The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP033362	Mesorhizobium sp. NZP2077 chromosome, complete genome	6830091	2160096	2207842	6830091	transposase	Erythrobacter_phage(14.29%)	42	NA	NA
WP_172224936.1|2160096_2161212_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_172234664.1|2161590_2162682_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_172224936.1|2162976_2164092_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_172234665.1|2165342_2167544_-	cation:proton antiporter	NA	NA	NA	NA	NA
WP_172224939.1|2168266_2168596_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_172234666.1|2168679_2168973_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172224941.1|2169366_2169603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172224943.1|2170133_2170577_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	50.4	1.3e-23
WP_172234667.1|2170754_2170877_+	YHYH domain-containing protein	NA	NA	NA	NA	NA
WP_172224945.1|2170878_2171205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172234668.1|2172455_2173052_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172224947.1|2173462_2174173_-	pentapeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_172224949.1|2174780_2174984_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172224951.1|2175187_2175400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172224953.1|2176035_2176311_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172224955.1|2176383_2176545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172224958.1|2176541_2176748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172224961.1|2176787_2177976_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	42.0	1.5e-48
WP_172224964.1|2178269_2179106_+	universal stress protein	NA	NA	NA	NA	NA
WP_172224967.1|2179166_2181734_+	cation-translocating P-type ATPase	NA	M1HX51	Paramecium_bursaria_Chlorella_virus	29.1	6.3e-65
WP_172224970.1|2182386_2183439_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_137934520.1|2183481_2184585_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	33.0	1.4e-24
WP_172224973.1|2184589_2185822_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_172224976.1|2185826_2186636_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_172224979.1|2186681_2187575_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172234669.1|2187676_2188891_-	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_137934483.1|2189147_2190362_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_172224983.1|2190702_2191482_-	creatininase	NA	NA	NA	NA	NA
WP_172224987.1|2191581_2192496_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172224990.1|2192588_2193725_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_137934479.1|2193831_2194677_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_172224993.1|2194673_2195507_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_137934477.1|2195503_2196598_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.4	3.3e-23
WP_172224996.1|2196614_2197616_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_172225000.1|2197748_2199002_+	sarcosine oxidase subunit beta family protein	NA	NA	NA	NA	NA
WP_137934474.1|2199015_2199318_+	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_172225003.1|2199314_2202314_+	sarcosine oxidase subunit alpha	NA	NA	NA	NA	NA
WP_172225006.1|2202323_2202884_+	sarcosine oxidase	NA	NA	NA	NA	NA
WP_172225009.1|2202901_2204176_+	serine hydroxymethyltransferase	NA	A0A240F2Y9	Aeromonas_phage	52.1	1.6e-101
WP_109658891.1|2204282_2205680_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_172225012.1|2206694_2207045_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_172234670.1|2206993_2207842_+|transposase	IS3 family transposase	transposase	A0A1P8CWQ3	Bacillus_phage	32.8	7.2e-34
>prophage 2
NZ_CP033362	Mesorhizobium sp. NZP2077 chromosome, complete genome	6830091	3570235	3588504	6830091	portal,head,protease,terminase	Sinorhizobium_phage(35.71%)	30	NA	NA
WP_172219735.1|3570235_3570640_-	MucR family transcriptional regulator	NA	A0A1P8VVG0	Erythrobacter_phage	54.1	5.3e-27
WP_172227691.1|3570645_3570969_-	DUF5131 family protein	NA	A0A291AUR0	Sinorhizobium_phage	83.8	2.3e-12
WP_172227693.1|3570968_3571274_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172227695.1|3571270_3571489_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172227697.1|3571488_3571707_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172227699.1|3571703_3571895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172227701.1|3571900_3572134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172227703.1|3572555_3573347_-	hypothetical protein	NA	R9TRS6	Rhizobium_phage	36.6	1.1e-20
