGCATATTAATGGCA	NA	NA	NA	NA
WP_000367376.1|2102598_2102751_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2103025_2103670_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2103767_2103995_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2103991_2104417_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2104485_2105523_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2105434_2105977_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2106011_2106710_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2106731_2106956_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2106952_2107309_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2107341_2107494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2107490_2107802_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2107928_2108492_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278460.1|2108601_2108706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2108892_2109105_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2109272_2109551_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2109552_2110602_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2110614_2110974_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2110970_2111660_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000023257.1|2113200_2115051_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2115132_2116346_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2116656_2116872_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2116876_2117221_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2117271_2117805_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2117960_2118143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2118155_2118287_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2118514_2118700_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2119234_2119549_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2119630_2119855_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235436.1|2120249_2120759_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001302857.1|2120730_2122659_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	65.9	3.3e-260
WP_000259002.1|2122642_2122849_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000831796.1|2122845_2124438_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_171881818.1|2124427_2125786_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.1	2.9e-101
WP_000256723.1|2125822_2126170_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2126227_2126494_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2126475_2127216_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2127229_2127661_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2127687_2128101_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_171881819.1|2128081_2129944_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.3	2.1e-264
WP_134790849.1|2129895_2130660_+|tail	phage tail tape measure protein	tail	Q9EYE1	Enterobacteria_phage	92.1	8.6e-127
WP_000847304.1|2130656_2130986_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_060722696.1|2130985_2131684_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	7.1e-128
WP_000194760.1|2131694_2132438_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_122995769.1|2132383_2133013_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	96.2	2.1e-102
WP_171881820.1|2133253_2136733_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.4	0.0e+00
WP_072618965.1|2136799_2137399_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	99.0	1.7e-109
WP_000268876.1|2137463_2138777_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	3.3e-78
WP_001023445.1|2138778_2139048_+|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	97.8	2.1e-43
>prophage 7
NZ_CP038421	Escherichia coli O157:H7 strain 7636 chromosome, complete genome	5458638	2150500	2217926	5458638	tail,transposase,integrase	Enterobacteria_phage(59.38%)	82	2164354:2164367	2219669:2219682
WP_162829202.1|2150500_2151714_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303549.1|2151810_2152455_-	outer membrane protein	NA	Q1MVN1	Enterobacteria_phage	60.6	5.8e-60
WP_000365585.1|2153425_2154121_+	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	3.6e-07
WP_001157239.1|2154187_2155606_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_000786000.1|2155586_2156057_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	2.0e-33
WP_001212226.1|2156045_2156966_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922685.1|2157138_2158056_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009307.1|2158134_2158317_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001302088.1|2158487_2160182_+	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000491488.1|2160178_2160994_-	mannosyl-3-phosphoglycerate phosphatase-related protein	NA	NA	NA	NA	NA
WP_000844800.1|2161291_2161519_-	peroxide/acid resistance protein YodD	NA	NA	NA	NA	NA
WP_000867217.1|2161681_2161870_+	protein DsrB	NA	NA	NA	NA	NA
WP_000104001.1|2161913_2162537_-	transcriptional regulator RcsA	NA	NA	NA	NA	NA
WP_000942326.1|2162826_2163612_-	flagellar type III secretion system protein FliR	NA	NA	NA	NA	NA
WP_000187358.1|2163619_2163889_-	flagellar biosynthesis protein FliQ	NA	NA	NA	NA	NA
WP_001253441.1|2163898_2164636_-	flagellar type III secretion system pore protein FliP	NA	NA	NA	NA	NA
2164354:2164367	attL	ACAGTGCCAGCCCC	NA	NA	NA	NA
WP_001302429.1|2164635_2165001_-	flagellar type III secretion system protein FliO	NA	NA	NA	NA	NA
WP_001282098.1|2165003_2165417_-	flagellar motor switch protein FliN	NA	NA	NA	NA	NA
WP_001295641.1|2165413_2166418_-	flagellar motor switch protein FliM	NA	NA	NA	NA	NA
WP_000133106.1|2166422_2166887_-	flagellar basal body-associated protein FliL	NA	NA	NA	NA	NA
WP_000620075.1|2166991_2168119_-	flagellar hook length control protein FliK	NA	NA	NA	NA	NA
WP_000807584.1|2168115_2168559_-	flagella biosynthesis chaperone FliJ	NA	NA	NA	NA	NA
WP_000213294.1|2168577_2169951_-	flagellum-specific ATP synthase FliI	NA	NA	NA	NA	NA
WP_001282715.1|2170012_2170699_-	flagellar assembly protein FliH	NA	NA	NA	NA	NA
WP_000067950.1|2170691_2171687_-	flagellar motor switch protein FliG	NA	NA	NA	NA	NA
WP_001684600.1|2171679_2173344_-	flagellar M-ring protein FliF	NA	NA	NA	NA	NA
WP_001274299.1|2173551_2173866_+	flagellar hook-basal body complex protein FliE	NA	NA	NA	NA	NA
WP_000484237.1|2174214_2175354_+	T3SS effector leucine-rich repeat protein EspR4	NA	NA	NA	NA	NA
WP_000501085.1|2175491_2175791_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000484277.1|2176172_2177312_+	T3SS effector leucine-rich repeat protein EspR3	NA	NA	NA	NA	NA
WP_000494168.1|2177449_2177929_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000334610.1|2178039_2178708_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.7	3.3e-82
WP_000790504.1|2178816_2179050_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_000118883.1|2179046_2180252_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_001295642.1|2180438_2180852_+	lipoprotein	NA	NA	NA	NA	NA
WP_001245723.1|2180885_2182373_-	alpha-amylase	NA	NA	NA	NA	NA
WP_001015033.1|2182450_2182816_-	flagella biosynthesis regulatory protein FliT	NA	NA	NA	NA	NA
WP_000270665.1|2182815_2183226_-	flagellar export chaperone FliS	NA	NA	NA	NA	NA
WP_000146755.1|2183250_2184648_-	flagellar filament capping protein FliD	NA	NA	NA	NA	NA
WP_000079722.1|2184913_2186671_+	FliC/FljB family flagellin	NA	NA	NA	NA	NA
WP_001087467.1|2186990_2187710_+	RNA polymerase sigma factor FliA	NA	NA	NA	NA	NA
WP_001417215.1|2187755_2188307_+	flagella biosynthesis regulatory protein FliZ	NA	NA	NA	NA	NA
WP_001302033.1|2188394_2189195_+	cystine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001128225.1|2189299_2190286_+	D-cysteine desulfhydrase	NA	NA	NA	NA	NA
WP_001158226.1|2190300_2190969_+	cystine ABC transporter permease	NA	NA	NA	NA	NA
WP_001273005.1|2190965_2191718_+	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
WP_001154288.1|2191947_2192670_+	transcriptional regulator SdiA	NA	NA	NA	NA	NA
