The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053649	Xanthomonas axonopodis pv. vasculorum strain NCPPB 796 chromosome, complete genome	4871233	84114	183310	4871233	transposase	Burkholderia_phage(50.0%)	59	NA	NA
WP_171890726.1|84114_85083_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.9	5.8e-88
WP_134812327.1|85130_85928_+	transporter	NA	NA	NA	NA	NA
WP_042821060.1|85961_86729_+	coniferyl-alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_042821061.1|88779_89664_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_134812709.1|91122_91809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134812328.1|92400_92889_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042821062.1|93018_93531_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_042821063.1|93644_95144_-	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_042821064.1|95287_96109_-	aquaporin family protein	NA	NA	NA	NA	NA
WP_042821065.1|96284_97799_-	glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_042821066.1|98020_98848_-	DeoR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042821067.1|99193_100177_-	oxidoreductase	NA	NA	NA	NA	NA
WP_042821068.1|100277_101354_-	aromatic ring-hydroxylating dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_042821069.1|102466_103255_+	CoA-transferase subunit beta	NA	NA	NA	NA	NA
WP_042821070.1|103251_104460_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_042821071.1|104538_105276_+	protocatechuate 3,4-dioxygenase subunit beta	NA	NA	NA	NA	NA
WP_042821072.1|105280_105844_+	protocatechuate 3,4-dioxygenase subunit alpha	NA	NA	NA	NA	NA
WP_042824512.1|106202_107555_+	3-carboxy-cis,cis-muconate cycloisomerase	NA	NA	NA	NA	NA
WP_042821073.1|107565_108348_+	3-oxoadipate enol-lactonase	NA	NA	NA	NA	NA
WP_042821074.1|108374_108788_+	4-carboxymuconolactone decarboxylase	NA	NA	NA	NA	NA
WP_042821236.1|109583_109928_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134812303.1|112710_113277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042820918.1|113294_114776_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042820919.1|114905_119378_-	glutamate synthase large subunit	NA	NA	NA	NA	NA
WP_042820920.1|119579_119960_-	Elastase inhibitor AFLEI flags: Precursor	NA	NA	NA	NA	NA
WP_171890727.1|120472_121438_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_042824383.1|121700_122273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042824384.1|122427_122631_+	YdcH family protein	NA	NA	NA	NA	NA
WP_042824386.1|123023_124004_-	zinc-binding dehydrogenase	NA	NA	NA	NA	NA
WP_134984072.1|124200_126855_-	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_042825010.1|126854_127826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042824387.1|128259_129312_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_042824388.1|129479_132518_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042824389.1|137924_138644_-	orotidine-5'-phosphate decarboxylase	NA	NA	NA	NA	NA
WP_146089645.1|138640_139591_-	5'-nucleotidase, lipoprotein e(P4) family	NA	NA	NA	NA	NA
WP_042824391.1|139926_140595_+	DUF480 domain-containing protein	NA	NA	NA	NA	NA
WP_042825011.1|141946_142483_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042824392.1|143189_145166_-	DNA helicase Rep	NA	A7KV33	Bacillus_phage	36.9	5.3e-112
WP_042824394.1|145374_146004_+	thymidine kinase	NA	A0A023W530	Serratia_phage	55.0	5.7e-52
WP_171890728.1|147518_148412_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	51.0	1.4e-80
WP_171890729.1|148569_149535_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_042820935.1|157169_158192_+	sugar kinase	NA	NA	NA	NA	NA
WP_042820934.1|158399_158681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042820933.1|159100_160309_-	trans-2-enoyl-CoA reductase family protein	NA	NA	NA	NA	NA
WP_171890730.1|160627_161596_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.9	9.9e-88
WP_167551823.1|161801_162149_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042820932.1|163177_163675_+	isoprenylcysteine carboxylmethyltransferase family protein	NA	NA	NA	NA	NA
WP_042820931.1|163818_164985_+	FMN-dependent L-lactate dehydrogenase LldD	NA	NA	NA	NA	NA
WP_042824476.1|166876_167056_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042820930.1|167297_167693_-	DUF779 domain-containing protein	NA	NA	NA	NA	NA
WP_042820929.1|171078_173217_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	42.4	1.9e-70
WP_042820928.1|173373_174582_+	aspartate/tyrosine/aromatic aminotransferase	NA	NA	NA	NA	NA
WP_042820927.1|174846_175857_+	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	37.8	7.3e-49
WP_134812308.1|176013_176343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042820926.1|176854_177109_+	DUF2164 domain-containing protein	NA	NA	NA	NA	NA
WP_134812307.1|177217_177466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042820925.1|177962_179288_-	DUF4990 domain-containing protein	NA	NA	NA	NA	NA