WP_172287191.1|3573459_3573645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172227707.1|3573641_3574163_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172227709.1|3574274_3574784_+	hypothetical protein	NA	A0A291AUJ7	Sinorhizobium_phage	43.5	6.3e-25
WP_172227711.1|3574825_3575074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172227713.1|3575077_3575359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172227715.1|3575358_3575673_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172227717.1|3575669_3576005_+	DUF2312 domain-containing protein	NA	Q8W6H2	Sinorhizobium_phage	67.2	2.5e-14
WP_172287193.1|3576004_3577192_+	ParB N-terminal domain-containing protein	NA	A0A2I7R268	Vibrio_phage	40.6	5.2e-22
WP_172227721.1|3577184_3577487_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172227723.1|3577486_3577777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172227725.1|3577773_3578070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172227727.1|3578066_3578642_+	hypothetical protein	NA	A0A291AUJ2	Sinorhizobium_phage	46.1	4.2e-17
WP_172227729.1|3578638_3578878_+	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	51.6	3.3e-08
WP_172234756.1|3578937_3579696_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_172227731.1|3579692_3580883_+	hypothetical protein	NA	A0A291AUS5	Sinorhizobium_phage	43.7	3.6e-39
WP_172227733.1|3580857_3581496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172227735.1|3581861_3582464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172227737.1|3582474_3584457_+|terminase	phage terminase large subunit family protein	terminase	A0A0A8ILA6	Aurantimonas_phage	45.3	2.8e-153
WP_172227739.1|3584460_3584655_+	hypothetical protein	NA	B7SYD5	Stenotrophomonas_phage	44.4	2.7e-05
WP_172227741.1|3584655_3586170_+|portal	phage portal protein	portal	Q9JMM5	Wolbachia_phage	33.6	1.1e-53
WP_172227743.1|3586162_3586792_+|head,protease	HK97 family phage prohead protease	head,protease	A0A088C3V8	Shewanella_sp._phage	27.8	3.3e-15
WP_172227745.1|3586878_3588504_+	hypothetical protein	NA	A0A2I7QXP2	Vibrio_phage	29.8	3.3e-35
>prophage 3
NZ_CP033362	Mesorhizobium sp. NZP2077 chromosome, complete genome	6830091	3785184	3836704	6830091	integrase,transposase	uncultured_Caudovirales_phage(28.57%)	42	3784935:3784980	3849279:3849324
3784935:3784980	attL	TTGGCTCCCCGGGCCGGATTCGAACCAGCGACCAACCGGTTAACAG	NA	NA	NA	NA
WP_172228091.1|3785184_3786504_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	25.9	9.9e-22
WP_172234767.1|3786658_3786898_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172228093.1|3787114_3787750_+	hypothetical protein	NA	NA	NA	NA	NA
WP_140623337.1|3788094_3788307_-	AlpA family phage regulatory protein	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	45.3	2.9e-08
WP_172228095.1|3788436_3791484_-	Ti-type conjugative transfer relaxase TraA	NA	NA	NA	NA	NA
WP_172234768.1|3791656_3791983_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_172228097.1|3791984_3792269_+	conjugal transfer protein TraD	NA	NA	NA	NA	NA
WP_172228099.1|3793660_3794938_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172228101.1|3796516_3797044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172234769.1|3797368_3798280_-	formylglycine-generating enzyme family protein	NA	A0A075BSL8	Microcystis_phage	27.7	1.2e-15
WP_172228103.1|3798408_3799917_-	arylsulfatase	NA	NA	NA	NA	NA
WP_172228105.1|3800116_3800902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172228107.1|3801169_3802258_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_172228101.1|3803177_3803705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172228109.1|3805619_3807341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172234770.1|3808408_3809686_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_172234771.1|3809743_3811156_+	DUF1254 domain-containing protein	NA	M1IA53	Paramecium_bursaria_Chlorella_virus	40.1	2.0e-84
WP_172228111.1|3811211_3811622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172228113.1|3812114_3812990_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_172234772.1|3813037_3814033_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_172228115.1|3814046_3816011_+	DUF3604 domain-containing protein	NA	NA	NA	NA	NA
WP_172228117.1|3816088_3816688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172228119.1|3816739_3817528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172228121.1|3817557_3818310_+	carbonic anhydrase	NA	NA	NA	NA	NA
WP_172225057.1|3818550_3818997_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_023772705.1|3818993_3819350_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_172234673.1|3819459_3820938_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	42.6	3.4e-103
WP_172234773.1|3821154_3823011_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_172228123.1|3823215_3823542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172228125.1|3823567_3824227_-	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_172234774.1|3824295_3825231_-	amino acid-binding protein	NA	NA	NA	NA	NA
