The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP038425	Escherichia coli O157:H7 strain 2571 chromosome, complete genome	5572326	1227800	1241239	5572326	holin,tail	Enterobacteria_phage(38.46%)	17	NA	NA
WP_001223948.1|1227800_1228412_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	95.6	2.5e-92
WP_001028854.1|1228408_1229074_+	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_001235472.1|1229070_1229694_+	antitermination protein	NA	K7PM87	Enterobacteria_phage	98.1	2.2e-112
WP_001302581.1|1229946_1230690_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000499458.1|1230775_1230943_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000143068.1|1231350_1233204_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	97.7	0.0e+00
WP_000284517.1|1233353_1233569_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_000731241.1|1233573_1233918_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_001171554.1|1234274_1234655_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_171878366.1|1234651_1234999_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	99.1	1.1e-60
WP_001023396.1|1235618_1235888_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_163332151.1|1236048_1236465_+	T3SS effector NleG family protein	NA	B6DZB9	Enterobacteria_phage	95.7	3.0e-73
WP_001301665.1|1236601_1237660_-	T3SS effector EspW	NA	NA	NA	NA	NA
WP_097209403.1|1237738_1238389_-	T3SS effector NleG family protein	NA	B6DZZ5	Stx2-converting_phage	37.2	2.8e-25
WP_001132157.1|1238571_1239162_+	T3SS effector guanine nucleotide exchange factor EspM2	NA	NA	NA	NA	NA
WP_001217542.1|1239663_1239912_-	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_000162574.1|1240756_1241239_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
>prophage 2
NZ_CP038425	Escherichia coli O157:H7 strain 2571 chromosome, complete genome	5572326	1518823	1580876	5572326	protease,capsid,transposase,portal,holin,integrase,tail,lysis	Escherichia_phage(28.0%)	75	1523218:1523241	1579845:1579868
WP_000950857.1|1518823_1519393_+	hypothetical protein	NA	Q716G6	Shigella_phage	99.3	4.6e-69
WP_000403517.1|1519392_1519860_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	74.7	1.7e-64
WP_000960724.1|1519846_1520527_+	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	71.0	1.8e-59
WP_000257010.1|1520536_1521673_+	phage DNA ejection protein	NA	Q716G3	Shigella_phage	72.8	1.4e-80
WP_000958700.1|1521847_1523005_-|integrase	prophage integrase IntS	integrase	E7DYQ6	Enterobacteria_phage	100.0	2.2e-222
1523218:1523241	attL	TTATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
WP_001218301.1|1523436_1524606_+|integrase	site-specific integrase	integrase	A0A1U9AJ52	Stx1_converting_phage	100.0	5.7e-231
WP_000405131.1|1524589_1524772_-	helix-turn-helix domain-containing protein	NA	A0A1U9AJ41	Stx1_converting_phage	100.0	4.1e-27
WP_000497812.1|1524832_1525084_-	DUF4222 domain-containing protein	NA	G3CFG8	Escherichia_phage	100.0	2.9e-39
WP_000763383.1|1526477_1526699_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001395510.1|1526797_1527079_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000548531.1|1527089_1527281_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_064032105.1|1527253_1527436_-	DUF1317 family protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	2.0e-26
WP_000186844.1|1527432_1528113_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_016241376.1|1528109_1528895_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	99.6	3.1e-148
WP_000995439.1|1528900_1529197_-	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000372941.1|1529272_1529416_-	host cell division inhibitory peptide Kil	NA	A0A1I9LJN2	Stx_converting_phage	100.0	1.2e-18
WP_001198861.1|1529384_1529549_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000167595.1|1529740_1530211_-	hypothetical protein	NA	A0A1I9LJN4	Stx_converting_phage	100.0	3.7e-88
WP_024231298.1|1530214_1530547_-	antitermination protein	NA	K7PJZ2	Enterobacterial_phage	97.3	4.6e-53
WP_032250460.1|1530877_1531282_-	hypothetical protein	NA	Q716D7	Shigella_phage	97.8	9.6e-69
WP_000028392.1|1531278_1531911_-	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_001194218.1|1532017_1532233_+	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000251069.1|1532352_1532646_+	hypothetical protein	NA	A2SY75	Escherichia_phage	100.0	3.7e-46
WP_171878367.1|1532678_1533032_+	replication protein	NA	M1FN81	Enterobacteria_phage	99.1	5.8e-62
WP_162829202.1|1533071_1534285_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_064234920.1|1534965_1535667_+	Replication protein P	NA	A0A1U9AJJ8	Stx1_converting_phage	100.0	3.4e-130
WP_000145931.1|1535663_1535954_+	protein ren	NA	A0A1I9LJP5	Stx_converting_phage	100.0	9.6e-47
WP_001000127.1|1536024_1536303_+	hypothetical protein	NA	Q9ZWY1	Enterobacteria_phage	100.0	3.4e-49
WP_000103679.1|1536435_1536651_+	hypothetical protein	NA	A0A1I9LJP7	Stx_converting_phage	100.0	1.3e-32
WP_001281772.1|1536661_1536898_+	restriction alleviation protein, Lar family	NA	Q8HA09	Enterobacteria_phage	100.0	1.2e-39
WP_000814576.1|1536854_1537301_+	recombination protein NinB	NA	A0A0N7C2V1	Escherichia_phage	100.0	2.4e-81
WP_000153270.1|1537297_1537825_+	phage N-6-adenine-methyltransferase	NA	K7PJZ4	Enterobacterial_phage	100.0	9.5e-101
WP_001254228.1|1537821_1538004_+	NinE family protein	NA	A0A1U9AJF6	Stx1_converting_phage	100.0	1.1e-29
WP_001502725.1|1538507_1540280_-	hypothetical protein	NA	A0A1U9AJG3	Stx1_converting_phage	100.0	0.0e+00
WP_001108081.1|1540873_1541440_+	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	100.0	2.3e-108
WP_064032103.1|1541414_1542026_+	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	100.0	1.1e-97
WP_000144764.1|1542022_1542217_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204849.1|1542209_1542644_+	antitermination protein	NA	Q8VNP1	Enterobacteria_phage	100.0	4.3e-83
WP_000691354.1|1543150_1544098_+	Shiga toxin Stx1 subunit A	NA	Q777W4	Enterobacteria_phage	100.0	3.2e-171
WP_000752026.1|1544107_1544377_+	Shiga toxin Stx1a subunit B	NA	Q7AYI7	Enterobacteria_phage	100.0	1.6e-43
WP_171878368.1|1544880_1546821_+	DUF1737 domain-containing protein	NA	A0A1U9AJ89	Stx1_converting_phage	99.8	0.0e+00
WP_000143458.1|1546957_1547137_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|1547177_1547450_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284510.1|1547526_1547742_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001080433.1|1547746_1548280_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	100.0	4.6e-103
WP_001369534.1|1548594_1549137_+	hypothetical protein	NA	A0A1U9AJ99	Stx1_converting_phage	100.0	4.8e-100
WP_000455406.1|1549136_1549286_+	hypothetical protein	NA	A0A0P0ZFU6	Escherichia_phage	100.0	2.4e-17
WP_064032098.1|1549293_1549731_+|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	96.6	1.2e-69
WP_000839224.1|1549933_1550431_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|1550427_1550685_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_001086076.1|1551088_1551895_+	hypothetical protein	NA	A0A1U9AJA9	Stx1_converting_phage	100.0	1.7e-133
WP_000143991.1|1551875_1553582_+	hypothetical protein	NA	A0A1U9AJA6	Stx1_converting_phage	100.0	0.0e+00
WP_000787520.1|1553581_1555726_+|portal	portal protein	portal	A0A1U9AJF2	Stx1_converting_phage	100.0	0.0e+00
WP_000345010.1|1555883_1556891_+	hypothetical protein	NA	A0A2R2Z355	Escherichia_phage	100.0	2.3e-180
WP_000214474.1|1556914_1558129_+|capsid	N4-gp56 family major capsid protein	capsid	A0A2R2Z358	Escherichia_phage	100.0	1.3e-233
WP_001140442.1|1558184_1558574_+	hypothetical protein	NA	A0A2R2Z353	Escherichia_phage	100.0	9.9e-63
WP_001367376.1|1558623_1559085_+	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	100.0	6.0e-75
WP_000829200.1|1559068_1559632_+	hypothetical protein	NA	A0A2R2Z349	Escherichia_phage	100.0	3.2e-102
WP_064032097.1|1559631_1560282_+	hypothetical protein	NA	A0A2R2X2B3	Escherichia_phage	99.5	1.3e-120
WP_064234923.1|1560278_1562174_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJS9	Stx_converting_phage	100.0	1.0e-64
WP_001023473.1|1562175_1562445_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	100.0	8.4e-45
WP_001426815.1|1562586_1562775_+	hypothetical protein	NA	A0A1U9AJB8	Stx1_converting_phage	100.0	9.0e-30
WP_001146325.1|1563069_1564695_+	hypothetical protein	NA	A0A1U9AJB6	Stx1_converting_phage	100.0	0.0e+00
WP_000197192.1|1564691_1565960_+	host specificity protein J	NA	A0A2R2Z364	Escherichia_phage	100.0	4.9e-220
WP_000455634.1|1565974_1566253_+	outer membrane protein	NA	A0A2R2Z367	Escherichia_phage	100.0	1.1e-50
WP_001426808.1|1566258_1566876_+	hypothetical protein	NA	A0A1U9AJB9	Stx1_converting_phage	100.0	8.8e-122
WP_000835358.1|1566966_1567701_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A1U9AJC8	Stx1_converting_phage	100.0	1.3e-135
WP_000078907.1|1567933_1568074_+	Hok/Gef family protein	NA	A0A2R2X2B4	Escherichia_phage	100.0	3.1e-19
WP_000035558.1|1568130_1568532_+	hypothetical protein	NA	A0A2R2Z359	Escherichia_phage	100.0	3.7e-73
WP_000509481.1|1568625_1569282_+	hypothetical protein	NA	A0A2R2Z361	Escherichia_phage	100.0	2.4e-109
WP_000455649.1|1569284_1569731_+	hypothetical protein	NA	A0A2R2Z357	Escherichia_phage	100.0	6.2e-77
WP_000540394.1|1569740_1569992_+	hypothetical protein	NA	A0A2R2Z351	Escherichia_phage	100.0	7.9e-13
WP_000012455.1|1570002_1571268_+	hypothetical protein	NA	A0A1U9AJC6	Stx1_converting_phage	100.0	2.4e-206
WP_000331678.1|1571337_1579722_+	hypothetical protein	NA	A0A1U9AJC4	Stx1_converting_phage	100.0	0.0e+00
WP_000368131.1|1579943_1580876_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
1579845:1579868	attR	TTATATCCATTTAACTAAGAGGAC	NA	NA	NA	NA
>prophage 3
NZ_CP038425	Escherichia coli O157:H7 strain 2571 chromosome, complete genome	5572326	1825015	1900685	5572326	terminase,transposase,portal,tRNA,holin,tail	Enterobacteria_phage(54.17%)	83	NA	NA
WP_000569336.1|1825015_1825942_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
WP_000783120.1|1825946_1826678_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1826658_1826766_-	protein YohO	NA	NA	NA	NA	NA
WP_027868261.1|1826825_1827527_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	100.0	4.6e-103
WP_000063648.1|1827547_1828834_-	DUF3596 domain-containing protein	NA	Q9EY96	Enterobacteria_phage	100.0	7.6e-253
WP_001193437.1|1828867_1829122_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	100.0	3.0e-44
WP_000556583.1|1829140_1829275_-	hypothetical protein	NA	A0A0P0ZDP5	Stx2-converting_phage	100.0	4.9e-22
WP_000457728.1|1829278_1829521_-	DUF4222 domain-containing protein	NA	B6DZ51	Enterobacteria_phage	100.0	1.5e-37
WP_000610375.1|1829608_1829971_-	DUF551 domain-containing protein	NA	Q9EY98	Enterobacteria_phage	100.0	1.8e-71
WP_000207903.1|1829967_1830324_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001356547.1|1830657_1830834_-	hypothetical protein	NA	B6DZ55	Enterobacteria_phage	100.0	4.6e-28
WP_001289954.1|1830835_1831783_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|1831779_1832001_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001444000.1|1832099_1832381_-	cell division protein ZapA	NA	A0A0P0ZBQ0	Stx2-converting_phage	100.0	1.9e-47
WP_000548547.1|1832391_1832583_-	DUF1382 family protein	NA	A0A1I9LJM8	Stx_converting_phage	100.0	1.9e-27
WP_001303590.1|1832555_1832738_-	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	100.0	7.4e-29
WP_000186740.1|1832737_1833415_-	YqaJ viral recombinase family protein	NA	A0A1I9LJM9	Stx_converting_phage	100.0	4.6e-132
WP_000100847.1|1833411_1834197_-	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000995395.1|1834202_1834499_-	host-nuclease inhibitor protein Gam	NA	Q9EYA6	Enterobacteria_phage	100.0	4.3e-50
WP_023148105.1|1834574_1834865_-	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001362421.1|1835368_1836976_-	SIR2 family protein	NA	A0A1S5SA14	Streptococcus_phage	49.0	6.9e-94
WP_000712399.1|1837082_1837775_-	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	86.1	2.5e-109
WP_001182876.1|1838138_1838678_+	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.6e-61
WP_000147884.1|1838674_1839694_+	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.8	9.7e-110
WP_000788906.1|1839690_1840392_+	Replication protein 14	NA	Q9EYB6	Enterobacteria_phage	100.0	5.8e-130
WP_000145928.1|1840388_1840673_+	hypothetical protein	NA	A0A0P0ZCJ0	Stx2-converting_phage	96.7	3.7e-43
WP_001481254.1|1840900_1841098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000390541.1|1841141_1841423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072141214.1|1841513_1841615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001053021.1|1841611_1842067_+	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_000224907.1|1842066_1842237_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|1842229_1842520_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099712.1|1842516_1842879_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	96.5	4.3e-60
WP_000971055.1|1842875_1843016_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_001204769.1|1843101_1843536_+	antitermination protein	NA	G9L695	Escherichia_phage	97.2	1.3e-79
WP_001356551.1|1843784_1843937_+	DNA methylase	NA	A0A2R2Z327	Escherichia_phage	100.0	4.0e-20
WP_000142932.1|1844740_1846687_+	DUF1737 domain-containing protein	NA	A0A075M342	Escherichia_Stx1-converting_recombinant_phage	98.1	0.0e+00
WP_000143458.1|1846824_1847004_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290230.1|1847044_1847290_+	DUF826 domain-containing protein	NA	A0A0P0ZGR2	Escherichia_phage	100.0	8.8e-17
WP_000284506.1|1847367_1847583_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001056806.1|1848389_1848959_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|1848958_1849105_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|1849332_1849518_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000348565.1|1850035_1850512_+	DUF1441 family protein	NA	Q9EYD0	Enterobacteria_phage	100.0	2.1e-83
WP_001077626.1|1850508_1852632_+|terminase	phage terminase large subunit family protein	terminase	S5MDQ1	Escherichia_phage	99.0	0.0e+00
WP_000102415.1|1852628_1852841_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_000974568.1|1852840_1854343_+|portal	phage portal protein	portal	S5MW34	Escherichia_phage	100.0	6.3e-291
WP_001097065.1|1856398_1856725_+	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001281350.1|1856717_1856999_+	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_000974966.1|1857001_1857625_+|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_000682716.1|1857637_1858036_+|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	100.0	5.9e-71