WP_042820924.1|179749_180406_-	DUF938 domain-containing protein	NA	NA	NA	NA	NA
WP_171890731.1|182341_183310_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.9	2.9e-87
>prophage 2
NZ_CP053649	Xanthomonas axonopodis pv. vasculorum strain NCPPB 796 chromosome, complete genome	4871233	350575	427484	4871233	transposase,tRNA	Burkholderia_phage(25.0%)	54	NA	NA
WP_042821077.1|350575_352480_-|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_042821078.1|353047_353521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042821079.1|353678_354638_+	pyridoxal-phosphate dependent enzyme	NA	NA	NA	NA	NA
WP_042821080.1|354622_355237_+	YdcF family protein	NA	NA	NA	NA	NA
WP_042821081.1|355279_355699_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_042821082.1|355809_356715_-	lipid A hydroxylase LpxO	NA	S4VR59	Pandoravirus	38.3	1.7e-36
WP_042821083.1|356962_357847_-	malonyl-ACP O-methyltransferase BioC	NA	NA	NA	NA	NA
WP_042824515.1|358728_359490_-	pimeloyl-ACP methyl ester esterase BioH	NA	NA	NA	NA	NA
WP_042824516.1|359590_359965_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171890741.1|360156_361530_-	8-amino-7-oxononanoate synthase	NA	NA	NA	NA	NA
WP_042821085.1|361453_362488_-	biotin synthase BioB	NA	NA	NA	NA	NA
WP_171890742.1|362537_363263_+	ComF family protein	NA	NA	NA	NA	NA
WP_042821087.1|363563_364469_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_042824518.1|365432_366884_-	HpaF protein	NA	NA	NA	NA	NA
WP_042821088.1|367946_370403_-	serine kinase	NA	NA	NA	NA	NA
WP_134812480.1|372571_373018_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042822505.1|373014_375030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042822508.1|375651_376122_-	CesT family type III secretion system chaperone	NA	NA	NA	NA	NA
WP_171890717.1|376176_376458_-	serine kinase	NA	NA	NA	NA	NA
WP_042822512.1|376536_376779_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042822514.1|376788_377727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042822516.1|377723_378542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042822517.1|378538_378799_-	type III secretion system export apparatus subunit SctS	NA	NA	NA	NA	NA
WP_003485742.1|378803_379448_-	type III secretion system export apparatus subunit SctR	NA	NA	NA	NA	NA
WP_042822518.1|379434_380400_-	type III secretion system cytoplasmic ring protein SctQ	NA	NA	NA	NA	NA
WP_042822520.1|380492_381131_-	type III secretion system protein SctP	NA	NA	NA	NA	NA
WP_054318819.1|381130_383068_-	FHIPEP family type III secretion protein	NA	NA	NA	NA	NA
WP_042822522.1|383061_384141_-	type III secretion system export apparatus subunit SctU	NA	NA	NA	NA	NA
WP_042822523.1|384355_384811_+	HrpB1 family type III secretion system apparatus protein	NA	NA	NA	NA	NA
WP_042822524.1|384844_385237_+	type III secretion protein HrpB2	NA	NA	NA	NA	NA
WP_042822526.1|385238_386000_+	type III secretion inner membrane ring lipoprotein SctJ	NA	NA	NA	NA	NA
WP_042822527.1|386007_386637_+	type III secretion protein HrpB4	NA	NA	NA	NA	NA
WP_042822528.1|386621_387323_+	type III secretion system stator protein SctL	NA	NA	NA	NA	NA
WP_042822529.1|387312_388641_+	type III secretion system ATPase SctN	NA	NA	NA	NA	NA
WP_042822530.1|388633_389143_+	type III secretion protein HrpB7	NA	NA	NA	NA	NA
WP_042822532.1|389139_389970_+	type III secretion system export apparatus subunit SctT	NA	NA	NA	NA	NA
WP_042822533.1|390051_391875_+	type III secretion system outer membrane ring subunit SctC	NA	NA	NA	NA	NA
WP_042824715.1|392609_393065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042822534.1|393438_394002_+	lytic transglycosylase domain-containing protein	NA	A0A0K2QQJ4	Ralstonia_phage	38.5	6.7e-12
WP_171890726.1|394299_395268_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.9	5.8e-88
WP_042821090.1|395657_395999_-	HPF/RaiA family ribosome-associated protein	NA	NA	NA	NA	NA
WP_042821091.1|396696_399117_+	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_042824519.1|399138_399396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171890743.1|400084_401053_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.6	1.4e-86
WP_167551841.1|401063_401504_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134812461.1|405000_406141_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.7	1.4e-43
WP_042825330.1|406209_406641_+|transposase	IS200/IS605 family transposase	transposase	I4AZM1	Saccharomonospora_phage	32.5	3.1e-09
WP_042825283.1|406943_407222_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_134812917.1|407344_407839_-	CdiI family contact-dependent growth inhibition immunity protein	NA	NA	NA	NA	NA
WP_171890744.1|414345_419970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042825292.1|420411_422154_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	A0A0R6PI85	Moraxella_phage	25.5	5.7e-33