WP_172228127.1|3827995_3828601_-	NAD-dependent DNA ligase	NA	NA	NA	NA	NA
WP_172228129.1|3828631_3829492_-	thermonuclease family protein	NA	NA	NA	NA	NA
WP_172228131.1|3829470_3829944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172228133.1|3830069_3830285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172234775.1|3830370_3831231_+	ATP-dependent DNA ligase	NA	A0A291AUP8	Sinorhizobium_phage	37.9	2.1e-44
WP_172228135.1|3831231_3831441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172228137.1|3831525_3831963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172228139.1|3832330_3832507_-	Flp family type IVb pilin	NA	NA	NA	NA	NA
WP_172221580.1|3833159_3834476_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_172221580.1|3834595_3835912_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_172225988.1|3835943_3836704_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.9	1.6e-11
3849279:3849324	attR	TTGGCTCCCCGGGCCGGATTCGAACCAGCGACCAACCGGTTAACAG	NA	NA	NA	NA
>prophage 4
NZ_CP033362	Mesorhizobium sp. NZP2077 chromosome, complete genome	6830091	3910337	3918487	6830091	tRNA	uncultured_Mediterranean_phage(83.33%)	9	NA	NA
WP_172228246.1|3910337_3911138_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	33.9	5.8e-33
WP_172228248.1|3911134_3911902_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	47.4	3.7e-37
WP_013895102.1|3912081_3912303_+	twin-arginine translocase TatA/TatE family subunit	NA	A0A1B1IVR9	uncultured_Mediterranean_phage	65.9	5.1e-08
WP_172228250.1|3912332_3913094_+	twin-arginine translocase subunit TatB	NA	NA	NA	NA	NA
WP_172228252.1|3913090_3913966_+	twin-arginine translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	46.7	9.7e-50
WP_172228254.1|3914067_3915372_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	56.6	2.1e-101
WP_027039151.1|3915371_3916130_+	5'/3'-nucleotidase SurE	NA	NA	NA	NA	NA
WP_172228256.1|3916126_3916780_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	NA	NA	NA	NA
WP_172228258.1|3916960_3918487_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2K9VGT1	Pontimonas_phage	37.4	9.1e-11
>prophage 5
NZ_CP033362	Mesorhizobium sp. NZP2077 chromosome, complete genome	6830091	4181950	4223652	6830091	protease,transposase,tRNA	uncultured_Mediterranean_phage(28.57%)	45	NA	NA
WP_027044626.1|4181950_4182556_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	A0A223W000	Agrobacterium_phage	52.8	2.9e-53
WP_172228688.1|4182578_4183055_-	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_172228690.1|4183087_4183402_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	41.6	6.2e-07
WP_172228692.1|4183629_4184151_+	single-stranded DNA-binding protein	NA	A0A0K1LLZ9	Caulobacter_phage	56.1	4.4e-42
WP_172228694.1|4184282_4184708_+	OsmC family protein	NA	NA	NA	NA	NA
WP_023670949.1|4184726_4185356_-	MarC family protein	NA	NA	NA	NA	NA
WP_172228696.1|4185459_4185837_-	VOC family protein	NA	NA	NA	NA	NA
WP_172228698.1|4185869_4186397_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172228700.1|4187116_4187740_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_172228702.1|4187736_4189437_-	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_172228704.1|4189648_4192453_+	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	31.8	3.9e-100
WP_172228706.1|4192522_4192675_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172228708.1|4192869_4193370_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	36.0	5.2e-24
WP_172228710.1|4193388_4193976_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	58.0	2.4e-44
WP_027029099.1|4194016_4194529_+	peptidylprolyl isomerase	NA	A0A1B1IVS0	uncultured_Mediterranean_phage	63.4	6.3e-49
WP_027044615.1|4194541_4194991_+	DMT family transporter	NA	NA	NA	NA	NA
WP_172228712.1|4194990_4196079_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_172228714.1|4196068_4196338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172228716.1|4196330_4197461_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	54.8	9.2e-101
WP_172228718.1|4197465_4197879_-	DUF4864 domain-containing protein	NA	NA	NA	NA	NA
WP_172234792.1|4198081_4198693_+	DsbA family protein	NA	NA	NA	NA	NA
WP_010909609.1|4198774_4199011_+	Lrp/AsnC ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_172228720.1|4199181_4200594_+	circularly permuted type 2 ATP-grasp protein	NA	NA	NA	NA	NA
WP_172228722.1|4200615_4201557_+	alpha-E domain-containing protein	NA	NA	NA	NA	NA
WP_172228724.1|4201642_4202437_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_172228726.1|4202468_4203200_+	peptidase	NA	NA	NA	NA	NA