WP_000235090.1|1858043_1858796_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000479062.1|1858809_1859232_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_163332214.1|1859258_1859357_+	hypothetical protein	NA	Q687F4	Enterobacteria_phage	96.9	1.5e-12
WP_000998048.1|1859390_1860929_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|1860978_1861326_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|1861322_1861703_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_097331591.1|1861753_1862017_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	95.1	1.1e-36
WP_151589247.1|1862060_1864706_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847298.1|1864702_1865032_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072617001.1|1865031_1865730_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	98.7	1.2e-130
WP_054191786.1|1865740_1866484_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.1e-146
WP_064562156.1|1866429_1867059_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	99.5	1.2e-105
WP_171878369.1|1867299_1870683_+	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	95.9	0.0e+00
WP_001230459.1|1870749_1871349_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_000268879.1|1871413_1872583_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	100.0	4.3e-85
WP_001023396.1|1872584_1872854_+|tail	phage tail fiber C-terminal domain-containing protein	tail	B6DZB8	Enterobacteria_phage	100.0	3.8e-45
WP_072142879.1|1873014_1873431_+	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	100.0	2.2e-76
WP_001143784.1|1873512_1874154_+	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	100.0	6.8e-109
WP_001261939.1|1874315_1874564_-	DinI-like family protein	NA	B6DZC1	Enterobacteria_phage	100.0	1.4e-38
WP_001301761.1|1875078_1876764_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	100.0	1.7e-305
WP_000598641.1|1876760_1877480_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1877526_1877997_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1878038_1878500_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001087225.1|1878624_1880628_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	100.0	0.0e+00
WP_001302810.1|1880624_1881761_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	100.0	1.9e-167
WP_000528951.1|1881753_1882485_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294377.1|1882503_1884033_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001302026.1|1884043_1885132_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000636932.1|1886372_1886690_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000356841.1|1886751_1890381_-	DUF4132 domain-containing protein	NA	NA	NA	NA	NA
WP_162829202.1|1896683_1897896_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001457618.1|1898651_1900685_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.0e-54
>prophage 4
NZ_CP038425	Escherichia coli O157:H7 strain 2571 chromosome, complete genome	5572326	1926334	1964400	5572326	capsid,terminase,portal,tRNA,head,holin,integrase,tail,plate,lysis	Escherichia_phage(62.22%)	50	1928115:1928142	1960074:1960101
WP_000807362.1|1926334_1927234_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	1.3e-12
WP_001303579.1|1927639_1927957_+	hypothetical protein	NA	NA	NA	NA	NA
1928115:1928142	attL	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_000985260.1|1928221_1929235_-|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.4	8.3e-194
WP_000020919.1|1929350_1929650_-	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_001081582.1|1929771_1930047_+	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	100.0	1.3e-48
WP_001005162.1|1930057_1930228_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217673.1|1930224_1930725_+	hypothetical protein	NA	M1SV55	Escherichia_phage	99.4	1.7e-91
WP_000557698.1|1930788_1931013_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	97.3	5.2e-32
WP_001277898.1|1931012_1931312_+	DUF5405 family protein	NA	S4TUD1	Salmonella_phage	99.0	3.2e-45
WP_001113265.1|1931314_1931539_+	TraR/DksA C4-type zinc finger protein	NA	S4TRY6	Salmonella_phage	98.6	3.2e-34
WP_000027664.1|1931535_1931811_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_000268574.1|1931800_1934083_+	replication endonuclease	NA	M1SV59	Escherichia_phage	91.3	0.0e+00
WP_000063136.1|1934172_1935396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001302413.1|1935442_1935895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000844437.1|1935894_1937862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038161.1|1938179_1939214_-|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	100.0	1.9e-201
WP_000156848.1|1939213_1940986_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	99.7	0.0e+00
WP_001085952.1|1941159_1942014_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_001248594.1|1942072_1943146_+|capsid	phage major capsid protein, P2 family	capsid	Q83VT1	Escherichia_phage	99.2	1.6e-200
WP_000203418.1|1943149_1943893_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	97.6	7.3e-123
WP_000988633.1|1943992_1944502_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	100.0	1.1e-90
WP_000846406.1|1944501_1944705_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	98.5	5.2e-31
WP_000123123.1|1944708_1944990_+|holin	holin	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_001144101.1|1944989_1945487_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000736555.1|1945501_1945927_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	98.6	1.2e-61
WP_000040644.1|1945914_1946340_+|lysis	LysB family phage lysis regulatory protein	lysis	A0A0F7LDJ6	Escherichia_phage	94.3	2.0e-64
WP_001300730.1|1946311_1946485_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	94.7	5.2e-24
WP_000917144.1|1946447_1946915_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	98.7	2.5e-81
WP_001001809.1|1946907_1947360_+	phage virion morphogenesis protein	NA	A0A0F7LBV9	Escherichia_phage	98.0	2.0e-75
WP_001093728.1|1947426_1948062_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	98.1	2.9e-112
WP_000127154.1|1948058_1948406_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	99.1	6.5e-58
WP_001121479.1|1948410_1949319_+|plate	baseplate assembly protein	plate	A0A0F7LCQ9	Escherichia_phage	99.7	7.5e-162
WP_001285352.1|1949311_1949923_+|tail	phage tail protein I	tail	A0A0F7LA36	Escherichia_phage	99.5	3.8e-117
WP_000217043.1|1949919_1951119_+|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	98.5	2.0e-215
WP_001008233.1|1951139_1951583_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	99.3	4.9e-82
WP_001057694.1|1951554_1952157_-|tail	tail fiber assembly protein	tail	A0A0F7LDQ5	Escherichia_phage	91.0	1.5e-97
WP_171878401.1|1952156_1952627_-|tail	tail fiber protein	tail	A0A0F7LCR3	Escherichia_phage	98.7	1.9e-84
WP_000905094.1|1952716_1953310_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	97.5	2.1e-104
WP_001286704.1|1953369_1954560_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.0	2.6e-223
WP_001251408.1|1954572_1955091_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|1955147_1955423_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_001496926.1|1955455_1955575_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	97.4	1.4e-15
WP_000069957.1|1955567_1958015_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	96.3	0.0e+00
WP_000978913.1|1958029_1958509_+|tail	phage tail protein	tail	Q7Y4C7	Escherichia_virus	98.7	3.3e-84
WP_000882933.1|1958508_1959672_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	98.4	1.7e-203
WP_000468308.1|1959753_1959972_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_000476014.1|1960245_1961607_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.7	1.9e-217
1960074:1960101	attR	TAAAAAATAAGCCCGTGTAAGGGAGATT	NA	NA	NA	NA
WP_001301848.1|1961754_1962087_-	YegP family protein	NA	NA	NA	NA	NA
WP_000137884.1|1962277_1963000_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.6	2.9e-31
WP_000675144.1|1962996_1964400_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.4	1.2e-33
>prophage 5
NZ_CP038425	Escherichia coli O157:H7 strain 2571 chromosome, complete genome	5572326	2047624	2189472	5572326	protease,capsid,terminase,transposase,portal,head,holin,integrase,tail,lysis	Stx2-converting_phage(47.69%)	167	2044242:2044256	2147117:2147131
2044242:2044256	attL	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_001007947.1|2047624_2048803_+|integrase	site-specific integrase	integrase	A0A0P0ZDN8	Stx2-converting_phage	100.0	1.8e-232
WP_000132739.1|2048783_2048975_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_001281188.1|2049056_2049401_-	hypothetical protein	NA	A0A0P0ZB93	Stx2-converting_phage	100.0	9.0e-60
WP_000610373.1|2049588_2049939_-	DUF551 domain-containing protein	NA	A0A0N7KZ94	Stx2-converting_phage	100.0	7.8e-67
WP_000207903.1|2049935_2050292_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	100.0	3.1e-63
WP_001289954.1|2050805_2051753_-	ead/Ea22-like family protein	NA	A0A0P0ZE96	Stx2-converting_phage	100.0	3.6e-183
WP_000763383.1|2051749_2051971_-	TraR/DksA family transcriptional regulator	NA	A0A1I9LJM6	Stx_converting_phage	100.0	2.9e-35
WP_001395510.1|2052069_2052351_-	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000548531.1|2052361_2052553_-	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_000682304.1|2052525_2052708_-	DUF1317 domain-containing protein	NA	A0A0P0ZD61	Stx2-converting_phage	100.0	7.4e-29
WP_054428303.1|2052704_2053385_-	YqaJ viral recombinase family protein	NA	A0A0P0ZCQ7	Stx2-converting_phage	100.0	1.2e-132
WP_000100845.1|2053381_2054167_-	phage recombination protein Bet	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	1.1e-148
WP_000995487.1|2054172_2054469_-	host-nuclease inhibitor protein Gam	NA	A0A0P0ZE86	Stx2-converting_phage	100.0	3.3e-50
WP_000372937.1|2054543_2054687_-	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001198861.1|2054655_2054820_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000065362.1|2054892_2055261_-	DUF2528 family protein	NA	A0A0N7C1W2	Escherichia_phage	100.0	2.0e-65
WP_000394299.1|2055443_2055695_-	hypothetical protein	NA	A4KWV4	Enterobacteria_phage	100.0	5.6e-43
WP_000088203.1|2055753_2056026_-	hypothetical protein	NA	A0A0N7C217	Escherichia_phage	100.0	5.7e-41
WP_000438343.1|2056003_2056186_-	hypothetical protein	NA	A0A0N7C057	Escherichia_phage	100.0	2.8e-28
WP_001130059.1|2056754_2057276_-	hypothetical protein	NA	A0A0N7BTU4	Escherichia_phage	100.0	1.8e-88
WP_001302016.1|2057777_2058473_-	LexA family transcriptional regulator	NA	A0A0N7BTS4	Escherichia_phage	100.0	8.6e-134
WP_000067727.1|2058548_2058764_+	helix-turn-helix transcriptional regulator	NA	A0A0N7C2U7	Escherichia_phage	100.0	2.2e-35
WP_000442612.1|2058905_2059202_+	hypothetical protein	NA	A4KWW1	Enterobacteria_phage	100.0	4.0e-48
WP_000166961.1|2059234_2059396_+	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000539354.1|2059382_2060204_+	replication protein	NA	A0A0N7KZ97	Stx2-converting_phage	100.0	2.0e-153
WP_001248388.1|2060200_2061577_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	100.0	5.7e-254
WP_001000130.1|2061647_2061926_+	hypothetical protein	NA	Q9EYB9	Enterobacteria_phage	100.0	4.4e-49
WP_000103678.1|2062058_2062274_+	hypothetical protein	NA	A0A0N7KZ98	Stx2-converting_phage	100.0	7.7e-33
WP_042819913.1|2062284_2062521_+	restriction alleviation protein, Lar family	NA	A0A0P0ZEB1	Stx2-converting_phage	100.0	1.6e-39
WP_097331918.1|2062477_2062924_+	recombination protein NinB	NA	A0A0P0ZEG6	Stx2-converting_phage	100.0	1.4e-81
WP_000153280.1|2062920_2063448_+	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	100.0	9.5e-101
WP_001254258.1|2063444_2063639_+	NinE family protein	NA	A0A0P0ZC71	Stx2-converting_phage	100.0	2.9e-31
WP_001502690.1|2063895_2064570_+	phage antirepressor Ant	NA	A0A0P0ZD80	Stx2-converting_phage	100.0	4.7e-129
WP_000924600.1|2064644_2065046_+	hypothetical protein	NA	G9L690	Escherichia_phage	100.0	1.4e-72
WP_001563210.1|2065005_2065215_+	protein ninF	NA	G9L691	Escherichia_phage	100.0	1.4e-31
WP_001292290.1|2065207_2065930_+	phage regulatory/antirepressor protein	NA	G9L692	Escherichia_phage	100.0	9.2e-131
WP_001108022.1|2065929_2066535_+	recombination protein NinG	NA	G9L693	Escherichia_phage	100.0	8.6e-98
WP_000144764.1|2066531_2066726_+	protein ninH	NA	G9L694	Escherichia_phage	100.0	1.9e-30
WP_001204880.1|2066718_2067153_+	antitermination protein	NA	G9L695	Escherichia_phage	100.0	2.8e-82
WP_000649751.1|2067935_2068895_+	Shiga toxin Stx2c subunit A	NA	Q5TJL6	Enterobacteria_phage	100.0	4.3e-176
WP_000738080.1|2068906_2069176_+	Shiga toxin Stx2c subunit B	NA	Q5TJL5	Enterobacteria_phage	100.0	2.1e-43
WP_001303568.1|2069472_2069796_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	100.0	6.9e-62
WP_000143109.1|2070039_2071977_+	SASA family carbohydrate esterase	NA	A0A0P0ZBP4	Stx2-converting_phage	99.2	0.0e+00
WP_000143458.1|2072114_2072294_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	100.0	2.2e-25
WP_001290231.1|2072334_2072607_+	DUF826 domain-containing protein	NA	A0A0P0ZBB8	Stx2-converting_phage	100.0	2.2e-21
WP_000284515.1|2072683_2072899_+|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	100.0	2.0e-33
WP_000075132.1|2072898_2073396_+	lysozyme RrrD	NA	A0A0N7KZA0	Stx2-converting_phage	100.0	2.6e-92
WP_000092318.1|2073392_2073830_+|lysis	lysis protein	lysis	A0A0P0ZBQ9	Stx2-converting_phage	100.0	2.0e-72
WP_000839224.1|2074032_2074530_+	KilA-N domain-containing protein	NA	A0A0P0ZBU2	Stx2-converting_phage	100.0	3.6e-94
WP_001283921.1|2074526_2074784_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_000095749.1|2075246_2075474_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	100.0	3.9e-35
WP_001303046.1|2075515_2075881_+	HNH endonuclease	NA	A0A0P0ZCH0	Stx2-converting_phage	100.0	2.0e-65
WP_000958387.1|2076172_2076736_+|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_001457603.1|2076732_2078394_+|terminase	terminase large subunit	terminase	A0A0P0ZEI4	Stx2-converting_phage	100.0	0.0e+00
WP_171878371.1|2078457_2080395_+|capsid	phage major capsid protein	capsid	A0A0P0ZE40	Stx2-converting_phage	100.0	0.0e+00
WP_001063023.1|2080439_2080661_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	98.6	3.8e-35