WP_171890745.1|422275_423089_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	34.8	6.6e-08
WP_171890746.1|425209_426010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171890747.1|426518_427484_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP053649	Xanthomonas axonopodis pv. vasculorum strain NCPPB 796 chromosome, complete genome	4871233	795266	803307	4871233		Enterobacteria_phage(42.86%)	7	NA	NA
WP_134983939.1|795266_796322_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	47.1	1.4e-82
WP_042823730.1|796377_797265_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	58.2	1.7e-94
WP_042823729.1|797261_797819_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	48.1	7.8e-45
WP_042823728.1|797815_798715_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.9	1.8e-27
WP_042823727.1|799055_800222_+	nucleotide sugar dehydrogenase	NA	M1HV26	Paramecium_bursaria_Chlorella_virus	57.8	9.4e-117
WP_042823726.1|800505_801909_-	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	29.6	9.5e-47
WP_134983934.1|801960_803307_-	phosphomannomutase	NA	A0A127AWJ1	Bacillus_phage	27.1	5.7e-33
>prophage 4
NZ_CP053649	Xanthomonas axonopodis pv. vasculorum strain NCPPB 796 chromosome, complete genome	4871233	1469479	1561076	4871233	transposase,tRNA,bacteriocin	Burkholderia_phage(16.67%)	59	NA	NA
WP_171890789.1|1469479_1470448_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.3	1.4e-86
WP_171890790.1|1472124_1473468_-	polyhydroxyalkanoate depolymerase	NA	NA	NA	NA	NA
WP_042824976.1|1473761_1474364_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_042824254.1|1474438_1474885_+	CopD family protein	NA	NA	NA	NA	NA
WP_134812861.1|1475091_1475532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171890791.1|1475538_1476754_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	65.1	9.9e-93
WP_042824238.1|1477608_1478283_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A088F6S9	Vibrio_phage	34.2	1.1e-24
WP_042824236.1|1479565_1479925_+	response regulator	NA	NA	NA	NA	NA
WP_042824968.1|1480174_1481098_-	LysR family transcriptional regulator ArgP	NA	NA	NA	NA	NA
WP_042824235.1|1481199_1481826_+	amino acid transporter	NA	NA	NA	NA	NA
WP_042824966.1|1484766_1484973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042824234.1|1485205_1485916_+	RNA-binding protein S4	NA	NA	NA	NA	NA
WP_042824232.1|1487731_1488136_-	response regulator	NA	NA	NA	NA	NA
WP_042824231.1|1488214_1488712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042824230.1|1488850_1490647_-	DNA helicase RecQ	NA	L7RCS0	Acanthamoeba_polyphaga_moumouvirus	35.1	7.5e-81
WP_171890792.1|1491051_1491294_+|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_042824228.1|1491551_1491914_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003482535.1|1492226_1492775_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	32.4	1.5e-16
WP_134983897.1|1492877_1496990_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SDF7	Indivirus	28.5	2.1e-46
WP_042824225.1|1501257_1502772_-	PhoPQ-regulated protein	NA	NA	NA	NA	NA
WP_042824224.1|1503087_1503600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042824222.1|1503659_1504778_-	pyrroloquinoline quinone biosynthesis protein PqqE	NA	NA	NA	NA	NA
WP_042824221.1|1504774_1505053_-	pyrroloquinoline quinone biosynthesis peptide chaperone PqqD	NA	NA	NA	NA	NA
WP_042824220.1|1505049_1505802_-	pyrroloquinoline-quinone synthase PqqC	NA	NA	NA	NA	NA
WP_042824219.1|1505798_1506698_-	pyrroloquinoline quinone biosynthesis protein PqqB	NA	NA	NA	NA	NA
WP_002812057.1|1506781_1506862_-	pyrroloquinoline quinone precursor peptide PqqA	NA	NA	NA	NA	NA
WP_042824218.1|1507152_1509339_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_042824217.1|1509586_1511029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042824216.1|1511385_1513488_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_042824214.1|1513725_1516170_+	penicillin-binding protein 1B	NA	NA	NA	NA	NA
WP_042824213.1|1516183_1516708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042824212.1|1516824_1517322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042824211.1|1517339_1517786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042824210.1|1518036_1520058_+	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.4	1.3e-94
WP_042824208.1|1520071_1520797_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_042824206.1|1521996_1522872_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_042824205.1|1522868_1523819_-	glutathione synthase	NA	NA	NA	NA	NA
WP_005913706.1|1524054_1524456_+	response regulator	NA	NA	NA	NA	NA
WP_042824204.1|1524473_1524836_+	response regulator	NA	A0A220YL79	Alteromonas_virus	27.7	5.3e-10
WP_003482487.1|1524835_1525366_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_134983899.1|1525405_1527442_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.5	6.2e-23