WP_000106479.1|2192737_2192962_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_001302050.1|2192948_2193125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611328.1|2193420_2194077_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_001283421.1|2194073_2195906_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_001160187.1|2195962_2196511_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_001303543.1|2197502_2197784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_115801851.1|2197804_2197999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032161583.1|2197940_2199077_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|2199027_2199351_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2199508_2200693_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2200692_2201205_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2201259_2201625_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2201633_2201789_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2204591_2205080_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2205236_2205809_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2205852_2206383_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2207474_2207789_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2207793_2208753_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2208829_2211652_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
WP_000599379.1|2211658_2212024_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2212020_2212638_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2212649_2212949_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2212945_2213212_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2213208_2213412_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2213435_2213852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2213944_2214058_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2214054_2214297_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2214308_2214587_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2214597_2214948_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2214969_2215173_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2215244_2215382_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2215471_2215876_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2215891_2216542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2216571_2216919_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2216924_2217926_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2219669:2219682	attR	ACAGTGCCAGCCCC	NA	NA	NA	NA
>prophage 8
NZ_CP038421	Escherichia coli O157:H7 strain 7636 chromosome, complete genome	5458638	2538486	2654288	5458638	lysis,protease,transposase,terminase,portal,holin,tail,capsid,head	Stx2-converting_phage(28.57%)	142	NA	NA
WP_001260835.1|2538486_2539308_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2539407_2539491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2539583_2539919_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2540315_2541569_-	MFS transporter	NA	NA	NA	NA	NA
WP_001019530.1|2541675_2542569_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2542703_2543924_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2544048_2544744_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2544696_2545989_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2546146_2546761_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
WP_000526515.1|2546803_2547658_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2547659_2548277_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2548287_2550711_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2550771_2553198_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2553396_2553702_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2553809_2554520_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2554522_2555083_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2555117_2555459_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2555593_2555920_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2556908_2557160_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2557232_2559704_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2559796_2559988_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2559984_2560173_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2560573_2560738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2560741_2560960_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072143447.1|2561031_2561331_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2561683_2561962_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2561963_2562155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2562175_2562547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2562644_2562947_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2562943_2563369_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2563391_2564354_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2564360_2565101_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2565911_2566307_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2566363_2566948_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2567063_2567168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2567356_2567569_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2567736_2568015_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2568016_2569066_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2569078_2569438_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2569434_2570124_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2570761_2571190_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_064234946.1|2571668_2573519_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.5	0.0e+00
WP_024180155.1|2573957_2574173_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2574177_2574522_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2574572_2575106_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2575376_2575946_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2575945_2576092_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2576319_2576505_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2576929_2577157_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279796.1|2577198_2577564_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958387.1|2577853_2578417_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001301491.1|2578413_2580075_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000173030.1|2580138_2582076_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2582120_2582342_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000267292.1|2582287_2584789_+|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_000126019.1|2584868_2585195_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2585204_2585555_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2585551_2585998_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2585994_2586339_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2586397_2587114_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2587119_2587494_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2587589_2587799_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_064234948.1|2587851_2591094_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.8	0.0e+00
WP_000807954.1|2591086_2591428_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179509.1|2591427_2591865_+|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_105626756.1|2592052_2595313_+	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	92.2	0.0e+00
WP_001304111.1|2595315_2595531_+	hypothetical protein	NA	Q9LA64	Enterobacterial_phage	97.2	1.0e-32
WP_001230508.1|2595598_2596198_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_064234952.1|2596262_2597477_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	95.5	3.9e-81
WP_001023362.1|2597478_2597748_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_001131642.1|2597861_2598437_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.5	4.1e-57
WP_001121225.1|2599146_2599797_+	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_000998048.1|2600379_2601918_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2601967_2602315_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2602311_2602692_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_001120551.1|2603654_2603897_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_162829202.1|2604382_2605595_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000102123.1|2605920_2607165_-	exonuclease	NA	H6WRX1	Salmonella_phage	50.3	1.4e-86
WP_000199475.1|2607257_2607446_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449175.1|2607442_2607631_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_001133037.1|2608195_2608405_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394548.1|2608405_2609044_-	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	41.9	2.5e-07