WP_000126019.1|2083187_2083514_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_001007901.1|2083523_2083874_+|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000573374.1|2083870_2084317_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_000133388.1|2084313_2084658_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_001275508.1|2084716_2085433_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2085438_2085813_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001453698.1|2085908_2086118_+	DUF4035 domain-containing protein	NA	A0A0P0ZDE6	Stx2-converting_phage	100.0	2.0e-33
WP_171878372.1|2086170_2089413_+|tail	phage tail tape measure protein	tail	A0A0P0ZE78	Stx2-converting_phage	99.9	0.0e+00
WP_000807954.1|2089405_2089747_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179516.1|2089746_2090445_+|tail	phage minor tail protein L	tail	A0A0P0ZD82	Stx2-converting_phage	100.0	1.5e-133
WP_001302649.1|2090461_2090782_-	Arc family DNA-binding protein	NA	A0A0P0ZBD1	Stx2-converting_phage	100.0	3.0e-49
WP_001154345.1|2090889_2091063_+	Arc family DNA-binding protein	NA	A0A0P0ZC65	Stx2-converting_phage	100.0	3.4e-23
WP_001428824.1|2091133_2092057_+	phage antirepressor Ant	NA	A0A0N7KZK0	Stx2-converting_phage	100.0	1.3e-177
WP_171878373.1|2092111_2092849_+|tail	phage tail protein	tail	A0A0P0ZDJ9	Stx2-converting_phage	100.0	3.1e-150
WP_171878402.1|2092794_2093427_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	99.5	2.4e-106
WP_171878374.1|2093665_2097148_+	host specificity protein J	NA	A0A0P0ZDT4	Stx2-converting_phage	100.0	0.0e+00
WP_001230459.1|2097214_2097814_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_171878375.1|2097878_2099192_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	100.0	4.3e-86
WP_001023352.1|2099193_2099463_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_000491542.1|2099602_2100478_+	hypothetical protein	NA	A0A0P0ZCT1	Stx2-converting_phage	100.0	1.5e-162
WP_001121226.1|2100702_2101353_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.5	4.1e-122
WP_001303036.1|2102677_2103844_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.7	4.5e-228
WP_001105393.1|2103962_2104436_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001202488.1|2104634_2105693_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2105864_2106194_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016346.1|2106294_2106477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001304123.1|2106965_2107079_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988600.1|2107091_2107286_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001285587.1|2107744_2108113_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2108186_2108408_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001186192.1|2108470_2108947_-	RadC family protein	NA	NA	NA	NA	NA
WP_000860079.1|2108961_2109441_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	6.8e-13
WP_001234544.1|2109522_2110344_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.5	3.6e-46
WP_000846711.1|2110564_2110975_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001502562.1|2110990_2111674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000102660.1|2111809_2112880_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_000203545.1|2112876_2113782_-	chemotaxis protein	NA	NA	NA	NA	NA
WP_000638172.1|2113778_2114660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162829204.1|2114643_2115857_-|transposase	IS3 family transposase	transposase	Q6H9S6	Enterobacteria_phage	97.6	8.2e-164
WP_000966626.1|2116228_2118376_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000998048.1|2119823_2121362_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|2121411_2121759_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|2121755_2122136_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000973176.1|2122497_2123043_+	bifunctional adenosylcobinamide kinase/adenosylcobinamide-phosphate guanylyltransferase	NA	NA	NA	NA	NA
WP_001295633.1|2123039_2123783_+	adenosylcobinamide-GDP ribazoletransferase	NA	NA	NA	NA	NA
WP_001193830.1|2123794_2124874_+	nicotinate-nucleotide--dimethylbenzimidazole phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000986334.1|2124935_2125871_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001011474.1|2126327_2127245_+	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_001011000.1|2127346_2128297_+	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_122989775.1|2128414_2130058_+	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_000532909.1|2130683_2131400_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_097209405.1|2131742_2133197_-	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000378596.1|2133298_2134615_-	shikimate transporter	NA	NA	NA	NA	NA
WP_000480501.1|2134928_2135981_+	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_014714124.1|2136242_2144225_-	inverse autotransporter adhesin-like protein YeeJ	NA	NA	NA	NA	NA
WP_001302302.1|2144714_2145512_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533600.1|2145747_2146770_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.4	2.0e-99
WP_000094838.1|2146769_2146973_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_000034457.1|2147031_2149503_-	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
2147117:2147131	attR	TGGCGTTCACCTTCG	NA	NA	NA	NA
WP_000199485.1|2149598_2149787_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449168.1|2149783_2149972_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000367376.1|2150452_2150605_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.7e-07
WP_000444607.1|2150879_2151524_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	24.9	2.8e-06
WP_001261752.1|2151621_2151849_+	cell division protein	NA	NA	NA	NA	NA
WP_000693816.1|2151845_2152271_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_001262409.1|2152339_2153377_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	68.3	1.1e-87
WP_072143023.1|2153288_2153831_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	96.7	6.4e-84
WP_000450610.1|2153865_2154564_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	59.5	1.6e-71
WP_000702797.1|2154585_2154810_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	42.3	3.6e-09
WP_001290006.1|2154806_2155163_+	hypothetical protein	NA	A0A222YY85	Escherichia_phage	65.8	3.1e-15
WP_001414276.1|2155195_2155348_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000111243.1|2155344_2155656_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	83.5	2.4e-51
WP_000137954.1|2155782_2156346_+	hypothetical protein	NA	H6WZG0	Escherichia_phage	94.9	4.5e-48
WP_001278461.1|2156455_2156560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000902687.1|2156746_2156959_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	7.6e-25
WP_001310296.1|2157126_2157405_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	1.3e-11
WP_001265075.1|2157406_2158456_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.3e-109
WP_000904141.1|2158468_2158828_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	64.9	1.5e-36
WP_001059369.1|2158824_2159514_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	1.5e-58
WP_000023257.1|2161053_2162904_+	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.4	0.0e+00
WP_162829202.1|2162985_2164199_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_024165672.1|2164510_2164726_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	98.6	7.7e-33
WP_000731204.1|2164730_2165075_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	99.1	1.7e-58
WP_000992126.1|2165125_2165659_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	97.7	1.4e-99
WP_001303555.1|2165814_2165997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280929.1|2166009_2166141_+	hypothetical protein	NA	A0A0N7BYT9	Escherichia_phage	88.4	9.4e-10
WP_001208680.1|2166368_2166554_+	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_001302690.1|2167080_2167395_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001299328.1|2167476_2167701_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	92.7	4.1e-21
WP_000235421.1|2168095_2168371_+	hypothetical protein	NA	A0A1I9KFT4	Aeromonas_phage	51.5	2.4e-10
WP_001171554.1|2168446_2168827_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|2168823_2169171_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|2169220_2170759_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001442367.1|2171022_2171307_+|terminase	phage terminase large subunit family protein	terminase	K7PGW7	Enterobacteria_phage	63.6	1.6e-25
WP_000259002.1|2172921_2173128_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_097209410.1|2173124_2174717_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.3	3.3e-181
WP_001254002.1|2174706_2176212_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_000256723.1|2176248_2176596_+|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001301534.1|2176653_2176920_+|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_029208397.1|2176901_2177642_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_000479117.1|2177655_2178087_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_000533402.1|2178113_2178527_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_171878376.1|2178507_2181087_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	82.1	0.0e+00
WP_000847298.1|2181083_2181413_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_096860299.1|2181412_2182111_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_001372130.1|2182121_2182865_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	97.6	1.9e-147
WP_071601640.1|2182810_2183440_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	95.2	2.3e-101
WP_171878377.1|2183680_2187157_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	95.2	0.0e+00
WP_001230459.1|2187223_2187823_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_171878378.1|2187887_2189201_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.3	1.3e-77
WP_001023407.1|2189202_2189472_+|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
>prophage 6
NZ_CP038425	Escherichia coli O157:H7 strain 2571 chromosome, complete genome	5572326	2246990	2266976	5572326	integrase,tail,transposase	Enterobacteria_phage(75.0%)	28	2260112:2260125	2270118:2270131
WP_032161583.1|2246990_2248127_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_000132765.1|2248077_2248401_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	97.8	2.1e-42
WP_000005444.1|2248558_2249743_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	96.7	1.7e-219
WP_000290456.1|2249742_2250255_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	99.4	2.1e-92
WP_000665314.1|2250309_2250675_+|tail	tail protein	tail	A0A0A7NPZ0	Enterobacteria_phage	98.3	1.7e-56
WP_000333495.1|2250683_2250839_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	100.0	8.8e-23
WP_000979955.1|2253641_2254130_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	100.0	1.0e-85
WP_000954203.1|2254286_2254859_+	serine acetyltransferase	NA	A0A1L2JYI5	Streptococcus_phage	34.4	1.0e-07
WP_001310336.1|2254902_2255433_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	88.0	3.5e-87
WP_000211280.1|2256524_2256839_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	52.9	1.1e-19
WP_000686523.1|2256843_2257803_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.1	1.2e-178
WP_000123463.1|2257879_2260702_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	97.7	0.0e+00
2260112:2260125	attL	TTCGAAGGTGCTGC	NA	NA	NA	NA
WP_000599379.1|2260708_2261074_-	hypothetical protein	NA	A0A0A7NRY1	Enterobacteria_phage	96.7	6.6e-61
WP_001310314.1|2261070_2261688_-	ash family protein	NA	S5MQL6	Escherichia_phage	46.2	2.1e-06
WP_000104305.1|2261699_2261999_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	89.9	1.6e-41
WP_000153707.1|2261995_2262262_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	77.3	3.1e-31
WP_000985157.1|2262258_2262462_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000991913.1|2262485_2262902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021655.1|2262994_2263108_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	100.0	6.2e-10
WP_000514287.1|2263104_2263347_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	98.8	1.2e-37
WP_000159449.1|2263358_2263637_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	80.4	4.8e-35
WP_000739029.1|2263647_2263998_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	81.9	8.6e-50
WP_000014504.1|2264019_2264223_-	DNA-binding protein	NA	P79674	Haemophilus_phage	45.2	3.1e-07
WP_001673482.1|2264294_2264432_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000786773.1|2264521_2264926_+	transcriptional regulator	NA	Q6QID2	Burkholderia_phage	53.8	2.7e-23
WP_000290345.1|2264941_2265592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000865208.1|2265621_2265969_+	DUF2511 domain-containing protein	NA	NA	NA	NA	NA
WP_001300279.1|2265974_2266976_+|integrase	tyrosine-type recombinase/integrase	integrase	Q94N03	Haemophilus_virus	58.5	4.2e-105
2270118:2270131	attR	GCAGCACCTTCGAA	NA	NA	NA	NA
>prophage 7
NZ_CP038425	Escherichia coli O157:H7 strain 2571 chromosome, complete genome	5572326	2586234	2733107	5572326	protease,capsid,terminase,portal,tRNA,head,holin,integrase,tail,lysis	Enterobacteria_phage(31.13%)	172	2594485:2594500	2689839:2689854
WP_001260835.1|2586234_2587056_-|protease	serine protease	protease	NA	NA	NA	NA
WP_000233090.1|2587155_2587239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000743952.1|2587331_2587667_-	acid shock protein	NA	NA	NA	NA	NA
WP_000091829.1|2588063_2589317_-	MFS transporter	NA	NA	NA	NA	NA
WP_001502517.1|2589423_2590317_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000225276.1|2590451_2591672_+	DNA-binding transcriptional repressor Mlc	NA	NA	NA	NA	NA
WP_000919231.1|2591796_2592492_+	ATP-dependent dethiobiotin synthetase BioD	NA	NA	NA	NA	NA
WP_071525082.1|2592444_2593737_-	voltage-gated ClC-type chloride channel ClcB	NA	NA	NA	NA	NA
WP_000148710.1|2593894_2594509_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
2594485:2594500	attL	TATCTTGCTGTGAAAA	NA	NA	NA	NA
WP_000526515.1|2594551_2595406_-	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000213028.1|2595407_2596025_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_001414236.1|2596035_2598459_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.3e-208
WP_000041704.1|2598519_2600946_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	1.1e-212
WP_000778147.1|2601144_2601450_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001303515.1|2601557_2602268_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2602270_2602831_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705189.1|2602865_2603207_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001302046.1|2603341_2603668_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000005552.1|2604656_2604908_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_000048458.1|2604980_2607452_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	60.1	3.2e-58