WP_172228728.1|4203254_4204670_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_172228730.1|4204721_4205126_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172228732.1|4205252_4206020_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.3	2.0e-22
WP_172228733.1|4206147_4207674_+	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_172228734.1|4207716_4208796_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	26.2	5.6e-07
WP_172228735.1|4208805_4209873_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.5	1.0e-16
WP_027044598.1|4209873_4210740_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_172228736.1|4210741_4211662_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_172228737.1|4211723_4212017_+	DUF2160 domain-containing protein	NA	NA	NA	NA	NA
WP_172228738.1|4212096_4213821_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_172228739.1|4213913_4215404_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_172228740.1|4215475_4215979_-	BA14K family protein	NA	NA	NA	NA	NA
WP_172223789.1|4217135_4217489_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_006201720.1|4217485_4217833_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	55.7	4.0e-31
WP_172223785.1|4217899_4219576_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.3	6.7e-108
WP_023778258.1|4219578_4219812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172220738.1|4220205_4220969_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.3	1.4e-12
WP_172224936.1|4221150_4222266_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_172234664.1|4222560_4223652_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 6
NZ_CP033362	Mesorhizobium sp. NZP2077 chromosome, complete genome	6830091	5810536	5864997	6830091	plate,transposase	Bacillus_virus(55.56%)	47	NA	NA
WP_172221580.1|5810536_5811853_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_172220738.1|5811956_5812720_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	36.3	1.4e-12
WP_172232151.1|5814642_5815425_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.5	3.1e-31
WP_172232154.1|5815438_5816302_-	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	27.4	6.3e-25
WP_027033926.1|5816330_5817338_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_172232157.1|5817598_5818330_-	histidine utilization repressor	NA	NA	NA	NA	NA
WP_172232160.1|5818362_5819388_-	alcohol dehydrogenase catalytic domain-containing protein	NA	NA	NA	NA	NA
WP_172232163.1|5819403_5820726_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_172287214.1|5820809_5821583_-	glucose 1-dehydrogenase	NA	NA	NA	NA	NA
WP_172234886.1|5821821_5822907_+	histidinol-phosphate transaminase	NA	A0A1X7QHI1	Faustovirus	27.4	1.0e-16
WP_172232169.1|5823017_5824301_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_172232172.1|5824297_5825155_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_172232175.1|5825151_5826006_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_172232178.1|5826239_5826884_+	cysteine hydrolase	NA	NA	NA	NA	NA
WP_172232181.1|5826930_5827479_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172232184.1|5827520_5828714_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_172232187.1|5828717_5829302_-	amino acid synthesis family protein	NA	NA	NA	NA	NA
WP_172232190.1|5829298_5829883_-	amino acid synthesis family protein	NA	NA	NA	NA	NA
WP_172232193.1|5830139_5831144_+	BMP family ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_172232196.1|5831255_5832821_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.6	5.1e-17
WP_172234887.1|5832820_5833861_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_172232199.1|5833848_5834835_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_172232203.1|5834845_5835859_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_172232206.1|5835870_5836803_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_172232208.1|5836829_5837702_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_172232211.1|5837777_5839847_-	NAD(P)-binding protein	NA	NA	NA	NA	NA
WP_172232214.1|5840120_5841287_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_172232217.1|5841297_5842233_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172232220.1|5842283_5843774_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_172232223.1|5843813_5844488_-	DUF1028 domain-containing protein	NA	NA	NA	NA	NA
WP_172232226.1|5844492_5844909_-	RidA family protein	NA	NA	NA	NA	NA
WP_172232229.1|5844953_5846228_-	NAD(P)-binding domain-containing protein	NA	NA	NA	NA	NA
WP_172234888.1|5846374_5847979_-	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0S9J5	Catovirus	31.5	5.7e-56
WP_172232232.1|5848041_5848845_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.1	2.9e-32
WP_172232235.1|5848858_5849725_-	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	28.5	1.5e-26