WP_000380316.1|2609055_2609208_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	5.1e-07
WP_001416688.1|2609500_2609839_-	peptidase S24	NA	H9C160	Pectobacterium_phage	30.1	1.9e-06
WP_000747948.1|2610230_2610473_+	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_000693878.1|2610456_2610882_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262402.1|2610950_2611994_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	65.1	1.4e-82
WP_000139447.1|2611986_2612448_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_000450627.1|2612481_2613198_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000603384.1|2613230_2613512_+	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000699809.1|2613508_2613736_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_001289673.1|2613728_2614040_+	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000683609.1|2614167_2614386_+	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_000104474.1|2614387_2614945_+	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000935259.1|2615178_2615391_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000756596.1|2615510_2615855_+	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000191872.1|2615976_2616249_+	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_001265229.1|2616250_2617300_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_001217444.1|2617312_2617618_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_000640035.1|2617680_2618235_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_000917763.1|2618459_2618657_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000301797.1|2618792_2619506_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001302123.1|2619956_2620388_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000023184.1|2620865_2622716_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_024180155.1|2623154_2623370_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000731241.1|2623374_2623719_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000992137.1|2623769_2624303_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2624573_2625143_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2625142_2625289_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_072618960.1|2625296_2625764_+|lysis	lysis protein	lysis	Q9EYC9	Enterobacteria_phage	90.9	2.6e-70
WP_001302717.1|2626227_2626542_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001303940.1|2626623_2626848_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_000867498.1|2627234_2627780_+|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001027230.1|2627754_2629680_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000198153.1|2629676_2629883_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2629879_2631481_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2631461_2632781_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2632790_2633123_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2633178_2634204_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2634245_2634644_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2634655_2635009_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2635023_2635557_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2635553_2635949_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2635956_2636709_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479046.1|2636722_2637145_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.4e-70
WP_000533440.1|2637171_2637585_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	83.2	3.2e-43
WP_000081804.1|2637565_2640178_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	95.9	0.0e+00
WP_000847298.1|2640174_2640504_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001151106.1|2640503_2641202_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	97.8	3.8e-129
WP_000194720.1|2641212_2641956_+|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_071601640.1|2641901_2642531_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_171878316.1|2642771_2646251_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	99.3	0.0e+00
WP_001230508.1|2646318_2646918_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_046671432.1|2646982_2648296_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	98.6	3.8e-82
WP_001023407.1|2648297_2648567_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_001131658.1|2648680_2649256_+	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001356599.1|2649328_2649958_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001143804.1|2650039_2650681_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001120551.1|2650842_2651085_-	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_000347470.1|2651216_2652500_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527769.1|2652588_2654049_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000214712.1|2654084_2654288_-	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
>prophage 9
NZ_CP038421	Escherichia coli O157:H7 strain 7636 chromosome, complete genome	5458638	2923586	2999118	5458638	protease,terminase,portal,capsid,holin,tail,transposase,head,integrase	Stx2-converting_phage(35.09%)	85	2939088:2939115	2999255:2999282
WP_000422055.1|2923586_2924636_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559268.1|2924855_2925614_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_001278878.1|2925610_2926201_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001291216.1|2926240_2927113_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001302160.1|2927325_2928909_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2928936_2929557_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285675.1|2929553_2930435_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2930572_2930617_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194607.1|2930708_2932271_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763520.1|2932270_2933866_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_000983858.1|2933866_2935228_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000209521.1|2935239_2936433_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443092.1|2936432_2937239_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000807651.1|2937619_2937799_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2937884_2938385_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079499.1|2938430_2938937_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
2939088:2939115	attL	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
WP_001345079.1|2940250_2940901_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001144877.1|2942407_2942998_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|2943181_2943829_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|2943965_2944112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|2944539_2944818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171540.1|2945157_2945538_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|2945534_2945882_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_072618941.1|2945931_2947470_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.3e-299
WP_000938103.1|2948435_2949005_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|2949070_2949982_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|2950088_2950211_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|2951808_2953134_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
WP_001023474.1|2954161_2954431_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|2954432_2955746_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|2955897_2956497_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_129137390.1|2956564_2958910_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001304109.1|2958861_2960037_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|2960379_2961012_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|2960957_2961701_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_001152184.1|2961711_2962410_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.4	2.9e-129
WP_000807954.1|2962409_2962751_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064234948.1|2962743_2965986_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.8	0.0e+00