WP_001090200.1|2607544_2607736_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000449192.1|2607732_2607921_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001331716.1|2608321_2608486_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171930.1|2608489_2608708_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001240334.1|2608779_2609079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303511.1|2609431_2609710_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_001302048.1|2609711_2609903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001169686.1|2609923_2610295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000172738.1|2610392_2610695_+	transcriptional regulator	NA	K7PHA1	Enterobacteria_phage	34.8	8.6e-06
WP_000693943.1|2610691_2611117_+	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000095669.1|2611139_2612102_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	57.3	4.8e-82
WP_000788938.1|2612108_2612849_+	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	90.2	4.6e-125
WP_001118159.1|2613659_2614055_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	7.8e-31
WP_000206793.1|2614111_2614696_+	DUF551 domain-containing protein	NA	A0A0P0ZD75	Stx2-converting_phage	84.8	1.9e-33
WP_001278450.1|2614811_2614916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000887477.1|2615104_2615317_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_012779366.1|2615484_2615763_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_001265161.1|2615764_2616814_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.7	1.4e-108
WP_001217455.1|2616826_2617186_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	67.5	5.9e-38
WP_001059381.1|2617182_2617872_+	antiterminator	NA	I6PDF8	Cronobacter_phage	51.1	4.0e-59
WP_001303509.1|2618509_2618938_+	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	97.8	4.4e-64
WP_171878379.1|2619416_2621267_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.2	0.0e+00
WP_029785460.1|2621701_2621917_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_000731236.1|2621921_2622266_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992137.1|2622316_2622850_+	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_001056806.1|2623120_2623690_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000539792.1|2623689_2623836_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2624063_2624249_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000095736.1|2624673_2624901_-	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_000279786.1|2624942_2625308_+	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000958416.1|2625597_2626161_+|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_038425863.1|2626157_2627819_+|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	99.8	0.0e+00
WP_000173030.1|2627882_2629820_+|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001063099.1|2629864_2630086_+	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000125988.1|2632613_2632940_+|head,tail	phage gp6-like head-tail connector protein	head,tail	B6ETF0	Enterobacteria_phage	100.0	7.0e-54
WP_001007905.1|2632949_2633300_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573391.1|2633296_2633743_+	HK97 gp10 family phage protein	NA	A0A0N7KZI9	Stx2-converting_phage	100.0	5.2e-76
WP_000133388.1|2633739_2634084_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_021569169.1|2634142_2634859_+	immunoglobulin domain-containing protein	NA	B6DZA6	Enterobacteria_phage	99.2	1.0e-126
WP_000710952.1|2634873_2635248_+|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001453746.1|2635343_2635553_+	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000212827.1|2635600_2638843_+|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	100.0	0.0e+00
WP_000807954.1|2638835_2639177_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_001179478.1|2639176_2639875_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	3.1e-131
WP_000170104.1|2639891_2640146_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_010904626.1|2640255_2640366_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_000835336.1|2640668_2641547_+	phage repressor protein/antirepressor Ant	NA	I6R977	Salmonella_phage	77.2	2.5e-93
WP_000967274.1|2641600_2642338_+|tail	phage tail protein	tail	B6ETG2	Enterobacteria_phage	99.6	9.1e-150
WP_071526731.1|2642283_2642520_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	80.3	2.8e-20
WP_115801847.1|2642532_2642622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301673.1|2642641_2644990_+	type III secretion system effector E3 ubiquitin ligase NleL	NA	NA	NA	NA	NA
WP_001301984.1|2645580_2648982_+	type III secretion system effector EspN	NA	A0A0N7KZG3	Stx2-converting_phage	39.2	1.7e-219
WP_001303921.1|2651290_2651566_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000938118.1|2651626_2652988_-	type III secretion system effector EspK	NA	Q9MBM1	Phage_Gifsy-1	29.2	1.4e-50
WP_000799385.1|2653351_2654215_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2654198_2655335_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2655584_2656811_+	peptidase T	NA	NA	NA	NA	NA
WP_001301987.1|2656859_2657981_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000085269.1|2658229_2659459_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	55.6	1.1e-131
WP_000953274.1|2659824_2660013_+	AlpA family transcriptional regulator	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.0	1.5e-13
WP_001502337.1|2660065_2661343_+	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_000076671.1|2661339_2661570_+	hypothetical protein	NA	A0A1W6JPD9	Morganella_phage	49.1	4.5e-07
WP_000336141.1|2661559_2661784_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000551751.1|2661776_2662142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001502338.1|2662134_2662356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204996.1|2662357_2662591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000770163.1|2662596_2662896_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_000833614.1|2662892_2664290_+	AAA family ATPase	NA	A0A2H4JFA4	uncultured_Caudovirales_phage	49.0	4.3e-116
WP_001080642.1|2664492_2664744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001294169.1|2664740_2665046_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000126670.1|2665055_2665466_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000233311.1|2665478_2665751_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001132080.1|2665876_2666101_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001137338.1|2666392_2667550_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	64.6	8.1e-137
WP_000504047.1|2667589_2668162_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	63.5	1.6e-61
WP_000267608.1|2668163_2669375_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	79.5	1.9e-189
WP_001020669.1|2669371_2669710_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	53.6	1.7e-31
WP_000134114.1|2669706_2670003_+|head,tail	phage head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	65.3	2.4e-32
WP_001145906.1|2670002_2670443_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	73.3	1.9e-62
WP_000174068.1|2670426_2670609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000113645.1|2670731_2671088_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	81.4	9.4e-52
WP_001502340.1|2671071_2672733_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	81.0	4.9e-276
WP_000133415.1|2672746_2673028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000735407.1|2673643_2675104_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265474.1|2675103_2675775_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423729.1|2675943_2677314_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	4.2e-108
WP_001301618.1|2677317_2677959_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001301861.1|2677994_2679101_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476093.1|2679154_2679616_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_001248690.1|2679625_2680279_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_000444477.1|2680450_2681701_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
WP_000741454.1|2681814_2682957_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	100.0	8.1e-206
WP_000088655.1|2682946_2683183_-	excisionase	NA	NA	NA	NA	NA
WP_171878380.1|2684107_2684809_+	Replication protein P	NA	A0A0P0ZD31	Stx2-converting_phage	99.1	8.4e-129
WP_000145915.1|2684805_2685108_+	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001070446.1|2685175_2685508_+	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_001302833.1|2685572_2685695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000709077.1|2685752_2687279_+	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001053040.1|2687780_2688236_+	recombination protein NinB	NA	I6PD71	Cronobacter_phage	64.9	8.6e-58
WP_000224907.1|2688235_2688406_+	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	5.3e-13
WP_000774504.1|2688398_2688689_+	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	92.7	2.8e-46
WP_001099695.1|2688685_2689048_+	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	95.7	7.3e-60
WP_000971093.1|2689044_2689185_+	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	71.1	7.7e-10
WP_001097228.1|2689181_2689871_+	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.9	1.7e-57
2689839:2689854	attR	TTTTCACAGCAAGATA	NA	NA	NA	NA
WP_000544528.1|2690192_2690498_+|holin	phage holin family protein	holin	A0A286N2Q5	Klebsiella_phage	87.6	7.0e-40
WP_001180487.1|2690484_2690961_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	4.3e-84
WP_010917798.1|2691177_2691360_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	93.3	4.7e-15
WP_000738495.1|2691450_2691744_-	serum resistance lipoprotein Bor	NA	K7PL54	Enterobacteria_phage	99.0	1.5e-47
WP_000079504.1|2692035_2692446_-	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	98.5	2.7e-71
WP_001031427.1|2692731_2692938_+	hypothetical protein	NA	A0A0K2FJ18	Enterobacteria_phage	100.0	5.8e-30
WP_001300120.1|2693102_2693297_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	98.4	1.5e-27
WP_000453564.1|2693685_2694231_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	97.8	2.6e-93
WP_024251565.1|2694205_2696131_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.2	0.0e+00
WP_000198153.1|2696127_2696334_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001301524.1|2696330_2697932_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000123254.1|2697912_2699232_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001295978.1|2699241_2699574_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000063265.1|2699629_2700655_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158906.1|2700696_2701095_+	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000753016.1|2701106_2701460_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	92.3	1.9e-57
WP_000975020.1|2701474_2702008_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	66.7	5.9e-58
WP_000683063.1|2702004_2702400_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	81.7	3.3e-58
WP_000235090.1|2702407_2703160_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_001502385.1|2703173_2703596_+|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	98.6	9.7e-72
WP_000532073.1|2703622_2703931_+|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_151589247.1|2703974_2706620_+|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	99.8	0.0e+00
WP_000847298.1|2706616_2706946_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_072617001.1|2706945_2707644_+|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	98.7	1.2e-130
WP_054191786.1|2707654_2708398_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.1e-146
WP_064562156.1|2708343_2708973_+|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	99.5	1.2e-105
WP_171878381.1|2709213_2712690_+	host specificity protein J	NA	Q687E8	Enterobacteria_phage	95.2	0.0e+00
WP_024201786.1|2712756_2713356_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	95.5	4.5e-107
WP_137067334.1|2713415_2714723_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	95.2	2.4e-68
WP_001023481.1|2714724_2714994_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	97.8	2.1e-43
WP_000692020.1|2716127_2716718_+	protein kinase	NA	NA	NA	NA	NA
WP_001460318.1|2717120_2717267_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001079499.1|2717756_2718263_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001056499.1|2718308_2718809_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000807651.1|2718894_2719074_-	general stress protein	NA	NA	NA	NA	NA
WP_000443092.1|2719454_2720261_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_000209521.1|2720260_2721454_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000983857.1|2721465_2722827_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763520.1|2722827_2724423_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.2	5.0e-52
WP_001194607.1|2724422_2725985_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_001700591.1|2726076_2726121_-	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001285675.1|2726258_2727140_+	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001295575.1|2727136_2727757_+	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001302160.1|2727784_2729368_+	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001291216.1|2729580_2730453_+	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001278878.1|2730492_2731083_-	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_000559268.1|2731079_2731838_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	6.7e-07
WP_000422055.1|2732057_2733107_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
>prophage 8
NZ_CP038425	Escherichia coli O157:H7 strain 2571 chromosome, complete genome	5572326	2816746	2871060	5572326	capsid,terminase,tRNA,head,holin,tail	Stx2-converting_phage(38.98%)	67	NA	NA
WP_000628061.1|2816746_2817979_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|2818233_2819217_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001625136.1|2819491_2819662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000123746.1|2819694_2821068_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001502424.1|2821196_2822132_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	99.2	7.7e-146