WP_042824203.1|1527555_1534575_+	Hpt domain-containing protein	NA	W8CYM9	Bacillus_phage	31.9	1.3e-11
WP_134983900.1|1534582_1535770_+	chemotaxis protein	NA	NA	NA	NA	NA
WP_008575177.1|1535803_1536280_+	chemotaxis protein CheW	NA	NA	NA	NA	NA
WP_042824201.1|1536510_1537104_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042824200.1|1538047_1539112_+	N(4)-(beta-N-acetylglucosaminyl)-L-asparaginase	NA	NA	NA	NA	NA
WP_042824199.1|1539108_1539840_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_042824198.1|1542014_1543175_-	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_042824196.1|1543777_1544107_+	RebB family R body protein	NA	NA	NA	NA	NA
WP_042824195.1|1544164_1544365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134812651.1|1544982_1547517_+	type III secretion system effector protein XopK	NA	NA	NA	NA	NA
WP_042824193.1|1547566_1549408_-	beta-galactosidase	NA	NA	NA	NA	NA
WP_042824192.1|1549687_1552030_-	glycoside hydrolase family 92 protein	NA	NA	NA	NA	NA
WP_042824191.1|1552115_1553579_-	glycoside hydrolase family 125 protein	NA	NA	NA	NA	NA
WP_171890730.1|1554497_1555466_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.9	9.9e-88
WP_134812925.1|1556362_1556764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042821447.1|1556905_1557868_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_134984164.1|1558200_1559445_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_171890756.1|1559931_1561076_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	59.2	3.1e-88
>prophage 5
NZ_CP053649	Xanthomonas axonopodis pv. vasculorum strain NCPPB 796 chromosome, complete genome	4871233	1688589	1763996	4871233	transposase,tRNA,holin	Acinetobacter_phage(25.0%)	44	NA	NA
WP_171890799.1|1688589_1689558_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.9	1.7e-87
WP_171890799.1|1691649_1692618_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.9	1.7e-87
WP_171890800.1|1692728_1694987_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_042825362.1|1695285_1695891_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171890801.1|1695887_1698539_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171890802.1|1698719_1699295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171890803.1|1699320_1700676_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_171890804.1|1700605_1701625_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171891036.1|1701962_1702568_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171890805.1|1702564_1705225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134984176.1|1705405_1705984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171890806.1|1706009_1708580_+	DUF2235 domain-containing protein	NA	NA	NA	NA	NA
WP_042823402.1|1709461_1711159_-	Kef family K(+) transporter	NA	NA	NA	NA	NA
WP_042823401.1|1712989_1715389_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	31.2	4.6e-09
WP_042823400.1|1715722_1718110_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	32.1	3.2e-10
WP_146089636.1|1718610_1718808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042823398.1|1719252_1721640_-	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	35.7	1.2e-09
WP_042823397.1|1721820_1723740_+	ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	31.3	6.2e-65
WP_042823396.1|1724447_1725323_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042823394.1|1725423_1726335_+	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	46.7	3.1e-59
WP_042823392.1|1728869_1731023_-|holin	phospholipase C, phosphocholine-specific	holin	NA	NA	NA	NA
WP_042823391.1|1731097_1733569_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042823389.1|1734024_1735269_-	MFS transporter	NA	NA	NA	NA	NA
WP_042823388.1|1735721_1736015_+	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_042823386.1|1736504_1737272_-	DUF3011 domain-containing protein	NA	NA	NA	NA	NA
WP_042823385.1|1737429_1739196_+|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_042823384.1|1739627_1740155_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042823383.1|1740252_1740930_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042823382.1|1741019_1741748_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_042823381.1|1741860_1742385_+	crossover junction endodeoxyribonuclease RuvC	NA	NA	NA	NA	NA
WP_003482577.1|1742542_1743127_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_042823379.1|1743323_1745228_+	potassium transporter Kup	NA	M1IBC2	Acanthocystis_turfacea_Chlorella_virus	33.7	1.1e-77
WP_042823378.1|1745739_1746783_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	28.2	1.2e-06
WP_042823377.1|1746835_1747294_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_042823376.1|1747305_1748085_+	protein TolQ	NA	NA	NA	NA	NA
WP_005913652.1|1748239_1748689_+	protein TolR	NA	NA	NA	NA	NA