WP_001453698.1|2966038_2966248_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|2966343_2966718_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|2966723_2967440_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|2967498_2967843_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|2967839_2968286_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|2968282_2968633_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|2968642_2968969_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|2969048_2971550_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|2971495_2971717_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|2971761_2973699_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|2973762_2975424_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|2975420_2975984_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|2976274_2976640_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000095736.1|2976681_2976909_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|2977333_2977519_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|2977746_2977893_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|2977892_2978462_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|2978732_2979266_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|2979316_2979661_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|2979665_2979881_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000143067.1|2980030_2981884_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.9	0.0e+00
WP_000935548.1|2982680_2983739_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|2983889_2984087_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|2984328_2984859_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|2984867_2985227_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|2985239_2986286_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|2986287_2986566_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|2986635_2986893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|2987113_2987326_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|2987604_2988363_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|2989061_2989226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|2989222_2989804_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|2989990_2990533_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|2990444_2991485_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|2991456_2992008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|2991991_2992219_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|2992295_2992703_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|2992966_2993266_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|2993338_2993557_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|2993579_2993987_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|2993964_2994198_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|2994191_2994359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|2994756_2994945_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|2994941_2995133_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|2995225_2997697_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|2997761_2998010_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2997987_2999118_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
2999255:2999282	attR	GTGGTATCGATATCCATGTACCACACTG	NA	NA	NA	NA
>prophage 10
NZ_CP038421	Escherichia coli O157:H7 strain 7636 chromosome, complete genome	5458638	3045814	3104016	5458638	protease,transposase,tRNA,tail	Escherichia_phage(25.0%)	50	NA	NA
WP_001299679.1|3045814_3047071_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3047284_3047908_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3047907_3048759_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3048909_3049857_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3049981_3051661_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3051715_3051994_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3052271_3052856_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3052972_3054064_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_001303183.1|3054907_3057793_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|3057892_3059812_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733713.1|3060039_3061110_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3061120_3061753_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3061763_3063182_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001459046.1|3065213_3065414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3065521_3066544_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3066543_3067524_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3067520_3068279_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|3069097_3069952_+	ModD protein	NA	NA	NA	NA	NA
WP_001302893.1|3069977_3071948_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3071997_3072252_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_171881823.1|3073100_3074313_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	98.6	3.5e-167
WP_001295616.1|3074501_3075113_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3075212_3076127_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3076222_3077959_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_162829348.1|3078116_3079330_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000197859.1|3079667_3080738_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3080747_3082046_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3082408_3083941_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|3083992_3084712_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3084933_3086475_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3086620_3087151_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3087196_3088465_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3088464_3088884_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_000807626.1|3090373_3090835_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3090911_3091571_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3091642_3091936_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3091947_3092106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3092176_3092578_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3092680_3093049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3093568_3094264_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3094287_3095100_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3095103_3095370_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_024183435.1|3095741_3096593_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_162829202.1|3096672_3097885_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001201843.1|3098452_3099406_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3099592_3101077_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_072618941.1|3101379_3102918_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.8	1.3e-299
WP_000612591.1|3102967_3103315_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3103311_3103692_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3103767_3104016_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
>prophage 11
NZ_CP038421	Escherichia coli O157:H7 strain 7636 chromosome, complete genome	5458638	3107571	3154256	5458638	tRNA,lysis,terminase,portal,holin,tail,capsid,head,integrase	Enterobacteria_phage(58.14%)	55	3124823:3124838	3153077:3153092
WP_000885630.1|3107571_3108153_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.7	6.1e-101
WP_000279120.1|3108152_3111068_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	98.3	1.1e-57
WP_001230336.1|3111132_3111732_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3111798_3115197_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3115257_3115890_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3115826_3116570_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3116575_3117274_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3117273_3117603_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3117599_3120149_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3120141_3120576_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3120557_3120980_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3120995_3121736_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683120.1|3121743_3122139_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	99.2	5.0e-70