WP_001358842.1|2822183_2823419_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.5	2.3e-238
WP_000079602.1|2823420_2823636_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	98.6	2.3e-37
WP_001302840.1|2823735_2823924_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001502425.1|2824167_2824977_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	6.8e-106
WP_001502426.1|2824969_2827570_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.2	5.1e-248
WP_001502427.1|2827671_2827947_-	bacteriophage protein	NA	A0A0U2QW85	Escherichia_phage	95.6	5.2e-42
WP_065336296.1|2828020_2828191_-	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	1.0e-16
WP_000560228.1|2828190_2828412_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.4e-37
WP_097209398.1|2828458_2829310_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	66.0	1.8e-64
WP_001502430.1|2829722_2829902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001502431.1|2829891_2830254_-	hypothetical protein	NA	I6PDF6	Cronobacter_phage	77.5	1.7e-08
WP_001502432.1|2830255_2830411_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	8.0e-08
WP_000753628.1|2830808_2831270_-	helix-turn-helix domain-containing protein	NA	A0A0U2QW76	Escherichia_phage	100.0	3.4e-78
WP_001053423.1|2831377_2831653_+	helix-turn-helix domain-containing protein	NA	A0A0U2S629	Escherichia_phage	100.0	3.4e-41
WP_024231359.1|2831636_2832059_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	93.6	1.7e-68
WP_001428773.1|2832136_2832925_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	65.7	6.1e-43
WP_097209397.1|2832931_2833678_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	80.5	8.1e-114
WP_072616986.1|2833699_2834452_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	63.6	1.8e-76
WP_001502613.1|2834438_2835167_+	ead/Ea22-like family protein	NA	A0A0U2QW67	Escherichia_phage	54.8	4.3e-51
WP_000172332.1|2835163_2835649_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.1	5.7e-68
WP_001365170.1|2835645_2836530_+	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	81.6	9.6e-138
WP_072616987.1|2837043_2837706_+	DUF551 domain-containing protein	NA	A0A1U9AJ59	Stx1_converting_phage	54.5	9.5e-74
WP_001278450.1|2837821_2837926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024175526.1|2838114_2838327_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	91.4	4.0e-26
WP_000119356.1|2838537_2838717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000818161.1|2838735_2839221_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_000687443.1|2839421_2839595_+	hypothetical protein	NA	A0A0U2I1S4	Escherichia_phage	72.2	7.3e-18
WP_001502554.1|2839654_2840254_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.5	7.7e-107
WP_000228020.1|2840253_2840544_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	89.6	3.3e-47
WP_001502553.1|2840540_2841083_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.0	1.1e-75
WP_000735807.1|2841568_2841793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024175525.1|2841845_2842067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000466957.1|2842245_2842677_+	tellurite resistance TerB family protein	NA	H6WZJ6	Escherichia_phage	97.2	3.3e-67
WP_171878382.1|2843247_2845098_+	DUF1737 domain-containing protein	NA	B6DZ89	Enterobacteria_phage	98.7	0.0e+00
WP_029785460.1|2845532_2845748_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.2	1.7e-32
WP_000731236.1|2845752_2846097_+	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	100.0	1.0e-58
WP_000992168.1|2846147_2846681_+	lysozyme	NA	A0A0N7KZF9	Stx2-converting_phage	99.4	4.3e-101
WP_171878383.1|2846951_2847506_+	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	96.8	2.5e-99
WP_000539792.1|2847505_2847652_+	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_012816791.1|2847879_2848065_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000074667.1|2848489_2848717_-	DUF3950 domain-containing protein	NA	A0A0P0ZCA1	Stx2-converting_phage	98.7	1.1e-34
WP_000279796.1|2848758_2849124_+	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_000958380.1|2849414_2849978_+|terminase	terminase small subunit	terminase	A0A0P0ZD56	Stx2-converting_phage	100.0	1.1e-89
WP_171878384.1|2849974_2851636_+|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.5	0.0e+00
WP_000173079.1|2851699_2853637_+|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_001063025.1|2853681_2853903_+	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000125984.1|2856429_2856756_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001007905.1|2856766_2857117_+|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000573364.1|2857113_2857560_+	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	99.3	1.8e-76
WP_000133372.1|2857556_2857901_+	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_001275508.1|2857966_2858683_+|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_001030063.1|2858688_2859063_+|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001513217.1|2859158_2859368_+	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_171878385.1|2859415_2862658_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.1	0.0e+00
WP_000807954.1|2862650_2862992_+|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_059214312.1|2862991_2863690_+|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	4.0e-131
WP_072616989.1|2863700_2864444_+|tail	phage tail protein	tail	Q9EYE4	Enterobacteria_phage	95.1	3.0e-145
WP_140439088.1|2864389_2865022_+|tail	tail assembly protein	tail	A0A0P0ZDX8	Stx2-converting_phage	95.2	7.9e-102
WP_171878386.1|2865270_2868744_+	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.4	0.0e+00
WP_001230471.1|2868811_2869411_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	98.0	9.7e-110
WP_171878387.1|2869475_2870789_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZD68	Stx2-converting_phage	98.9	1.1e-76
WP_001023356.1|2870790_2871060_+|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A2R2Z347	Escherichia_phage	98.9	2.4e-44
>prophage 9
NZ_CP038425	Escherichia coli O157:H7 strain 2571 chromosome, complete genome	5572326	3055635	3164057	5572326	protease,capsid,terminase,portal,transposase,head,holin,integrase,tail	Enterobacteria_phage(31.07%)	130	3118819:3118833	3165269:3165283
WP_000214712.1|3055635_3055839_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527769.1|3055874_3057335_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.9e-42
WP_000347470.1|3057423_3058707_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_001120551.1|3058838_3059081_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001143804.1|3059242_3059884_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	96.7	3.8e-104
WP_001356599.1|3059965_3060595_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	91.5	6.1e-78
WP_001131658.1|3060667_3061243_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	88.9	4.1e-89
WP_001023407.1|3061356_3061626_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	1.4e-44
WP_171878388.1|3061627_3062941_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.5	1.1e-84
WP_001230459.1|3063005_3063605_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q687E7	Enterobacteria_phage	100.0	8.0e-112
WP_171878389.1|3063671_3067055_-	host specificity protein J	NA	B6DZB5	Enterobacteria_phage	95.9	0.0e+00
WP_064562156.1|3067295_3067925_-|tail	tail assembly protein	tail	A0A0P0ZEN7	Stx2-converting_phage	99.5	1.2e-105
WP_054191786.1|3067870_3068614_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.8	2.1e-146
WP_072617001.1|3068624_3069323_-|tail	phage minor tail protein L	tail	A0A0N7KZH0	Stx2-converting_phage	98.7	1.2e-130
WP_000847298.1|3069322_3069652_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_171878390.1|3069648_3072294_-|tail	phage tail tape measure protein	tail	Q687F3	Enterobacteria_phage	96.6	0.0e+00
WP_000532073.1|3072337_3072646_-|tail	phage tail assembly protein T	tail	Q687F4	Enterobacteria_phage	100.0	1.3e-54
WP_000479062.1|3072672_3073095_-|tail	phage minor tail protein G	tail	Q687F5	Enterobacteria_phage	97.9	2.2e-71
WP_000235090.1|3073108_3073861_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	100.0	5.8e-136
WP_000682708.1|3073868_3074267_-|tail	tail protein	tail	Q9EYD7	Enterobacteria_phage	99.2	1.0e-70
WP_000974966.1|3074279_3074903_-|tail	phage tail protein	tail	Q9EYD6	Enterobacteria_phage	100.0	6.6e-101
WP_001281350.1|3074905_3075187_-	DNA breaking-rejoining protein	NA	Q8VNN4	Enterobacteria_phage	97.8	3.9e-45
WP_001097065.1|3075179_3075506_-	DUF2190 family protein	NA	Q9EYD5	Enterobacteria_phage	100.0	6.1e-50
WP_001369631.1|3075593_3077573_-|protease	Clp protease ClpP	protease	Q8VNN5	Enterobacteria_phage	100.0	0.0e+00
WP_000974563.1|3077562_3079065_-|portal	phage portal protein	portal	Q8VNN6	Enterobacteria_phage	100.0	1.8e-290
WP_000102415.1|3079064_3079277_-	hypothetical protein	NA	S5MBY8	Escherichia_phage	98.6	3.0e-29
WP_001077625.1|3079273_3081397_-|terminase	phage terminase large subunit family protein	terminase	Q9EYD1	Enterobacteria_phage	100.0	0.0e+00
WP_000373407.1|3081393_3081870_-	DUF1441 family protein	NA	Q8VNN8	Enterobacteria_phage	100.0	3.3e-84
WP_000736383.1|3082288_3082513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012816791.1|3082598_3082784_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000087722.1|3083302_3083836_-	lysozyme	NA	A0A1I9LJR4	Stx_converting_phage	98.3	2.5e-101
WP_000284510.1|3083840_3084056_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001290217.1|3084132_3084405_-	DUF826 domain-containing protein	NA	A0A0P0ZC09	Stx2-converting_phage	100.0	4.8e-24
WP_000142777.1|3084445_3084625_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	96.6	1.4e-24
WP_000142971.1|3084761_3086708_-	DUF1737 domain-containing protein	NA	Q9EYC8	Enterobacteria_phage	98.0	0.0e+00
WP_000483497.1|3087211_3088270_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	99.1	2.3e-207
WP_000917735.1|3088420_3088618_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.8e-28
WP_000762904.1|3088844_3089666_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	61.2	1.2e-81
WP_000904137.1|3089662_3090037_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.4e-34
WP_001302870.1|3090049_3091099_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.5e-110
WP_001304183.1|3091100_3091379_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	46.9	1.1e-10
WP_000998188.1|3091444_3091612_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000967408.1|3091890_3092103_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	94.3	1.1e-26
WP_001278450.1|3092291_3092396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000610379.1|3092511_3092874_-	DUF551 domain-containing protein	NA	A0A0P0ZCX1	Stx2-converting_phage	98.3	8.6e-69
WP_000137941.1|3092870_3093242_-	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	78.0	1.3e-48
WP_000063625.1|3093277_3093490_-	hypothetical protein	NA	A0A2R2Z310	Escherichia_phage	87.1	1.4e-31
WP_001302146.1|3093538_3093895_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	94.9	3.7e-56
WP_001118161.1|3093951_3094347_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	51.4	1.0e-30
WP_000450888.1|3094362_3095133_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	66.0	3.8e-82
WP_000095667.1|3095910_3096864_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.7	5.2e-73
WP_000693888.1|3096886_3097312_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_024213789.1|3097295_3097571_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	54.8	1.1e-15
WP_000367559.1|3097673_3098063_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000380323.1|3098231_3098384_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	1.1e-06
WP_001302871.1|3098395_3098701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000555741.1|3098687_3098993_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000450222.1|3099556_3099745_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000092782.1|3099741_3099930_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102174.1|3100022_3102467_+	exonuclease	NA	V5UQJ3	Shigella_phage	58.3	4.9e-176
WP_000113189.1|3102531_3102780_+	excisionase	NA	NA	NA	NA	NA
WP_000113671.1|3102757_3103888_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.1	1.7e-102
WP_001345079.1|3105187_3105838_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	32.4	6.6e-27
WP_001144877.1|3107344_3107935_-	T3SS effector guanine nucleotide exchange factor EspM1	NA	NA	NA	NA	NA
WP_001303944.1|3108118_3108766_+	T3SS effector E3 ubiquitin-protein ligase NleG	NA	B6ETE1	Enterobacteria_phage	41.1	1.6e-41
WP_001414184.1|3108902_3109049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001303943.1|3109476_3109755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171554.1|3110094_3110475_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3110471_3110819_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3110868_3112407_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000938103.1|3113372_3113942_-	T3SS effector caspase inhibitor NleF	NA	NA	NA	NA	NA
WP_000950979.1|3114007_3114919_-	type III secretion system effector kinase NleH1-2	NA	A5LH48	Enterobacteria_phage	82.2	3.0e-134
WP_106409364.1|3115025_3115148_-|tail	phage tail fiber C-terminal domain-containing protein	tail	Q687E5	Enterobacteria_phage	91.3	3.8e-05
WP_001025672.1|3116745_3118071_+	type III secretion system effector NleA	NA	H6WZN2	Escherichia_phage	81.2	1.9e-214
3118819:3118833	attL	CCCACTACTGCCGCT	NA	NA	NA	NA
WP_001023474.1|3119097_3119367_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1U9AJC2	Stx1_converting_phage	98.9	3.2e-44
WP_000216532.1|3119368_3120682_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	97.9	2.1e-80
WP_001228304.1|3120833_3121433_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	96.5	1.6e-107
WP_129137390.1|3121500_3123846_-	host specificity protein J	NA	Q9EYE7	Enterobacteria_phage	99.7	0.0e+00
WP_001304109.1|3123797_3124973_-	host specificity protein J	NA	Q9EYE6	Enterobacteria_phage	96.9	1.2e-228
WP_050439450.1|3125315_3125948_-|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	97.1	3.9e-101
WP_000194720.1|3125893_3126637_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	97.6	5.0e-148
WP_059214312.1|3126647_3127346_-|tail	phage minor tail protein L	tail	A0A0P0ZBE3	Stx2-converting_phage	97.8	4.0e-131
WP_000807954.1|3127345_3127687_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_171878385.1|3127679_3130922_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	95.1	0.0e+00