WP_172232238.1|5849804_5850794_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_172232241.1|5851147_5853952_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	26.6	4.5e-80
WP_172232244.1|5854276_5855449_+	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_172232248.1|5855455_5855995_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_172232251.1|5855998_5857504_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_172234889.1|5857563_5858013_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_172234890.1|5857999_5858755_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_172232254.1|5858756_5860631_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_172232257.1|5860594_5861698_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_172232260.1|5861694_5863167_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_172232263.1|5863170_5863623_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_172232266.1|5863662_5864997_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 7
NZ_CP033362	Mesorhizobium sp. NZP2077 chromosome, complete genome	6830091	6240355	6294902	6830091	integrase,transposase	Stx2-converting_phage(33.33%)	44	6247311:6247327	6304594:6304610
WP_172233032.1|6240355_6240688_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_172233035.1|6240919_6241429_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172233038.1|6241613_6243404_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_172233041.1|6243705_6245136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172233044.1|6245107_6246313_-	MFS transporter	NA	NA	NA	NA	NA
WP_172233047.1|6246419_6247307_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
6247311:6247327	attL	GCGAAAAGGCCTCCTGA	NA	NA	NA	NA
WP_172233050.1|6247587_6248589_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_172233053.1|6248741_6249680_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172233056.1|6250114_6251500_-	dipeptidase	NA	NA	NA	NA	NA
WP_172233059.1|6251496_6252255_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_172233062.1|6252251_6253298_-	2-dehydropantoate 2-reductase	NA	NA	NA	NA	NA
WP_172233065.1|6253294_6253996_-	creatininase family protein	NA	NA	NA	NA	NA
WP_172233068.1|6253992_6254967_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172233071.1|6255153_6256731_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_172233074.1|6256921_6257860_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_172233077.1|6257856_6258705_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_172234923.1|6258713_6259703_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	7.2e-17
WP_172233080.1|6259702_6260722_+	ATP-binding cassette domain-containing protein	NA	NA	NA	NA	NA
WP_172233083.1|6260754_6262272_+	carboxypeptidase M32	NA	NA	NA	NA	NA
WP_172233086.1|6262898_6263924_-	zinc-binding alcohol dehydrogenase family protein	NA	NA	NA	NA	NA
WP_172233089.1|6263997_6264912_-	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_172233092.1|6265006_6265792_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	24.5	6.3e-08
WP_172234924.1|6265788_6266709_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_172233095.1|6267009_6267906_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172233098.1|6268240_6269557_+|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_172233101.1|6269862_6271266_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_172233104.1|6271477_6272239_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	56.7	2.0e-27
WP_172233107.1|6273136_6274885_+	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_172233110.1|6274939_6276037_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_172233113.1|6276383_6277016_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WE94	Clostridium_phage	26.4	3.0e-08
WP_172233116.1|6277209_6278316_-	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_172234925.1|6278331_6278901_-	DUF3726 domain-containing protein	NA	NA	NA	NA	NA
WP_172233119.1|6278900_6280550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172234926.1|6280546_6281551_-	Ldh family oxidoreductase	NA	NA	NA	NA	NA
WP_172233122.1|6281566_6282475_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172233125.1|6282575_6284024_+	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_172233128.1|6284020_6284998_+	membrane dipeptidase	NA	NA	NA	NA	NA
WP_172233131.1|6285450_6286236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172233134.1|6286248_6288246_-	adenylate/guanylate cyclase domain-containing protein	NA	NA	NA	NA	NA
WP_172233137.1|6288363_6289992_+	caspase family protein	NA	NA	NA	NA	NA
WP_172233140.1|6291262_6291613_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172223789.1|6292461_6292815_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_006201720.1|6292811_6293159_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	55.7	4.0e-31