WP_000752995.1|3122724_3123078_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3123089_3123488_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3123529_3124555_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3124610_3124943_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
3124823:3124838	attL	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_000123254.1|3124952_3126272_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3126252_3127854_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3127850_3128057_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027365.1|3128053_3129979_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000453564.1|3129953_3130499_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_001300120.1|3130887_3131082_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_001031427.1|3131246_3131453_-	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_000079504.1|3131738_3132149_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_000738495.1|3132440_3132734_+	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_010917798.1|3132824_3133007_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_001180487.1|3133223_3133700_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_000544528.1|3133686_3133992_-|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001097228.1|3134313_3135003_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
WP_000971093.1|3134999_3135140_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001099695.1|3135136_3135499_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000774504.1|3135495_3135786_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_000224907.1|3135778_3135949_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_001053040.1|3135948_3136404_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000709077.1|3136905_3138432_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001302833.1|3138489_3138612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070446.1|3138676_3139009_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|3139076_3139379_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788869.1|3139375_3140077_-	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.6	1.3e-129
WP_000088655.1|3141001_3141238_+	excisionase	NA	NA	NA	NA	NA
WP_000741454.1|3141227_3142370_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000444477.1|3142483_3143734_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_001248690.1|3143905_3144559_+	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000476093.1|3144568_3145030_+	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001301861.1|3145083_3146190_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_001301618.1|3146225_3146867_+	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000423729.1|3146870_3148241_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001265474.1|3148409_3149081_+	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000735407.1|3149080_3150541_+	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_000133424.1|3151141_3151423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000835281.1|3151678_3152221_-|terminase	terminase small subunit	terminase	O64316	Escherichia_phage	44.2	1.8e-33
WP_000224603.1|3152426_3152840_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380883.1|3152852_3153188_-|head	head decoration protein	head	NA	NA	NA	NA
3153077:3153092	attR	CCAGCATCAGCGGGGT	NA	NA	NA	NA
WP_000907465.1|3153200_3154256_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.3	1.5e-68
>prophage 12
NZ_CP038421	Escherichia coli O157:H7 strain 7636 chromosome, complete genome	5458638	3160347	3217682	5458638	terminase,portal,holin,tail,capsid,head,integrase	Stx2-converting_phage(27.27%)	70	3203249:3203269	3224339:3224359
WP_000085256.1|3160347_3161577_-|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	56.1	3.8e-132
WP_001301987.1|3161825_3162947_+	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000359446.1|3162995_3164222_-	peptidase T	NA	NA	NA	NA	NA
WP_000531594.1|3164471_3165608_+	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000799385.1|3165591_3166455_+	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000938118.1|3166818_3168180_+	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_001303921.1|3168240_3168516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301984.1|3170824_3174226_-	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001301673.1|3174816_3177165_-	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_115801847.1|3177184_3177274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071526731.1|3177286_3177523_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_000967271.1|3177468_3178206_-|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	100.0	8.2e-151
WP_000835336.1|3178259_3179138_-	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_010904626.1|3179440_3179551_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000170104.1|3179660_3179915_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001152182.1|3179931_3180630_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	98.3	8.1e-132
WP_000807954.1|3180629_3180971_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_064234948.1|3180963_3184206_-|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	95.8	0.0e+00
WP_001453698.1|3184258_3184468_-	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_001030063.1|3184563_3184938_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3184943_3185660_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133388.1|3185718_3186063_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3186059_3186506_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3186502_3186853_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3186862_3187189_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_000267292.1|3187268_3189770_-|portal	phage portal protein	portal	B6DZA1	Enterobacteria_phage	99.2	0.0e+00
WP_001063099.1|3189715_3189937_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3189981_3191919_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_072618957.1|3191982_3193644_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000958387.1|3193640_3194204_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|3194493_3194859_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_032173704.1|3194900_3195086_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	88.7	1.9e-19
WP_000347013.1|3195215_3195356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3195712_3195937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3196001_3196208_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3196435_3196582_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3196581_3197151_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3197421_3197955_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3198005_3198350_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3198354_3198570_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3198645_3198915_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3198952_3199135_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3199282_3201220_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000762929.1|3202298_3203120_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3203116_3203491_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3203249:3203269	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265159.1|3203503_3204553_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.2	1.4e-106
WP_001341388.1|3204554_3204833_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3205000_3205213_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3205401_3205506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3205621_3206209_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3206211_3206403_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3206404_3206842_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3206828_3207146_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3207099_3207417_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3207406_3207709_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3207705_3207987_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3208019_3208736_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3208769_3209312_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001262323.1|3209223_3210261_-	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	79.5	3.3e-89