WP_001513217.1|3130969_3131179_-	DUF4035 domain-containing protein	NA	H6WZM0	Escherichia_phage	100.0	1.5e-33
WP_001030063.1|3131274_3131649_-|tail	tail assembly protein	tail	A0A0N7KZA2	Stx2-converting_phage	100.0	7.8e-65
WP_001275508.1|3131654_3132371_-|tail	tail protein	tail	A0A0P0ZD29	Stx2-converting_phage	100.0	2.9e-129
WP_000133372.1|3132436_3132781_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	99.1	4.2e-57
WP_000573364.1|3132777_3133224_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	99.3	1.8e-76
WP_001007905.1|3133220_3133571_-|head	phage head closure protein	head	A0A0P0ZB28	Stx2-converting_phage	100.0	1.6e-59
WP_000125984.1|3133581_3133908_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDE0	Stx2-converting_phage	100.0	5.4e-54
WP_001063025.1|3136434_3136656_-	hypothetical protein	NA	A0A0P0ZD92	Stx2-converting_phage	100.0	5.8e-36
WP_000173079.1|3136700_3138638_-|capsid	phage major capsid protein	capsid	A0A0P0ZCT9	Stx2-converting_phage	100.0	0.0e+00
WP_171878391.1|3138701_3140363_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	99.1	0.0e+00
WP_000958416.1|3140359_3140923_-|terminase	terminase small subunit	terminase	A0A0P0ZDD1	Stx2-converting_phage	100.0	4.7e-90
WP_000279786.1|3141212_3141578_-	HNH endonuclease	NA	B6DZ96	Enterobacteria_phage	99.2	9.9e-65
WP_000095736.1|3141619_3141847_+	DUF3950 domain-containing protein	NA	A0A0P0ZE23	Stx2-converting_phage	100.0	1.7e-35
WP_012816791.1|3142271_3142457_-	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_000539792.1|3142684_3142831_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3142830_3143400_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992137.1|3143670_3144204_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	100.0	3.5e-103
WP_000731259.1|3144254_3144599_-	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	100.0	4.5e-59
WP_000284517.1|3144603_3144819_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_072617007.1|3144968_3146822_-	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	98.1	0.0e+00
WP_000935548.1|3147618_3148677_-	site-specific DNA-methyltransferase	NA	S5MDR0	Escherichia_phage	94.3	1.1e-199
WP_000917750.1|3148827_3149025_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	98.5	1.0e-28
WP_000640048.1|3149266_3149797_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	72.6	9.3e-72
WP_000904166.1|3149805_3150165_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	60.9	3.6e-35
WP_001302148.1|3150177_3151224_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.2	4.2e-108
WP_010917803.1|3151225_3151504_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	2.2e-11
WP_001217394.1|3151573_3151831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000961820.1|3152051_3152264_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	70.0	1.4e-15
WP_001449026.1|3152542_3153301_-	AcfC family adhesin Paa	NA	NA	NA	NA	NA
WP_001505071.1|3153999_3154164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774808.1|3154160_3154742_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	80.2	8.6e-79
WP_157825328.1|3154928_3155471_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	98.7	1.5e-85
WP_000020556.1|3155382_3156423_-	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	7.9e-91
WP_000705621.1|3156394_3156946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912298.1|3156929_3157157_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000787428.1|3157233_3157641_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_001240336.1|3157905_3158205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001171903.1|3158277_3158496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000394552.1|3158518_3158926_+	hypothetical protein	NA	A0A2R2Z306	Escherichia_phage	37.8	7.0e-11
WP_000920491.1|3158903_3159137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001356681.1|3159130_3159298_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449192.1|3159695_3159884_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001090200.1|3159880_3160072_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000048551.1|3160164_3162636_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	58.2	1.1e-58
WP_000113189.1|3162700_3162949_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|3162926_3164057_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
3165269:3165283	attR	AGCGGCAGTAGTGGG	NA	NA	NA	NA
>prophage 10
NZ_CP038425	Escherichia coli O157:H7 strain 2571 chromosome, complete genome	5572326	3210931	3362970	5572326	protease,capsid,terminase,transposase,portal,tRNA,head,holin,integrase,tail	Escherichia_phage(31.03%)	171	3348537:3348557	3369627:3369647
WP_001299679.1|3210931_3212188_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_001130692.1|3212401_3213025_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_001260332.1|3213024_3213876_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_001298109.1|3214026_3214974_+	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
WP_001033352.1|3215098_3216778_+	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_000823885.1|3216832_3217111_-	stress-induced protein YchH	NA	NA	NA	NA	NA
WP_000152933.1|3217388_3217973_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_000505866.1|3218089_3219181_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_097209380.1|3220024_3222910_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_001310261.1|3223009_3224929_-	PTS-dependent dihydroxyacetone kinase operon transcriptional regulator DhaR	NA	NA	NA	NA	NA
WP_000733713.1|3225156_3226227_+	dihydroxyacetone kinase subunit DhaK	NA	NA	NA	NA	NA
WP_001302889.1|3226237_3226870_+	dihydroxyacetone kinase ADP-binding subunit DhaL	NA	NA	NA	NA	NA
WP_001302890.1|3226880_3228299_+	dihydroxyacetone kinase subunit DhaM	NA	NA	NA	NA	NA
WP_001459046.1|3230330_3230531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060146.1|3230638_3231661_+	iron ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001223662.1|3231660_3232641_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000173324.1|3232637_3233396_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.7	1.5e-14
WP_000576838.1|3234214_3235069_+	ModD protein	NA	NA	NA	NA	NA
WP_001502371.1|3235094_3237065_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_000511315.1|3237114_3237369_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_171878392.1|3238217_3239430_+|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.0	1.6e-167
WP_001295616.1|3239618_3240230_-	membrane-bound lytic murein transglycosylase EmtA	NA	NA	NA	NA	NA
WP_000051572.1|3240329_3241244_+	muramoyltetrapeptide carboxypeptidase	NA	NA	NA	NA	NA
WP_000340206.1|3241339_3243076_+	potassium/proton antiporter	NA	NA	NA	NA	NA
WP_162829348.1|3243233_3244447_-|transposase	IS3 family transposase	transposase	H6WZH1	Escherichia_phage	99.7	4.9e-169
WP_000197859.1|3244784_3245855_-	catabolic alanine racemase DadX	NA	NA	NA	NA	NA
WP_001266908.1|3245864_3247163_-	D-amino acid dehydrogenase	NA	NA	NA	NA	NA
WP_000190855.1|3247525_3249058_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_000234823.1|3249109_3249829_-	fatty acid metabolism transcriptional regulator FadR	NA	NA	NA	NA	NA
WP_000406391.1|3250050_3251592_+	Na(+)/H(+) antiporter NhaB	NA	NA	NA	NA	NA
WP_000943459.1|3251737_3252268_+	disulfide bond formation protein DsbB	NA	NA	NA	NA	NA
WP_000457644.1|3252313_3253582_-	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.2	3.0e-209
WP_000897378.1|3253581_3254001_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.1	6.9e-38
WP_001304191.1|3254373_3255285_+	hemolysin HlyE	NA	NA	NA	NA	NA
WP_000807626.1|3255491_3255953_-	YcgN family cysteine cluster protein	NA	NA	NA	NA	NA
WP_000284277.1|3256029_3256689_-	fumarylacetoacetate hydrolase family protein	NA	NA	NA	NA	NA
WP_001295992.1|3256760_3257054_-	YcgL domain-containing protein	NA	NA	NA	NA	NA
WP_000874954.1|3257065_3257224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000695220.1|3257294_3257696_+	pre-peptidase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_001056834.1|3257798_3258167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000072536.1|3258686_3259382_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_000101055.1|3259405_3260218_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_001185665.1|3260221_3260488_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_000361110.1|3261726_3262311_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001201843.1|3262809_3263763_+|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001226373.1|3263949_3265434_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000998048.1|3265736_3267275_-|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_000612591.1|3267324_3267672_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001171554.1|3267668_3268049_-	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000937476.1|3268124_3268373_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	76.5	1.7e-12
WP_000239881.1|3268429_3269098_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000134810.1|3269595_3269778_+	general stress protein	NA	NA	NA	NA	NA
WP_001166090.1|3269856_3270357_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001079482.1|3270393_3270900_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_000488340.1|3270918_3271809_+	manganese catalase family protein	NA	NA	NA	NA	NA
WP_097223427.1|3271928_3272510_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	93.2	5.2e-100
WP_001301660.1|3272509_3274060_-|tail	tail fiber protein	tail	A0A1B0VFW4	Salmonella_phage	57.2	4.3e-40
WP_071536264.1|3274020_3274116_-	DNA-binding protein	NA	NA	NA	NA	NA
WP_162829202.1|3274176_3275389_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001230336.1|3276802_3277402_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.5	3.0e-111
WP_000515612.1|3277468_3280867_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	90.7	0.0e+00
WP_000090920.1|3280927_3281560_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	1.7e-96
WP_000194779.1|3281496_3282240_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152612.1|3282245_3282944_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	98.7	2.1e-132
WP_000847331.1|3282943_3283273_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	100.0	2.5e-59
WP_000840323.1|3283269_3285819_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	87.3	0.0e+00
WP_000459457.1|3285811_3286246_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479161.1|3286227_3286650_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	2.4e-70
WP_001143002.1|3286665_3287406_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	95.9	8.3e-127
WP_000683105.1|3287413_3287809_-|tail	tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	100.0	1.0e-70
WP_000752995.1|3288394_3288748_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	99.1	9.9e-62
WP_000158906.1|3288759_3289158_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	3.5e-63
WP_000063265.1|3289199_3290225_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_001295978.1|3290280_3290613_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_000123254.1|3290622_3291942_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	3.4e-232
WP_001301524.1|3291922_3293524_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	98.7	1.4e-307
WP_000198153.1|3293520_3293727_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	98.5	2.2e-29
WP_001027223.1|3293723_3295649_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	98.1	0.0e+00
WP_000867498.1|3295623_3296169_-|terminase	terminase small subunit	terminase	A0A0K2FIG2	Enterobacteria_phage	83.3	9.6e-80
WP_001303940.1|3296555_3296780_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	90.6	1.7e-19
WP_001302717.1|3296861_3297176_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_001208680.1|3297701_3297887_-	membrane protein	NA	A0A1U9AJA4	Stx1_converting_phage	80.3	1.7e-20
WP_000539795.1|3298109_3298256_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	87.0	1.1e-11
WP_001056806.1|3298255_3298825_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3299095_3299629_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3299679_3300024_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_024180155.1|3300028_3300244_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	97.2	1.3e-32
WP_000023184.1|3300682_3302533_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	98.9	0.0e+00
WP_001302123.1|3303010_3303442_-	tellurite resistance protein	NA	H6WZJ6	Escherichia_phage	96.5	1.6e-66
WP_000301797.1|3303892_3304606_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000917763.1|3304741_3304939_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	8.9e-28
WP_000640035.1|3305163_3305718_-	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	67.4	1.0e-65
WP_001217444.1|3305780_3306086_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.3	7.1e-32
WP_001265229.1|3306098_3307148_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.6	1.2e-110
WP_000191872.1|3307149_3307422_-	hypothetical protein	NA	S4TNP0	Salmonella_phage	53.0	1.1e-12
WP_000756596.1|3307543_3307888_-	YgiW/YdeI family stress tolerance OB fold protein	NA	A0A1I9LJU6	Stx_converting_phage	99.1	6.1e-56
WP_000935259.1|3308007_3308220_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0P0ZAX5	Stx2-converting_phage	100.0	6.0e-30
WP_000104474.1|3308453_3309011_-	DUF551 domain-containing protein	NA	A0A0N7KZV3	Escherichia_phage	41.7	2.8e-34
WP_000683609.1|3309012_3309231_-	DUF4014 family protein	NA	A0A2R2Z311	Escherichia_phage	72.2	2.3e-21
WP_001289673.1|3309358_3309670_-	hypothetical protein	NA	A0A0U2QV73	Escherichia_phage	92.2	7.2e-56
WP_000699809.1|3309662_3309890_-	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	49.3	5.1e-11
WP_000603384.1|3309886_3310168_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.6	1.0e-29
WP_000450627.1|3310200_3310917_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.8	3.3e-72
WP_000139447.1|3310950_3311412_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	4.0e-79
WP_162829202.1|3311927_3313140_+|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_001120551.1|3313428_3313671_+	DinI-like family protein	NA	Q687E4	Enterobacteria_phage	83.3	2.4e-27
WP_001171554.1|3314633_3315014_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZBP6	Stx2-converting_phage	100.0	1.4e-66
WP_000612591.1|3315010_3315358_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_000998048.1|3315407_3316946_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	100.0	1.5e-300