WP_172223785.1|6293225_6294902_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	44.3	6.7e-108
6304594:6304610	attR	GCGAAAAGGCCTCCTGA	NA	NA	NA	NA
>prophage 8
NZ_CP033362	Mesorhizobium sp. NZP2077 chromosome, complete genome	6830091	6382161	6447410	6830091	holin,transposase	Bacillus_virus(12.5%)	59	NA	NA
WP_172224417.1|6382161_6383231_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_172233350.1|6383622_6384909_-	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_172234936.1|6385124_6385304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172233353.1|6385404_6387198_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_172233356.1|6387418_6388411_-	N-alpha-acetyl diaminobutyric acid deacetylase DoeB	NA	NA	NA	NA	NA
WP_172233359.1|6388416_6389595_-	ectoine hydrolase DoeA	NA	NA	NA	NA	NA
WP_172233362.1|6389632_6390625_-	ectoine utilization protein EutC	NA	NA	NA	NA	NA
WP_172233366.1|6390621_6391608_-	hydroxyectoine utilization dehydratase EutB	NA	NA	NA	NA	NA
WP_172233369.1|6391613_6392393_-	ectoine utilization protein EutA	NA	NA	NA	NA	NA
WP_027033945.1|6392396_6393056_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
WP_172233372.1|6393055_6393715_-	ectoine/hydroxyectoine ABC transporter permease subunit EhuC	NA	NA	NA	NA	NA
WP_172233375.1|6393887_6394739_-	ectoine/hydroxyectoine ABC transporter substrate-binding protein EhuB	NA	NA	NA	NA	NA
WP_172234937.1|6394825_6395599_-	ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA	NA	G3M9Y6	Bacillus_virus	29.8	4.8e-16
WP_172233378.1|6395741_6397127_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_172233380.1|6397210_6397702_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_172233382.1|6397832_6399326_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_172233384.1|6399359_6400739_+	aspartate aminotransferase family protein	NA	A0A1C9EHH3	Mycobacterium_phage	26.6	2.7e-06
WP_172233386.1|6402677_6403376_+	HAD-IA family hydrolase	NA	NA	NA	NA	NA
WP_172234938.1|6403593_6403929_-	response regulator	NA	NA	NA	NA	NA
WP_172233388.1|6403949_6405884_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_172233390.1|6406156_6406666_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_172233392.1|6406757_6406925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172233394.1|6407408_6407810_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_172233396.1|6407902_6408538_-	porin family protein	NA	NA	NA	NA	NA
WP_172233399.1|6408905_6409556_+	porin family protein	NA	NA	NA	NA	NA
WP_172233402.1|6409650_6410226_-	CatB-related O-acetyltransferase	NA	A0A1V0SJ47	Klosneuvirus	34.5	5.6e-22
WP_172233405.1|6411127_6411427_+	DUF1236 domain-containing protein	NA	NA	NA	NA	NA
WP_172233407.1|6411494_6411740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172233410.1|6412128_6412791_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_172233413.1|6412957_6413149_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172233416.1|6413934_6414180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172233419.1|6414726_6414903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172233422.1|6415081_6415489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172233425.1|6416624_6417694_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_172234939.1|6418032_6419838_-	EAL domain-containing protein	NA	I6XM43	Pseudomonas_phage	48.8	4.5e-09
WP_172221962.1|6421118_6421931_+	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	34.3	5.3e-34
WP_172233428.1|6422314_6423121_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172233431.1|6423422_6424106_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_172233434.1|6424402_6425164_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_172233437.1|6425568_6425880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172233440.1|6425860_6426133_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172233443.1|6426375_6426567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172233445.1|6426607_6427192_-	glutathione S-transferase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_172233447.1|6427654_6428137_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_172233449.1|6428153_6429431_+	cytochrome b N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_172233451.1|6429423_6430206_+	pirin family protein	NA	NA	NA	NA	NA
WP_172234940.1|6430683_6430983_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_172233453.1|6431032_6431767_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_172219771.1|6432154_6432382_+	DUF680 domain-containing protein	NA	NA	NA	NA	NA
WP_172234941.1|6433998_6434355_+	SPW repeat protein	NA	NA	NA	NA	NA
WP_172233455.1|6434749_6435460_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_172233457.1|6435517_6437356_+	PAS domain-containing protein	NA	A0A1V0SGX0	Hokovirus	27.4	4.8e-06