WP_042823375.1|1748678_1749719_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_003482565.1|1749906_1751226_+	Tol-Pal system beta propeller repeat protein TolB	NA	NA	NA	NA	NA
WP_042823374.1|1751283_1751802_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_042823373.1|1751808_1752627_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_042823371.1|1752669_1753353_+	7-carboxy-7-deazaguanine synthase QueE	NA	J9PV61	Bacillus_phage	41.0	3.9e-38
WP_171890808.1|1753891_1755268_+|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	54.4	2.9e-64
WP_171890809.1|1761574_1762525_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_171890810.1|1762780_1763996_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	68.7	1.5e-101
>prophage 7
NZ_CP053649	Xanthomonas axonopodis pv. vasculorum strain NCPPB 796 chromosome, complete genome	4871233	1867723	1887371	4871233	transposase,integrase	Burkholderia_phage(50.0%)	16	1869665:1869683	1890713:1890731
WP_171890818.1|1867723_1868488_-|transposase	IS5 family transposase	transposase	A0A0N9SJT9	Paenibacillus_phage	30.6	2.2e-05
WP_171890820.1|1868659_1869553_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	51.3	6.4e-81
1869665:1869683	attL	GTTGTTCAGAGGTTCCCTA	NA	NA	NA	NA
WP_042825309.1|1869745_1870333_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_042825310.1|1870340_1871000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171891037.1|1871026_1872205_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_042825312.1|1872266_1873310_-	sulfotransferase	NA	NA	NA	NA	NA
WP_134812924.1|1873302_1874181_-	TauD/TfdA family dioxygenase	NA	NA	NA	NA	NA
WP_171890731.1|1874852_1875821_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.9	2.9e-87
WP_171890822.1|1875823_1876054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171890731.1|1876552_1877521_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.9	2.9e-87
WP_042822186.1|1878322_1878769_+	autotransporter	NA	NA	NA	NA	NA
WP_171890824.1|1879106_1879958_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	35.5	5.8e-31
WP_134812427.1|1883262_1883760_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134812428.1|1883717_1884818_+	N-acetylmuramoyl-L-alanine amidase	NA	NA	NA	NA	NA
WP_042821844.1|1885719_1886040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042821845.1|1886093_1887371_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	64.9	4.3e-155
1890713:1890731	attR	GTTGTTCAGAGGTTCCCTA	NA	NA	NA	NA
>prophage 8
NZ_CP053649	Xanthomonas axonopodis pv. vasculorum strain NCPPB 796 chromosome, complete genome	4871233	2123813	2205398	4871233	transposase,tRNA	uncultured_Mediterranean_phage(15.38%)	53	NA	NA
WP_042822097.1|2123813_2124923_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_042822099.1|2125184_2125724_-	Smr/MutS family protein	NA	NA	NA	NA	NA
WP_042822101.1|2125823_2126603_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.2	3.4e-70
WP_042822103.1|2126599_2127277_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.6e-37
WP_042822105.1|2127295_2127910_+	DedA family protein	NA	NA	NA	NA	NA
WP_042822107.1|2127906_2128686_+	peptidoglycan DD-metalloendopeptidase family protein	NA	NA	NA	NA	NA
WP_042822109.1|2128884_2129259_-	Xcc1710-like domain-containing protein	NA	NA	NA	NA	NA
WP_042822111.1|2129274_2129580_-	ribosome assembly RNA-binding protein YhbY	NA	NA	NA	NA	NA
WP_042822112.1|2129645_2130278_+	23S rRNA (uridine(2552)-2'-O)-methyltransferase RlmE	NA	NA	NA	NA	NA
WP_042822113.1|2130338_2132282_+	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	M4QMW8	Micromonas_pusilla_virus	43.4	1.1e-117
WP_042822114.1|2132408_2133311_+	dihydropteroate synthase	NA	NA	NA	NA	NA
WP_042822115.1|2133310_2134294_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_005915027.1|2134372_2134651_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_042822116.1|2134662_2135982_+	GTPase HflX	NA	NA	NA	NA	NA
WP_042822117.1|2136407_2136902_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	50.3	1.7e-27
WP_042822120.1|2137379_2139056_+	2-polyprenylphenol 6-hydroxylase	NA	G8DDN0	Micromonas_pusilla_virus	28.9	1.0e-39
WP_042822122.1|2139142_2139784_+	transcriptional repressor LexA	NA	A0A1W6JNS2	Morganella_phage	40.2	2.4e-13
WP_042822124.1|2139956_2140991_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	61.3	8.6e-114
WP_042822126.1|2141291_2141780_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_042822128.1|2141881_2144530_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	39.8	2.8e-84
WP_042822129.1|2144669_2144882_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	74.5	5.1e-13
WP_171890845.1|2145900_2146851_-|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_171890780.1|2146974_2147941_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.6	6.4e-87