WP_000693915.1|3210329_3210755_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3210738_3211062_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3211186_3211663_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3211978_3212131_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3212245_3212761_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3212893_3213283_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3213344_3213614_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3213582_3214701_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3214867_3215662_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3215658_3216705_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3216860_3217682_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3224339:3224359	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 13
NZ_CP038421	Escherichia coli O157:H7 strain 7636 chromosome, complete genome	5458638	3426760	3482098	5458638	protease,transposase,portal,holin,tail,capsid,head,integrase	Enterobacteria_phage(25.0%)	63	3428695:3428710	3483863:3483878
WP_000003653.1|3426760_3427348_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3427344_3428052_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3428070_3429864_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3428695:3428710	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3429860_3430979_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3433111_3433381_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000268962.1|3433382_3434696_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.0	2.8e-77
WP_001230444.1|3434760_3435360_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	99.0	8.8e-111
WP_149025607.1|3435427_3437773_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	95.6	0.0e+00
WP_072618954.1|3437724_3438900_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	97.4	4.4e-231
WP_000649829.1|3439033_3439561_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_149025606.1|3439751_3440384_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	96.2	1.8e-101
WP_054191786.1|3440329_3441073_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.1e-146
WP_001151105.1|3441083_3441782_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	1.2e-130
WP_000847298.1|3441781_3442111_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_032106087.1|3442107_3444687_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	81.6	0.0e+00
WP_000533402.1|3444667_3445081_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3445107_3445539_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3445552_3446293_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3446274_3446541_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3446598_3446946_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_171881818.1|3446982_3448341_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.1	2.9e-101
WP_000831796.1|3448330_3449923_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.5	8.7e-182
WP_000259002.1|3449919_3450126_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000998048.1|3452302_3453841_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3453890_3454238_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3454234_3454615_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000235421.1|3454690_3454966_-	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_000411791.1|3455716_3455923_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3456178_3456451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3456610_3457144_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3457364_3457478_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3457699_3457885_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3458412_3458727_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3458931_3460145_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|3460320_3462171_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3462938_3463652_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3464272_3465091_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3465242_3465614_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3465603_3465975_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3465987_3467037_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3467038_3467317_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3467484_3467640_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3467741_3467879_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3468244_3469018_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3469369_3469783_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3469798_3470569_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3470590_3471337_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_001205823.1|3471343_3472435_-	hypothetical protein	NA	V5URT9	Shigella_phage	70.0	5.1e-133
WP_000273724.1|3472513_3472969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3473175_3473601_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000887453.1|3473584_3473857_-	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	45.8	1.1e-12
WP_000986592.1|3473965_3474367_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3474394_3474586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3474585_3474873_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3475150_3475306_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3475447_3475837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3476023_3476209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3476782_3476971_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3476967_3477159_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3477252_3479724_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3479791_3480034_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3480011_3481031_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_000375128.1|3481438_3482098_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	1.8e-48
3483863:3483878	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 14
NZ_CP038421	Escherichia coli O157:H7 strain 7636 chromosome, complete genome	5458638	3777422	3816835	5458638	lysis,protease,terminase,portal,holin,tail,transposase,integrase	Enterobacteria_phage(51.16%)	50	3777007:3777021	3816909:3816923
3777007:3777021	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3777422_3778121_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3778351_3779233_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3779401_3779563_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3780059_3781079_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3781112_3782093_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3782269_3782539_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_000741874.1|3782540_3783857_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	Q6H9S9	Enterobacteria_phage	95.6	2.0e-67
WP_001233141.1|3783916_3784516_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_000515426.1|3784586_3788000_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.1	0.0e+00
WP_000090841.1|3788060_3788669_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3788605_3789349_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3789354_3790053_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3790062_3790392_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_162829202.1|3791256_3792470_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001161009.1|3794741_3795071_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3795079_3795466_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3795526_3796270_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3796280_3796682_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3796678_3797257_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3797268_3797544_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3797536_3797860_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001442366.1|3797946_3799974_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.2	0.0e+00
WP_127446149.1|3799918_3800254_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_072187152.1|3800375_3801500_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	98.8	5.9e-193