WP_001121225.1|3317528_3318179_-	DUF1076 domain-containing protein	NA	B6ETE1	Enterobacteria_phage	99.1	1.2e-121
WP_122994186.1|3318888_3319464_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	60.0	1.6e-56
WP_001023362.1|3319577_3319847_-|tail	phage tail fiber C-terminal domain-containing protein	tail	H6WZN0	Escherichia_phage	98.9	6.4e-45
WP_071805583.1|3319848_3321072_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	B6DZB7	Enterobacteria_phage	92.6	8.7e-81
WP_001230508.1|3321136_3321736_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_000514789.1|3321803_3325280_-	host specificity protein J	NA	A0A0P0ZBW1	Stx2-converting_phage	89.4	0.0e+00
WP_001179509.1|3325467_3325905_-|tail	phage minor tail protein L	tail	A0A0P0ZD44	Stx2-converting_phage	100.0	5.0e-63
WP_000807954.1|3325904_3326246_-|tail	phage tail protein	tail	A0A0P0ZBQ8	Stx2-converting_phage	100.0	5.1e-63
WP_171878393.1|3326238_3329481_-|tail	phage tail tape measure protein	tail	A0A0P0ZDY0	Stx2-converting_phage	97.4	0.0e+00
WP_001453746.1|3329528_3329738_-	DUF4035 domain-containing protein	NA	A0A0P0ZED8	Stx2-converting_phage	100.0	2.6e-33
WP_000710952.1|3329833_3330208_-|tail	tail assembly protein	tail	A0A0P0ZE84	Stx2-converting_phage	100.0	4.6e-65
WP_001275499.1|3330222_3330939_-	immunoglobulin domain-containing protein	NA	A0A0P0ZDV1	Stx2-converting_phage	99.6	8.0e-127
WP_000133388.1|3331004_3331349_-	DUF3168 domain-containing protein	NA	A0A0P0ZC17	Stx2-converting_phage	100.0	1.4e-57
WP_000573374.1|3331345_3331792_-	HK97 gp10 family phage protein	NA	A0A0P0ZCD2	Stx2-converting_phage	100.0	8.1e-77
WP_001007901.1|3331788_3332139_-|head	phage head closure protein	head	A0A0P0ZCU6	Stx2-converting_phage	100.0	7.0e-60
WP_000126019.1|3332148_3332475_-|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A0P0ZDA0	Stx2-converting_phage	100.0	9.2e-54
WP_171878394.1|3332554_3335056_-|portal	phage portal protein	portal	A0A0P0ZDD0	Stx2-converting_phage	99.8	0.0e+00
WP_001063099.1|3335001_3335223_-	hypothetical protein	NA	B6DZA0	Enterobacteria_phage	100.0	5.8e-36
WP_000173030.1|3335267_3337205_-|capsid	phage major capsid protein	capsid	B6ETE8	Enterobacteria_phage	100.0	0.0e+00
WP_001301491.1|3337268_3338930_-|terminase	terminase large subunit	terminase	A0A0P0ZD10	Stx2-converting_phage	100.0	0.0e+00
WP_000958387.1|3338926_3339490_-|terminase	terminase small subunit	terminase	A0A0N7KZJ8	Stx2-converting_phage	100.0	8.1e-90
WP_000279796.1|3339781_3340147_-	HNH endonuclease	NA	B6ETE5	Enterobacteria_phage	100.0	3.1e-66
WP_001302977.1|3340188_3340374_+	DUF3950 domain-containing protein	NA	H6WZK6	Escherichia_phage	90.4	3.7e-20
WP_000347013.1|3340503_3340644_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000735655.1|3341000_3341225_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001208682.1|3341289_3341496_-	hypothetical protein	NA	H6WRZ6	Salmonella_phage	64.7	7.1e-12
WP_000539792.1|3341723_3341870_-	hypothetical protein	NA	A0A0P0ZE99	Stx2-converting_phage	100.0	2.6e-16
WP_001056806.1|3341869_3342439_-	hypothetical protein	NA	A0A1I9LJR6	Stx_converting_phage	100.0	3.1e-105
WP_000992148.1|3342709_3343243_-	lysozyme	NA	B6DZ92	Enterobacteria_phage	99.4	3.0e-102
WP_000731241.1|3343293_3343638_-	YdfR family protein	NA	A0A0P0ZD64	Stx2-converting_phage	99.1	1.7e-58
WP_000284518.1|3343642_3343858_-|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	100.0	2.0e-33
WP_001289717.1|3343933_3344203_-	DUF826 domain-containing protein	NA	A0A2R2Z348	Escherichia_phage	75.3	8.2e-08
WP_001213059.1|3344240_3344423_-	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	67.8	1.0e-14
WP_000023170.1|3344570_3346508_-	SASA family carbohydrate esterase	NA	Q6H9W1	Enterobacteria_phage	76.8	2.5e-292
WP_000216629.1|3346822_3346990_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	72.5	1.9e-10
WP_000762929.1|3347586_3348408_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.3e-83
WP_001217410.1|3348404_3348779_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	2.1e-33
3348537:3348557	attL	CAGCGCATCCAGCGGCGCTTT	NA	NA	NA	NA
WP_001265168.1|3348791_3349841_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	53.4	1.2e-107
WP_001341388.1|3349842_3350121_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000887477.1|3350288_3350501_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	68.6	3.1e-18
WP_001278450.1|3350689_3350794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000207955.1|3350909_3351497_-	DUF551 domain-containing protein	NA	K7PH57	Enterobacteria_phage	45.8	7.5e-38
WP_001014296.1|3351499_3351691_-	hypothetical protein	NA	G9L660	Escherichia_phage	98.4	1.6e-26
WP_000515959.1|3351692_3352130_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	1.9e-38
WP_000156547.1|3352116_3352434_-	hypothetical protein	NA	A0A088CQ13	Enterobacteria_phage	90.0	4.4e-45
WP_001017965.1|3352387_3352705_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	92.4	2.1e-42
WP_001310212.1|3352694_3352997_-	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	87.9	1.9e-45
WP_072140318.1|3352993_3353275_-	DNA-binding protein	NA	A0A222YXX1	Escherichia_phage	73.1	1.4e-29
WP_000451012.1|3353307_3354024_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	62.4	2.1e-71
WP_072143019.1|3354057_3354600_-	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	92.2	2.3e-81
WP_001457513.1|3354511_3355549_-	primosomal protein I	NA	A0A0U2RT81	Escherichia_phage	79.5	1.5e-89
WP_000693915.1|3355617_3356043_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000711018.1|3356026_3356350_-	transcriptional regulator	NA	A0A0R6PH31	Moraxella_phage	44.9	6.2e-10
WP_000948454.1|3356474_3356951_+	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	53.4	5.7e-12
WP_001414141.1|3357266_3357419_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	1.0e-07
WP_000559928.1|3357533_3358049_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077699040.1|3358181_3358571_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.0	1.3e-38
WP_000003742.1|3358632_3358902_+	excisionase	NA	NA	NA	NA	NA
WP_000074985.1|3358870_3359989_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	43.9	1.0e-83
WP_000580316.1|3360155_3360950_+	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000759316.1|3360946_3361993_+	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000952736.1|3362148_3362970_-	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
3369627:3369647	attR	AAAGCGCCGCTGGATGCGCTG	NA	NA	NA	NA
>prophage 11
NZ_CP038425	Escherichia coli O157:H7 strain 2571 chromosome, complete genome	5572326	3623304	3676188	5572326	protease,capsid,terminase,portal,transposase,head,holin,integrase,tail	Escherichia_phage(27.5%)	59	3625239:3625254	3677953:3677968
WP_000003653.1|3623304_3623892_-|protease	hydrogenase 1 maturation protease	protease	NA	NA	NA	NA
WP_001186424.1|3623888_3624596_-	Ni/Fe-hydrogenase b-type cytochrome subunit	NA	NA	NA	NA	NA
WP_000107391.1|3624614_3626408_-	Ni/Fe-hydrogenase large subunit	NA	NA	NA	NA	NA
3625239:3625254	attL	ATTCAGCTGCTGAATG	NA	NA	NA	NA
WP_001301613.1|3626404_3627523_-	hydrogenase 1 small subunit	NA	NA	NA	NA	NA
WP_001023352.1|3629514_3629784_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	100.0	3.4e-46
WP_171878395.1|3629785_3631099_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.5	1.1e-84
WP_001230508.1|3631163_3631763_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	100.0	1.2e-110
WP_171878396.1|3631830_3635304_-	host specificity protein J	NA	A0A0P0ZCI5	Stx2-converting_phage	96.2	0.0e+00
WP_000649829.1|3635437_3635965_+	superoxide dismutase family protein	NA	Q9MC02	Salmonella_phage	60.5	1.8e-59
WP_050546863.1|3636155_3636788_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	99.5	5.8e-105
WP_000194760.1|3636733_3637477_-|tail	phage tail protein	tail	A0A0P0ZE89	Stx2-converting_phage	99.6	2.4e-150
WP_001151078.1|3637487_3638186_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	98.3	2.9e-129
WP_000847304.1|3638185_3638515_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	95.4	2.2e-55
WP_171878397.1|3638511_3641091_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.9	0.0e+00
WP_000533402.1|3641071_3641485_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000479117.1|3641511_3641943_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	2.4e-41
WP_029208397.1|3641956_3642697_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	3.6e-130
WP_001301534.1|3642678_3642945_-|capsid	major capsid protein	capsid	NA	NA	NA	NA
WP_000256723.1|3643002_3643350_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	58.1	2.6e-22
WP_001254002.1|3643386_3644892_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	54.2	1.2e-100
WP_097209410.1|3644881_3646474_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	60.3	3.3e-181
WP_000259002.1|3646470_3646677_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_000235436.1|3648546_3649056_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000411791.1|3649806_3650013_+|holin	class II holin family protein	holin	Q6H9V8	Enterobacteria_phage	97.1	4.5e-30
WP_000138558.1|3650268_3650541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001003118.1|3650700_3651234_+	lysozyme	NA	A0A1U9AJ98	Stx1_converting_phage	94.4	3.1e-99
WP_000675931.1|3651454_3651568_+	hypothetical protein	NA	A0A2L1IV24	Escherichia_phage	100.0	6.6e-12
WP_012816791.1|3651789_3651975_+	membrane protein	NA	A0A0P0ZCT3	Stx2-converting_phage	100.0	1.2e-18
WP_001303878.1|3652502_3652817_+	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_162829202.1|3653021_3654235_-|transposase	IS3 family transposase	transposase	A0A0N7C1X7	Escherichia_phage	100.0	7.6e-170
WP_000874392.1|3654410_3656261_-	SASA family carbohydrate esterase	NA	B6DZ89	Enterobacteria_phage	96.1	0.0e+00
WP_000261909.1|3657028_3657742_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000265265.1|3658362_3659181_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000090264.1|3659332_3659704_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	83.2	4.0e-53
WP_001217436.1|3659693_3660065_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.7	1.3e-35
WP_001265172.1|3660077_3661127_-	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.9	1.2e-110
WP_001341388.1|3661128_3661407_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	5.7e-12
WP_000813263.1|3661574_3661730_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	1.9e-17
WP_000955173.1|3661831_3661969_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	96.6	5.4e-08
WP_000160654.1|3662334_3663108_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001151233.1|3663459_3663873_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	89.1	9.8e-61
WP_000450992.1|3663888_3664659_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	6.1e-80
WP_000788751.1|3664680_3665427_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	84.2	6.2e-114
WP_072143748.1|3665433_3666525_-	DNA-binding protein	NA	V5URT9	Shigella_phage	71.1	2.5e-135
WP_000273724.1|3666603_3667059_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000693855.1|3667265_3667691_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_032362955.1|3667674_3667947_-	helix-turn-helix domain-containing protein	NA	H6WRX5	Salmonella_phage	50.0	8.5e-13
WP_000986592.1|3668055_3668457_+	helix-turn-helix domain-containing protein	NA	A0A1B5FPF4	Escherichia_phage	54.5	7.4e-13
WP_000536233.1|3668484_3668676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001303876.1|3668675_3668963_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000379575.1|3669240_3669396_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000394511.1|3669537_3669927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001133046.1|3670113_3670299_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000413705.1|3670872_3671061_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001098307.1|3671057_3671249_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000034474.1|3671342_3673814_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.6	8.8e-56
WP_000273151.1|3673881_3674124_+	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_001299351.1|3674101_3675121_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	49.7	1.3e-85
WP_001502226.1|3675528_3676188_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	2.4e-48
3677953:3677968	attR	ATTCAGCTGCTGAATG	NA	NA	NA	NA
>prophage 12
NZ_CP038425	Escherichia coli O157:H7 strain 2571 chromosome, complete genome	5572326	3907120	3944978	5572326	protease,terminase,portal,holin,integrase,tail,lysis	Enterobacteria_phage(50.0%)	49	3906705:3906719	3945052:3945066
3906705:3906719	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001247925.1|3907120_3907819_-|protease	T3SS effector zinc metalloprotease NleD	protease	NA	NA	NA	NA
WP_000951026.1|3908049_3908931_-	type III secretion system effector kinase NleH1-1	NA	A5LH48	Enterobacteria_phage	90.1	8.6e-147
WP_072127173.1|3909099_3909261_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	72.5	3.9e-13
WP_115801843.1|3909757_3910777_-|protease	type III secretion system effector zinc metalloprotease NleC	protease	NA	NA	NA	NA
WP_000950813.1|3910810_3911791_-	type III secretion system effector arginine glycosyltransferase NleB2	NA	Q8HAB2	Salmonella_phage	49.5	2.9e-87
WP_001024022.1|3911967_3912237_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A1I9LJT0	Stx_converting_phage	98.9	4.9e-45
WP_001233141.1|3913376_3913976_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	92.5	1.8e-103
WP_148905702.1|3914046_3917460_-	DUF1983 domain-containing protein	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_000090841.1|3917520_3918129_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	94.1	2.4e-100
WP_000194779.1|3918065_3918809_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	97.6	2.0e-149
WP_001152360.1|3918814_3919513_-|tail	phage minor tail protein L	tail	A5LH40	Enterobacteria_phage	99.1	3.9e-134
WP_000447253.1|3919522_3919852_-|tail	phage tail protein	tail	A5LH39	Enterobacteria_phage	100.0	1.7e-60
WP_000371994.1|3919851_3922917_-|tail	phage tail tape measure protein	tail	A0A291AWX1	Escherichia_phage	98.9	0.0e+00
WP_001161009.1|3922888_3923218_-|tail	phage tail assembly protein T	tail	A5LH37	Enterobacteria_phage	100.0	7.6e-56
WP_001300035.1|3923226_3923613_-|tail	phage minor tail protein G	tail	A0A291AWW5	Escherichia_phage	100.0	1.6e-65
WP_000211123.1|3923673_3924417_-|tail	phage tail protein	tail	A5LH35	Enterobacteria_phage	98.0	9.5e-131
WP_001079422.1|3924427_3924829_-|tail	tail protein	tail	A5LH34	Enterobacteria_phage	98.5	2.0e-71