WP_172233459.1|6437373_6438363_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_172233461.1|6438363_6439227_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_172233463.1|6439223_6441014_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	9.0e-18
WP_172233466.1|6441060_6442617_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_172233098.1|6443786_6445103_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_172221580.1|6445222_6446539_-|transposase	IS701 family transposase	transposase	NA	NA	NA	NA
WP_172225988.1|6446649_6447410_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.9	1.6e-11
>prophage 1
NZ_CP033363	Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence	364809	41734	83945	364809	transposase,integrase,tRNA	Pseudomonas_phage(18.18%)	34	81830:81847	86305:86322
WP_172235028.1|41734_43141_+|tRNA	Asp-tRNA(Asn)/Glu-tRNA(Gln) amidotransferase subunit GatA	tRNA	NA	NA	NA	NA
WP_172235029.1|43325_44564_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_172235030.1|44574_44850_+	sarcosine oxidase subunit delta	NA	NA	NA	NA	NA
WP_172235031.1|44846_47732_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_172235032.1|47733_48357_+	sarcosine oxidase	NA	NA	NA	NA	NA
WP_172235033.1|48307_49414_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_172235230.1|49500_50466_+	threonine/serine dehydratase	NA	C3U2M1	Lactococcus_phage	25.7	3.0e-07
WP_172235034.1|50612_51497_+	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	35.7	5.6e-13
WP_172235035.1|51740_52877_+	aminotransferase class V-fold PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_172235231.1|52966_54031_-	CHAD domain-containing protein	NA	NA	NA	NA	NA
WP_172234992.1|54048_54207_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172235036.1|54437_54899_-	phasin	NA	NA	NA	NA	NA
WP_172235037.1|55663_55879_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172235038.1|56053_56296_-	DUF982 domain-containing protein	NA	NA	NA	NA	NA
WP_172235039.1|57329_58223_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	37.0	5.5e-40
WP_172287243.1|58223_58682_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172235041.1|58671_60537_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_172235042.1|62300_63443_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_172235043.1|64427_66572_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	27.2	2.5e-30
WP_172235044.1|66639_67032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172235045.1|67269_67872_+	DUF1419 domain-containing protein	NA	NA	NA	NA	NA
WP_109670635.1|68166_68364_+	hypothetical protein	NA	NA	NA	NA	NA
WP_146211836.1|68445_68643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_095081136.1|68852_69878_+|transposase	IS110 family transposase	transposase	A0A1X9I5Z0	Streptococcus_phage	31.4	1.3e-08
WP_172235046.1|70420_71110_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_172235232.1|71149_72343_-	DUF1173 domain-containing protein	NA	NA	NA	NA	NA
WP_172235047.1|72528_77067_+	strawberry notch family protein	NA	A0A076FMQ0	Aureococcus_anophage	23.5	5.3e-14
WP_095204587.1|77079_77376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172235233.1|77375_78419_+	toprim domain-containing protein	NA	A0A0H5AWB1	Pseudomonas_phage	30.7	4.9e-08
WP_172235048.1|78478_79726_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B1P7C7	Bacillus_phage	27.4	2.1e-13
WP_172235049.1|79722_80673_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A076G872	Mycobacterium_phage	34.2	2.7e-05
WP_172235050.1|80665_81661_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_172235234.1|81729_82785_-	toprim domain-containing protein	NA	A0A0H5AWB1	Pseudomonas_phage	28.1	5.5e-07
81830:81847	attL	AGATCGTCGTTGAAGTCG	NA	NA	NA	NA
WP_172235051.1|83063_83945_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	32.0	6.6e-30
WP_172235051.1|83063_83945_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	32.0	6.6e-30
86305:86322	attR	CGACTTCAACGACGATCT	NA	NA	NA	NA
>prophage 2
NZ_CP033363	Mesorhizobium sp. NZP2077 plasmid pMSNZP2077NSa, complete sequence	364809	201267	277641	364809	transposase,holin,integrase	Leptospira_phage(20.0%)	60	202742:202761	276191:276210
WP_172235136.1|201267_201705_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_172235137.1|201701_202052_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_172235138.1|202123_202750_+|transposase	IS66 family transposase zinc-finger binding domain-containing protein	transposase	A0A0P0ZBS5	Stx2-converting_phage	34.7	8.8e-21
202742:202761	attL	TTATGTTGATGTCAACATAA	NA	NA	NA	NA
WP_172235052.1|203131_204331_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_172235051.1|204341_205223_-|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	32.0	6.6e-30
WP_172235139.1|205488_206484_-|integrase	tyrosine-type recombinase/integrase	integrase	E0YQ33	Mycobacterium_phage	24.8	2.8e-05