WP_001072975.1|3801427_3801640_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3801636_3803739_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3803738_3804230_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3804904_3805057_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3805044_3805512_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3805508_3806006_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3806005_3806221_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3806363_3806762_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3806842_3807001_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3807086_3807830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3808013_3808703_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3808717_3808840_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3809177_3810137_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3810348_3811014_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001108055.1|3811010_3811631_-	recombination protein NinG	NA	Q716C3	Shigella_phage	96.1	1.6e-94
WP_000567001.1|3811623_3811794_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3811790_3811973_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3812670_3813351_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3813347_3813530_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3813502_3813694_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3813704_3813986_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3814084_3814306_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3814516_3815119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3815361_3815529_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3815568_3815787_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533643.1|3815764_3816835_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.9e-202
3816909:3816923	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 15
NZ_CP038421	Escherichia coli O157:H7 strain 7636 chromosome, complete genome	5458638	4395663	4432480	5458638	tail,transposase,integrase	Escherichia_phage(28.57%)	38	4395234:4395248	4428950:4428964
4395234:4395248	attL	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_001130487.1|4395663_4396845_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000246059.1|4397807_4398551_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355475.1|4399374_4400148_+	hypothetical protein	NA	A0A289ZIY5	Serratia_phage	44.7	5.0e-50
WP_000904979.1|4400205_4400760_-	site-specific DNA recombinase	NA	A0A0F7LA37	Escherichia_phage	88.4	2.8e-87
WP_001115574.1|4400789_4401284_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	93.5	3.9e-80
WP_000805544.1|4401283_4401877_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	61.7	5.2e-55
WP_000344820.1|4401848_4402292_-|tail	tail assembly chaperone	tail	A0A0F7LDZ0	Escherichia_phage	97.3	7.0e-81
WP_162829202.1|4402409_4403622_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001303805.1|4403949_4404195_+	transcription antitermination protein	NA	J3JZZ6	Escherichia_phage	90.5	1.0e-12
WP_000893282.1|4405264_4406518_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4406529_4407633_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4407920_4408976_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4409014_4409416_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4409473_4410718_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4410809_4411268_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4411528_4412986_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023438539.1|4413042_4413600_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4413511_4413778_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4414084_4414537_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4414546_4414945_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4414947_4415241_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4415292_4416348_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4416418_4417204_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4417148_4418888_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4419705_4420479_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4420664_4420925_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4420943_4421204_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4421359_4422100_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_171881830.1|4422070_4422838_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4422942_4423521_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4423760_4426205_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4426247_4426721_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4426874_4427645_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4427762_4428935_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4429015_4429201_+	protein YncO	NA	NA	NA	NA	NA
4428950:4428964	attR	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_000247943.1|4429115_4429379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4429580_4431341_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4431343_4432480_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
>prophage 16
NZ_CP038421	Escherichia coli O157:H7 strain 7636 chromosome, complete genome	5458638	4891230	4950241	5458638	protease,transposase	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|4891230_4892583_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|4892676_4893228_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|4893383_4894757_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|4894932_4895931_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|4895963_4896959_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001301928.1|4896945_4897968_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|4897981_4899484_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|4899623_4900580_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|4900889_4901420_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|4901499_4901850_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|4901843_4902095_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|4902306_4902648_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|4902650_4906430_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|4906426_4908160_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|4908365_4909004_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|4909326_4910670_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|4910748_4910955_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|4911279_4911834_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|4911896_4912835_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|4913046_4913787_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|4913976_4915920_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|4916037_4916418_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|4916506_4917367_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|4917474_4918440_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|4918547_4919210_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|4919254_4920667_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|4920975_4921596_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|4921813_4922452_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|4922586_4923795_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|4923802_4924234_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|4924856_4925651_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|4925721_4926171_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|4926212_4926440_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|4926444_4926759_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|4926765_4927161_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|4927487_4927763_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|4927891_4928578_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|4928577_4929432_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|4929441_4930092_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|4930105_4930570_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|4930579_4930885_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|4930900_4932298_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|4933824_4934580_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569692.1|4934576_4935326_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|4935507_4935837_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|4935985_4936261_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|4936377_4938003_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|4938086_4939250_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|4939252_4939891_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4939900_4940299_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|4940316_4940976_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|4941026_4941725_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|4941743_4942145_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4942271_4943003_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|4943183_4945625_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|4945663_4946089_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4946293_4947592_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4947695_4947893_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4947974_4948979_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4948981_4950241_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 17