WP_000677094.1|3924825_3925404_-|tail	phage tail protein	tail	A5LH33	Enterobacteria_phage	99.0	6.1e-101
WP_001283153.1|3925415_3925691_-	DNA breaking-rejoining protein	NA	K7PH43	Enterobacteria_phage	100.0	2.3e-45
WP_001097050.1|3925683_3926007_-	DUF2190 family protein	NA	A0A291AWX2	Escherichia_phage	100.0	8.5e-52
WP_001136597.1|3926093_3928121_-|protease	Clp protease ClpP	protease	K7PGT6	Enterobacteria_phage	99.4	0.0e+00
WP_127446149.1|3928065_3928401_-|portal	phage portal protein	portal	A5LH29	Enterobacteria_phage	99.1	9.1e-57
WP_010904538.1|3928522_3929647_-|portal	phage portal protein	portal	K7PJP3	Enterobacteria_phage	99.4	5.4e-194
WP_001072975.1|3929574_3929787_-	hypothetical protein	NA	A5LH28	Enterobacteria_phage	100.0	1.1e-31
WP_000934137.1|3929783_3931886_-|terminase	phage terminase large subunit family protein	terminase	A0A291AWY5	Escherichia_phage	96.7	0.0e+00
WP_000349509.1|3931885_3932377_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_001139679.1|3933051_3933204_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	8.9e-20
WP_000092302.1|3933191_3933659_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	97.4	9.4e-76
WP_000075107.1|3933655_3934153_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	98.2	7.1e-90
WP_000284524.1|3934152_3934368_-|holin	class II holin family protein	holin	A0A0P0ZC45	Stx2-converting_phage	98.6	4.5e-33
WP_012578864.1|3934510_3934909_+	hypothetical protein	NA	H6WZJ8	Escherichia_phage	83.3	6.9e-11
WP_000499454.1|3934989_3935148_-	DUF3927 family protein	NA	NA	NA	NA	NA
WP_001302581.1|3935233_3935977_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001097238.1|3936160_3936850_-	Q antiterminator encoded by prophage CP-933P	NA	I6PDF8	Cronobacter_phage	48.1	1.5e-58
WP_032160865.1|3936864_3936987_-	YlcG family protein	NA	NA	NA	NA	NA
WP_000750155.1|3937324_3938284_+	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_001028854.1|3938495_3939161_-	serine/threonine protein phosphatase	NA	Q5TJL8	Enterobacteria_phage	99.5	5.0e-131
WP_097209407.1|3939157_3939778_-	recombination protein NinG	NA	Q716C3	Shigella_phage	95.6	8.6e-93
WP_000567001.1|3939770_3939941_-	protein ninF	NA	Q716C4	Shigella_phage	96.4	7.9e-25
WP_001254218.1|3939937_3940120_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	96.7	4.8e-28
WP_000186844.1|3940817_3941498_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	99.6	3.5e-132
WP_000682316.1|3941494_3941677_+	DUF1317 domain-containing protein	NA	A0A0P0ZAS9	Stx2-converting_phage	95.0	4.1e-27
WP_000548536.1|3941649_3941841_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	96.8	1.1e-25
WP_023436627.1|3941851_3942133_+	hypothetical protein	NA	A0A0P0ZE02	Stx2-converting_phage	97.8	1.6e-46
WP_000763363.1|3942231_3942453_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	98.6	6.4e-35
WP_000120056.1|3942663_3943266_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545728.1|3943508_3943676_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	98.2	1.3e-27
WP_001303849.1|3943715_3943934_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000034810.1|3944207_3944978_+|integrase	tyrosine-type recombinase/integrase	integrase	K7P6P6	Enterobacteria_phage	100.0	3.1e-140
3945052:3945066	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 13
NZ_CP038425	Escherichia coli O157:H7 strain 2571 chromosome, complete genome	5572326	4517279	4563409	5572326	integrase,plate,transposase	uncultured_Caudovirales_phage(30.0%)	41	4516850:4516864	4542499:4542513
4516850:4516864	attL	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_001130487.1|4517279_4518461_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	61.3	2.4e-144
WP_000893282.1|4518813_4520067_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	3.4e-96
WP_001285288.1|4520078_4521182_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|4521469_4522525_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_000174701.1|4522563_4522965_-	sigma factor-binding protein Crl	NA	NA	NA	NA	NA
WP_000189536.1|4523022_4524267_-	esterase FrsA	NA	NA	NA	NA	NA
WP_001291990.1|4524358_4524817_-	xanthine phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001293009.1|4525077_4526535_+	cytosol nonspecific dipeptidase	NA	NA	NA	NA	NA
WP_023438539.1|4526591_4527149_-	peptide chain release factor H	NA	NA	NA	NA	NA
WP_001303804.1|4527060_4527327_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001059871.1|4527633_4528086_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001263495.1|4528095_4528494_-	type II toxin-antitoxin system mRNA interferase toxin YafO	NA	NA	NA	NA	NA
WP_000554757.1|4528496_4528790_-	type I toxin-antitoxin system antitoxin YafN	NA	NA	NA	NA	NA
WP_001226186.1|4528841_4529897_-	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000207556.1|4529967_4530753_-	putative lateral flagellar export/assembly protein LafU	NA	NA	NA	NA	NA
WP_001301901.1|4530697_4532437_+	flagellar type III secretion system protein FlhA	NA	NA	NA	NA	NA
WP_000543891.1|4533254_4534028_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	37.7	1.2e-19
WP_000729705.1|4534213_4534474_+	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_001303998.1|4534492_4534753_+	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_001225679.1|4534908_4535649_+	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001301698.1|4535619_4536387_-	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000284050.1|4536491_4537070_-	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000973071.1|4537309_4539754_+	acyl-CoA dehydrogenase FadE	NA	NA	NA	NA	NA
WP_000532698.1|4539796_4540270_-	C-lysozyme inhibitor	NA	NA	NA	NA	NA
WP_001118031.1|4540423_4541194_+	2-oxoglutaramate amidase	NA	NA	NA	NA	NA
WP_000027427.1|4541311_4542484_-|transposase	ISAs1-like element ISEc26 family transposase	transposase	NA	NA	NA	NA
WP_120795385.1|4542564_4542750_+	protein YncO	NA	NA	NA	NA	NA
4542499:4542513	attR	ATCTTTTTAGTTATT	NA	NA	NA	NA
WP_000247943.1|4542664_4542928_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001145876.1|4543129_4544890_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.3	1.0e-21
WP_000420853.1|4544892_4546029_-|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001506588.1|4546774_4547314_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_077698677.1|4547382_4548891_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	45.6	2.1e-23
WP_136720823.1|4549929_4554162_-	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.1	2.1e-25
WP_000103335.1|4554237_4556379_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	25.0	1.4e-25
WP_001142958.1|4556588_4557107_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_000037399.1|4557803_4558304_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_000123970.1|4558338_4558563_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097209396.1|4558613_4560005_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_000599596.1|4560095_4560509_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_000393844.1|4560512_4562363_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348794.1|4562326_4563409_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
>prophage 14
NZ_CP038425	Escherichia coli O157:H7 strain 2571 chromosome, complete genome	5572326	5004875	5063903	5572326	protease,transposase	Klosneuvirus(11.11%)	60	NA	NA
WP_001162171.1|5004875_5006228_-|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_000166270.1|5006321_5006873_+	ribosome-associated protein	NA	NA	NA	NA	NA
WP_001219792.1|5007028_5008402_-	UDP-N-acetylmuramate:L-alanyl-gamma-D-glutamyl- meso-diaminopimelate ligase	NA	NA	NA	NA	NA
WP_000853749.1|5008577_5009576_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.6	2.1e-69
WP_000596020.1|5009608_5010604_-	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_001502142.1|5010590_5011613_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000205805.1|5011626_5013129_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_000265942.1|5013268_5014225_-	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000055075.1|5014534_5015065_+	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.3	1.2e-55
WP_000239579.1|5015144_5015495_-	endoribonuclease toxin ChpB	NA	NA	NA	NA	NA
WP_001223210.1|5015488_5015740_-	type II toxin-antitoxin system antitoxin ChpS	NA	NA	NA	NA	NA
WP_001219160.1|5015951_5016293_-	gamma-glutamylcyclotransferase	NA	NA	NA	NA	NA
WP_000060930.1|5016295_5020075_-	autotransporter assembly complex protein TamB	NA	NA	NA	NA	NA
WP_001269327.1|5020071_5021805_-	autotransporter assembly complex protein TamA	NA	NA	NA	NA	NA
WP_001301936.1|5022010_5022649_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000935036.1|5022971_5024315_+	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_000689228.1|5024410_5024617_-	DUF1107 domain-containing protein	NA	NA	NA	NA	NA
WP_000175287.1|5024941_5025496_+	YtfJ family protein	NA	NA	NA	NA	NA
WP_000937658.1|5025558_5026497_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000886884.1|5026708_5027449_-	3'(2'),5'-bisphosphate nucleotidase CysQ	NA	NA	NA	NA	NA
WP_000589487.1|5027638_5029582_+	2',3'-cyclic-nucleotide 2'-phosphodiesterase	NA	NA	NA	NA	NA
WP_000084622.1|5029699_5030080_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000560631.1|5030168_5031029_+	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_001301505.1|5031136_5032102_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000331454.1|5032209_5032872_+	iron-sulfur cluster repair protein YtfE	NA	NA	NA	NA	NA
WP_000228346.1|5032916_5034329_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_000211225.1|5034637_5035258_-	FKBP-type peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_001119481.1|5035475_5036114_+	cell division protein YtfB	NA	NA	NA	NA	NA
WP_000826431.1|5036248_5037457_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	5.4e-208
WP_000604943.1|5037464_5037896_+|transposase	IS200/IS605-like element IS609 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	5.7e-43
WP_001301745.1|5038518_5039313_+	DUF2686 family protein	NA	NA	NA	NA	NA
WP_001196062.1|5039383_5039833_-	50S ribosomal protein L9	NA	NA	NA	NA	NA
WP_000135199.1|5039874_5040102_-	30S ribosomal protein S18	NA	NA	NA	NA	NA
WP_001296681.1|5040106_5040421_-	primosomal replication protein N	NA	NA	NA	NA	NA
WP_001216676.1|5040427_5040823_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_000492914.1|5041149_5041425_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001170812.1|5041553_5042240_-	L-ribulose-5-phosphate 4-epimerase UlaF	NA	NA	NA	NA	NA
WP_000949511.1|5042239_5043094_-	L-ribulose-5-phosphate 3-epimerase UlaE	NA	NA	NA	NA	NA
WP_000056760.1|5043103_5043754_-	3-keto-L-gulonate-6-phosphate decarboxylase UlaD	NA	NA	NA	NA	NA
WP_000776517.1|5043767_5044232_-	PTS ascorbate transporter subunit IIA	NA	NA	NA	NA	NA
WP_000218362.1|5044241_5044547_-	PTS ascorbate transporter subunit IIB	NA	NA	NA	NA	NA
WP_001301921.1|5044562_5045960_-	PTS ascorbate transporter subunit IIC	NA	NA	NA	NA	NA
WP_000133631.1|5047486_5048242_+	HTH-type transcriptional regulator UlaR	NA	NA	NA	NA	NA
WP_000569696.1|5048238_5048988_-	esterase	NA	NA	NA	NA	NA
WP_000254636.1|5049169_5049499_+	biofilm peroxide resistance protein BsmA	NA	NA	NA	NA	NA
WP_000811566.1|5049647_5049923_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001301849.1|5050039_5051665_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000943960.1|5051748_5052912_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101670.1|5052914_5053553_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|5053562_5053961_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_000012572.1|5053978_5054638_-	YjfK family protein	NA	NA	NA	NA	NA
WP_000511966.1|5054688_5055387_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_000220128.1|5055405_5055807_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|5055933_5056665_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076303.1|5056845_5059287_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	32.9	2.4e-66
WP_001177639.1|5059325_5059751_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|5059955_5061254_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|5061357_5061555_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|5061636_5062641_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|5062643_5063903_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
>prophage 15
NZ_CP038425	Escherichia coli O157:H7 strain 2571 chromosome, complete genome	5572326	5200783	5215448	5572326	integrase,tRNA,tail	Enterobacteria_phage(43.75%)	18	5196624:5196639	5214153:5214168
5196624:5196639	attL	TGCTGGTGGCAGGAAT	NA	NA	NA	NA
WP_000918366.1|5200783_5202199_-	replicative DNA helicase	NA	O80281	Escherichia_phage	78.1	8.3e-200
WP_000891404.1|5203430_5203673_-	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000543819.1|5203806_5204844_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332269.1|5204932_5206030_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.5	2.1e-211
WP_001217541.1|5206091_5206340_+	DinI-like family protein	NA	A5LH55	Enterobacteria_phage	98.8	3.1e-38
WP_001143816.1|5206500_5207142_-	DUF1076 domain-containing protein	NA	B6DZC0	Enterobacteria_phage	99.1	1.1e-106
WP_072140863.1|5207223_5207853_-	DUF1076 domain-containing protein	NA	B6DZB9	Enterobacteria_phage	93.5	1.4e-79
WP_001118000.1|5207925_5208498_-	DUF1076 domain-containing protein	NA	H6WZN1	Escherichia_phage	53.2	2.5e-46
WP_021502109.1|5208609_5208879_-|tail	phage tail fiber C-terminal domain-containing protein	tail	A0A0P0ZEF0	Stx2-converting_phage	98.9	1.7e-45
WP_072612778.1|5208880_5210194_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0P0ZE15	Stx2-converting_phage	99.1	6.9e-84
WP_001230514.1|5210258_5210858_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZE39	Stx2-converting_phage	99.0	5.7e-110
WP_000008211.1|5212179_5212716_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	3.1e-99
WP_001242740.1|5212706_5213057_+	hypothetical protein	NA	A0A0P0ZBF8	Stx2-converting_phage	94.8	1.6e-56
WP_000145668.1|5213053_5213338_+	hypothetical protein	NA	I6S1S6	Salmonella_phage	83.9	1.3e-40
WP_000829415.1|5213673_5213871_+	hypothetical protein	NA	K7PH57	Enterobacteria_phage	68.6	7.5e-11
WP_001093918.1|5214215_5214497_+	pyocin activator PrtN family protein	NA	K7PGU0	Enterobacteria_phage	98.9	8.7e-45
5214153:5214168	attR	ATTCCTGCCACCAGCA	NA	NA	NA	NA
WP_000654815.1|5214544_5214718_-	hypothetical protein	NA	K7PJQ2	Enterobacteria_phage	100.0	4.4e-23
WP_000956557.1|5214914_5215448_-	hypothetical protein	NA	K7PKJ4	Enterobacteria_phage	100.0	1.1e-99