WP_042822846.1|2148698_2150321_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_042822844.1|2150695_2150971_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_042822842.1|2150994_2152068_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_042822840.1|2152409_2154056_-	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_134812516.1|2154261_2154978_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_042822838.1|2155137_2156076_+	proline racemase family protein	NA	NA	NA	NA	NA
WP_171891041.1|2156192_2157353_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_017157080.1|2157349_2157595_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_042822835.1|2157587_2158901_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042822834.1|2158897_2159806_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_042824745.1|2160016_2161633_+	aldehyde dehydrogenase (NADP(+))	NA	NA	NA	NA	NA
WP_042822833.1|2161629_2162829_+	aminopeptidase P family protein	NA	NA	NA	NA	NA
WP_042822832.1|2162968_2164783_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_042822831.1|2164779_2166633_+	DUF885 family protein	NA	NA	NA	NA	NA
WP_042822830.1|2166696_2168283_+	APC family permease	NA	NA	NA	NA	NA
WP_134984065.1|2168272_2170612_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_134984068.1|2170611_2172246_+	DUF5597 domain-containg protein	NA	NA	NA	NA	NA
WP_134984066.1|2172338_2172635_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134984067.1|2174271_2175843_-	S8/S53 family peptidase	NA	A0A1V0SLL0	Klosneuvirus	36.3	2.2e-68
WP_042822824.1|2176309_2178667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042822823.1|2179136_2181953_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	26.0	2.7e-48
WP_171891042.1|2182405_2186716_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_042822820.1|2186712_2188299_+	family 43 glycosylhydrolase	NA	NA	NA	NA	NA
WP_042822819.1|2188613_2190959_+	S9 family peptidase	NA	NA	NA	NA	NA
WP_042822816.1|2194510_2196886_+	glycoside hydrolase family 127 protein	NA	NA	NA	NA	NA
WP_171890847.1|2197163_2198264_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_171890848.1|2198290_2199095_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_171890850.1|2199218_2202917_-	avirulence protein	NA	NA	NA	NA	NA
WP_171890847.1|2203145_2204246_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_171890730.1|2204429_2205398_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.9	9.9e-88
>prophage 9
NZ_CP053649	Xanthomonas axonopodis pv. vasculorum strain NCPPB 796 chromosome, complete genome	4871233	2238285	2311490	4871233	transposase,protease,tRNA,integrase	Burkholderia_phage(18.18%)	58	2253652:2253671	2323916:2323935
WP_171890853.1|2238285_2238561_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_042823309.1|2239951_2240194_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042823308.1|2242234_2242645_+	TcpQ domain-containing protein	NA	NA	NA	NA	NA
WP_042823306.1|2242770_2243802_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_042823305.1|2243798_2244566_+	TrbG/VirB9 family P-type conjugative transfer protein	NA	NA	NA	NA	NA
WP_171891044.1|2244955_2245732_+	TrbI/VirB10 family protein	NA	NA	NA	NA	NA
WP_171891045.1|2245737_2246787_+	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_042823303.1|2246849_2247674_+	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_042824820.1|2247732_2248146_+	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_134812562.1|2248138_2248450_+	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_042823301.1|2248550_2251004_+	VirB4 family type IV secretion/conjugal transfer ATPase	NA	NA	NA	NA	NA
WP_171890855.1|2250996_2251818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042824817.1|2251918_2253004_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_134812561.1|2253026_2253518_+	DUF4189 domain-containing protein	NA	NA	NA	NA	NA
2253652:2253671	attL	CTAAGGAACCTCTGAACAAC	NA	NA	NA	NA
WP_171890857.1|2253803_2254772_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.6	3.8e-87
WP_171890782.1|2254858_2256003_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	59.2	1.8e-88
WP_171890859.1|2257264_2258233_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.6	4.9e-87
WP_042822814.1|2258358_2259345_-	response regulator	NA	W8CYM9	Bacillus_phage	27.6	7.4e-06
WP_042822813.1|2259378_2263473_-	response regulator	NA	A0A1V0SGX0	Hokovirus	28.9	2.7e-57
WP_042822812.1|2263615_2264920_-	DUF445 family protein	NA	NA	NA	NA	NA
WP_042822810.1|2265092_2265947_-	plasmid replication/partition related protein	NA	A0A1B1INV8	uncultured_Mediterranean_phage	38.7	3.2e-13
WP_171890860.1|2266085_2267450_-	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_042822808.1|2267966_2269646_+	OFA family MFS transporter	NA	NA	NA	NA	NA
WP_042822807.1|2269652_2270498_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_042822806.1|2270494_2272843_+	FdhF/YdeP family oxidoreductase	NA	NA	NA	NA	NA