NZ_CP038421	Escherichia coli O157:H7 strain 7636 chromosome, complete genome	5458638	5087120	5101785	5458638	tail,tRNA,integrase	Enterobacteria_phage(43.75%)	19	5082961:5082976	5100490:5100505
5082961:5082976	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5087120_5088536_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000235522.1|5088618_5089602_+	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000891404.1|5089767_5090010_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5090143_5091181_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5091269_5092367_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217542.1|5092428_5092677_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143817.1|5092837_5093479_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.5	5.7e-108
WP_072140863.1|5093560_5094190_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5094262_5094835_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_001023355.1|5094946_5095216_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	96.6	2.7e-43
WP_064234994.1|5095217_5096531_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZCC1	Stx2-converting_phage	97.5	5.7e-78
WP_001230302.1|5096595_5097195_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZBV0	Stx2-converting_phage	97.5	2.4e-108
WP_000008211.1|5098516_5099053_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5099043_5099394_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5099390_5099675_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5100010_5100208_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5100552_5100834_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5100490:5100505	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5100881_5101055_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5101251_5101785_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
>prophage 1
NZ_CP038422	Escherichia coli O157:H7 strain 7636 plasmid p7636-1, complete sequence	94959	24315	94210	94959	transposase,integrase,protease	Stx2-converting_phage(30.0%)	61	11888:11903	52770:52785
11888:11903	attL	GTGTTTTTCTGGCCGG	NA	NA	NA	NA
WP_001066920.1|24315_25056_+|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	2.0e-24
WP_000361615.1|25340_26318_-	replication initiation protein	NA	J9Q7H0	Salmonella_phage	58.9	5.1e-100
WP_000708307.1|26725_26926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001248529.1|26922_27543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010891291.1|27539_28223_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_000813634.1|28681_28900_+	type II toxin-antitoxin system antitoxin CcdA	NA	NA	NA	NA	NA
WP_001159868.1|28901_29207_+	type II toxin-antitoxin system toxin CcdB	NA	NA	NA	NA	NA
WP_000016989.1|29207_30014_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	99.1	3.7e-56
WP_162829202.1|30736_31950_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000772446.1|32611_33778_+	plasmid-partitioning protein SopA	NA	A0A2I6B2X3	Macacine_betaherpesvirus	100.0	7.0e-229
WP_000817031.1|33777_34749_+	ParB/RepB/Spo0J family plasmid partition protein	NA	I3WF22	Macacine_betaherpesvirus	100.0	4.8e-175
WP_000273919.1|35443_36346_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891292.1|36349_36655_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000085945.1|36731_37415_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.9	8.7e-30
WP_001104869.1|37415_37637_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001358893.1|37530_38085_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_001310284.1|38779_39352_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_010891293.1|39447_39750_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271685.1|39796_40219_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027495.1|40215_40407_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303399.1|40525_40915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000218642.1|41402_41633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000199442.1|41684_43046_+	DUF3560 domain-containing protein	NA	NA	NA	NA	NA
WP_001302171.1|43092_43656_+	class I SAM-dependent methyltransferase	NA	A8HNV9	Thalassomonas_phage	36.7	1.0e-20
WP_001496595.1|43741_44209_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000547965.1|44278_44485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000290823.1|44510_44963_+	single-stranded DNA-binding protein	NA	A0A1B0VAF5	Salmonella_phage	59.3	4.4e-46
WP_000005995.1|45019_45253_+	DUF905 family protein	NA	NA	NA	NA	NA
WP_000117168.1|45318_47277_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	26.7	1.8e-19
WP_000845908.1|47331_47766_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276250.1|47762_48524_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_001302184.1|48755_48914_+	type I toxin-antitoxin system Hok family toxin	NA	NA	NA	NA	NA
WP_001453090.1|51136_51568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000581721.1|53319_62829_+	toxin B	NA	NA	NA	NA	NA
52770:52785	attR	CCGGCCAGAAAAACAC	NA	NA	NA	NA
WP_000205762.1|65087_65834_+	conjugal transfer pilus acetylase TraX	NA	A0A077JBM8	Xanthomonas_phage	30.8	6.4e-10
WP_000704522.1|65892_66753_+	alpha/beta hydrolase	NA	A2RQC8	Archaeal_BJ1_virus	23.0	2.3e-11
WP_000840472.1|66855_67416_+	fertility inhibition protein FinO	NA	NA	NA	NA	NA
WP_001302189.1|67548_67761_+	ANR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001233853.1|68005_68467_+	thermonuclease family protein	NA	A0A0R6PHV6	Moraxella_phage	37.1	5.5e-20
WP_001302200.1|68512_68722_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_000766796.1|68759_69098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000083831.1|69337_69592_+	replication regulatory protein RepA	NA	NA	NA	NA	NA
WP_001370046.1|69827_69902_+	RepA leader peptide Tap	NA	NA	NA	NA	NA
WP_000130945.1|69894_70752_+	incFII family plasmid replication initiator RepA	NA	NA	NA	NA	NA
WP_001178089.1|71664_71949_+	ribbon-helix-helix protein, CopG family	NA	NA	NA	NA	NA
WP_000421248.1|71948_72224_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001105064.1|72318_72525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302179.1|73865_74051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000592771.1|74227_76438_+	catalase/peroxidase KatP	NA	NA	NA	NA	NA
WP_001172748.1|76481_76871_+	cytochrome b562 family protein	NA	NA	NA	NA	NA
WP_001034100.1|78096_81999_+|protease	serine protease autotransporter EspP	protease	Q9LA58	Enterobacterial_phage	40.4	9.5e-238
WP_001302199.1|84176_84998_+	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000975743.1|84997_86104_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000550559.1|86193_87915_+	phosphoethanolamine transferase CptA	NA	NA	NA	NA	NA
WP_001302181.1|87988_88987_+	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_171881834.1|89447_89831_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	99.2	8.8e-64
WP_001171540.1|89906_90287_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	99.2	7.1e-66
WP_000612591.1|90283_90631_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|90680_92219_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|92274_92622_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|92671_94210_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