WP_172235140.1|206476_207427_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_172235141.1|207423_208656_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	31.6	1.3e-12
WP_172235142.1|209764_210361_+	UPF0149 family protein	NA	NA	NA	NA	NA
WP_172235143.1|210561_210711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172235144.1|210759_213960_-	glycosyl hydrolase	NA	NA	NA	NA	NA
WP_172235145.1|214793_215249_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_172235243.1|215563_216523_+	aminotransferase class IV	NA	NA	NA	NA	NA
WP_167481077.1|217997_218471_+|transposase	transposase	transposase	A0A0P0ZBP6	Stx2-converting_phage	49.3	4.1e-10
WP_120019434.1|218451_218805_+	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	46.3	1.9e-20
WP_172235146.1|218859_220431_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	32.3	9.2e-59
WP_172235147.1|221135_222575_-	CapA family protein	NA	S4VS02	Pandoravirus	29.0	9.5e-18
WP_109670693.1|222625_223681_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.8	1.4e-18
WP_109670695.1|223677_224685_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.2	2.1e-11
WP_109670697.1|224686_225568_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_109670699.1|225569_226511_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_109670701.1|226510_228121_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_109670703.1|229637_231017_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	23.7	3.0e-13
WP_172235148.1|231053_232547_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_172235149.1|232682_233174_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_172235244.1|233456_234563_+|holin	betaine/proline/choline family ABC transporter ATP-binding protein	holin	G3M9Y6	Bacillus_virus	34.9	1.7e-27
WP_172235150.1|234564_236076_+	proline/glycine betaine ABC transporter permease	NA	NA	NA	NA	NA
WP_109670715.1|236072_237038_+	amino acid-binding protein	NA	NA	NA	NA	NA
WP_172235151.1|237067_238249_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_109670719.1|238495_238966_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_172235152.1|239604_242079_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_172235153.1|243462_244644_-	amidohydrolase	NA	NA	NA	NA	NA
WP_172235154.1|244792_245896_+	hydroxyectoine utilization dehydratase EutB	NA	NA	NA	NA	NA
WP_172235155.1|245895_246888_+	ectoine utilization protein EutC	NA	NA	NA	NA	NA
WP_109670853.1|247697_248684_-	GlxA family transcriptional regulator	NA	NA	NA	NA	NA
WP_172235156.1|248924_249788_+	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_172235157.1|249818_250808_+	N-alpha-acetyl diaminobutyric acid deacetylase DoeB	NA	NA	NA	NA	NA
WP_172235245.1|250972_251623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172235158.1|251660_252842_+	M24 family metallopeptidase	NA	NA	NA	NA	NA
WP_172235159.1|252858_253899_+	low specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_109670744.1|254614_255283_+	ectoine/hydroxyectoine ABC transporter permease subunit EhuD	NA	NA	NA	NA	NA
WP_172235246.1|255337_256102_+	ectoine/hydroxyectoine ABC transporter ATP-binding protein EhuA	NA	G9BWD6	Planktothrix_phage	37.4	8.5e-26
WP_172235160.1|256215_257694_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_109670748.1|258692_259442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172235161.1|259558_260410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172235162.1|260410_261379_-	ImmA/IrrE family metallo-endopeptidase	NA	NA	NA	NA	NA
WP_172235163.1|261381_261753_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172235164.1|261950_262703_+	multiubiquitin domain-containing protein	NA	NA	NA	NA	NA
WP_172235165.1|262699_264106_+	ThiF family adenylyltransferase	NA	NA	NA	NA	NA
WP_172235166.1|264342_265218_-	TniQ family protein	NA	NA	NA	NA	NA
WP_172235247.1|266821_267235_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_172234322.1|267315_268872_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_172234322.1|269012_270569_-|transposase	ISL3 family transposase	transposase	NA	NA	NA	NA
WP_172235167.1|270607_271243_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_172235140.1|271235_272186_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_172235141.1|272182_273415_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2L1IV36	Escherichia_phage	31.6	1.3e-12
WP_172235051.1|273728_274610_+|integrase	tyrosine-type recombinase/integrase	integrase	S5W9T9	Leptospira_phage	32.0	6.6e-30
WP_172235052.1|274620_275820_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_023772705.1|276841_277198_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
276191:276210	attR	TTATGTTGATGTCAACATAA	NA	NA	NA	NA
WP_095205360.1|277194_277641_-|transposase	transposase	transposase	NA	NA	NA	NA