WP_042822805.1|2272832_2273111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042822804.1|2274887_2275349_-	bacteriohemerythrin	NA	NA	NA	NA	NA
WP_042822803.1|2275478_2276777_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	37.6	1.8e-20
WP_171890863.1|2276861_2278181_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_134983917.1|2278177_2279557_-	glutamine synthetase	NA	NA	NA	NA	NA
WP_042822797.1|2279700_2280456_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_042822796.1|2280462_2281848_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_134812510.1|2282189_2282444_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134812509.1|2282455_2283370_-	sel1 repeat family protein	NA	NA	NA	NA	NA
WP_042824742.1|2284053_2285421_+	aspartate aminotransferase family protein	NA	NA	NA	NA	NA
WP_042822793.1|2285643_2286759_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_042822792.1|2287007_2288210_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_042822790.1|2288206_2289793_+	multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_042822789.1|2289797_2291288_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_042822788.1|2291402_2292536_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	35.3	2.6e-26
WP_042822787.1|2292532_2293450_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_042822785.1|2293446_2294295_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_171890865.1|2294423_2295815_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_042822784.1|2295966_2296968_-	magnesium and cobalt transport protein CorA	NA	NA	NA	NA	NA
WP_134812507.1|2296983_2298246_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_042822783.1|2298242_2299121_-	CBS domain-containing protein	NA	NA	NA	NA	NA
WP_042822781.1|2299216_2299735_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042822780.1|2299734_2300220_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_042822778.1|2300318_2300861_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042822777.1|2300862_2301846_-	PhoH family protein	NA	A0A1B2ICF6	Erwinia_phage	48.6	7.3e-46
WP_042822776.1|2302269_2303724_-|tRNA	tRNA (N6-isopentenyl adenosine(37)-C2)-methylthiotransferase MiaB	tRNA	NA	NA	NA	NA
WP_134812506.1|2304494_2305676_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_042822775.1|2305814_2306798_+	lytic transglycosylase domain-containing protein	NA	A0A0H3V0Q1	Geobacillus_virus	56.9	7.4e-30
WP_042822774.1|2307272_2307917_+	ubiquinol-cytochrome c reductase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_042822772.1|2307916_2309176_+	cytochrome bc complex cytochrome b subunit	NA	NA	NA	NA	NA
WP_042822771.1|2309168_2309927_+	cytochrome c1	NA	NA	NA	NA	NA
WP_017159210.1|2310335_2310971_+	glutathione S-transferase N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_042822767.1|2311049_2311490_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	45.3	9.3e-25
2323916:2323935	attR	GTTGTTCAGAGGTTCCTTAG	NA	NA	NA	NA
>prophage 10
NZ_CP053649	Xanthomonas axonopodis pv. vasculorum strain NCPPB 796 chromosome, complete genome	4871233	2322900	2374400	4871233	transposase,integrase	Xanthomonas_phage(68.18%)	38	2311914:2311930	2329584:2329600
2311914:2311930	attL	TTTGCCCAGGCGCAGCT	NA	NA	NA	NA
WP_171890866.1|2322900_2323869_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.9	5.8e-88
WP_171890837.1|2326062_2327206_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	59.2	1.8e-88
WP_134812504.1|2327365_2328325_-|integrase	site-specific integrase	integrase	A0A0A1I5U0	Burkholderia_phage	34.6	1.4e-33
WP_171890868.1|2328327_2329302_+|transposase	IS5 family transposase	transposase	A0A077SK28	Escherichia_phage	53.0	7.2e-86
WP_134812655.1|2330638_2331172_+|transposase	transposase	transposase	K4I1H9	Acidithiobacillus_phage	64.1	4.6e-18
2329584:2329600	attR	TTTGCCCAGGCGCAGCT	NA	NA	NA	NA
WP_171890869.1|2331383_2331764_+	hypothetical protein	NA	A0A1W6DY99	Xanthomonas_phage	75.8	2.3e-48
WP_099800090.1|2331883_2332540_-	conjugal transfer protein	NA	A0A077JBM8	Xanthomonas_phage	85.4	1.7e-102
WP_171890871.1|2332539_2333706_-	zonular occludens toxin	NA	A0A077JGB2	Xanthomonas_phage	89.4	6.6e-203
WP_039573919.1|2333702_2334020_-	DUF2523 domain-containing protein	NA	A0A077JCZ2	Xanthomonas_phage	98.1	3.4e-53
WP_046831224.1|2334019_2335519_-	hypothetical protein	NA	A0A077JDC5	Xanthomonas_phage	87.4	2.3e-216
WP_039573915.1|2335626_2335893_-	hypothetical protein	NA	A0A077JBM7	Xanthomonas_phage	77.3	2.8e-24
WP_039573912.1|2335898_2336099_-	hypothetical protein	NA	A0A077JGA5	Xanthomonas_phage	98.5	8.7e-31
WP_039573910.1|2336124_2336421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082331134.1|2336747_2337467_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167389982.1|2337456_2337597_-	hypothetical protein	NA	NA	NA	NA	NA
WP_082331133.1|2337593_2337893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_039573907.1|2337892_2338075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134984159.1|2338228_2338696_+	hypothetical protein	NA	A0A1D6ZIU9	Xanthomonas_phage	36.9	7.3e-12
WP_099800090.1|2339195_2339852_-	conjugal transfer protein	NA	A0A077JBM8	Xanthomonas_phage	85.4	1.7e-102
WP_099800091.1|2339851_2341018_-	zonular occludens toxin	NA	A0A077JGB2	Xanthomonas_phage	89.7	2.3e-203
WP_039585104.1|2341014_2341332_-	DUF2523 domain-containing protein	NA	A0A077JCZ2	Xanthomonas_phage	98.1	4.4e-53
WP_099800092.1|2341331_2342831_-	hypothetical protein	NA	A0A077JDC5	Xanthomonas_phage	90.4	4.0e-221
WP_039584212.1|2342937_2343204_-	hypothetical protein	NA	A0A077JBM7	Xanthomonas_phage	75.0	1.8e-23
WP_099800093.1|2343206_2343407_-	hypothetical protein	NA	A0A077JGA5	Xanthomonas_phage	95.5	2.5e-30
WP_099800094.1|2343513_2343807_-	single-stranded DNA-binding protein	NA	B1NI78	Stenotrophomonas_phage	61.7	2.1e-25
WP_099800095.1|2343911_2344973_-	replication initiation factor domain-containing protein	NA	S0F3F7	Stenotrophomonas_phage	39.8	5.8e-65
WP_099800096.1|2344969_2345269_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099800097.1|2345268_2345451_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134984158.1|2345447_2345636_-	hypothetical protein	NA	A0A1W6DXV6	Xanthomonas_phage	73.8	1.4e-17
WP_042824257.1|2349603_2350308_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_042824259.1|2351540_2351816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134984070.1|2352923_2355653_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_042824979.1|2356143_2357259_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_042824260.1|2357251_2360344_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_042824261.1|2360340_2361825_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_134812862.1|2361943_2362966_+	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_042824263.1|2362962_2363574_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_171890872.1|2373437_2374400_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 11
NZ_CP053649	Xanthomonas axonopodis pv. vasculorum strain NCPPB 796 chromosome, complete genome	4871233	2412473	2447988	4871233	transposase,plate	Burkholderia_phage(33.33%)	26	NA	NA
WP_042822442.1|2412473_2413811_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_042822443.1|2413807_2415187_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_042822444.1|2415183_2415723_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042822445.1|2415731_2417672_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.3	4.8e-41
WP_042822447.1|2417981_2418464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042822448.1|2418653_2419103_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042822451.1|2419106_2421860_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	30.4	5.4e-78
WP_042822453.1|2421897_2422908_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_042822455.1|2422871_2424749_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_042822457.1|2424752_2425256_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_042822458.1|2425243_2426077_-	ImpE protein	NA	NA	NA	NA	NA
WP_042822459.1|2426112_2426616_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_042822460.1|2426715_2428233_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_134812475.1|2428225_2428753_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_171890874.1|2429140_2430109_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	51.2	3.4e-88
WP_171890875.1|2430429_2431586_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_134984155.1|2434340_2435540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171890731.1|2435634_2436603_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.9	2.9e-87
WP_171890877.1|2437864_2439008_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	59.2	9.0e-88
WP_042824524.1|2439837_2441343_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_134812339.1|2441347_2441719_-	DUF3742 family protein	NA	NA	NA	NA	NA
WP_042821126.1|2441748_2442162_-	PIN domain-containing protein	NA	NA	NA	NA	NA
WP_042821127.1|2442148_2442382_-	AbrB/MazE/SpoVT family DNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_171890878.1|2442615_2443420_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	33.7	2.5e-07
WP_171890880.1|2443543_2447350_-	avirulence protein	NA	NA	NA	NA	NA
WP_171890881.1|2447619_2447988_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 12
NZ_CP053649	Xanthomonas axonopodis pv. vasculorum strain NCPPB 796 chromosome, complete genome	4871233	2948168	3005546	4871233	transposase,tRNA	uncultured_Mediterranean_phage(55.56%)	45	NA	NA
WP_042821447.1|2948168_2949131_+|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_042824823.1|2949154_2949757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042823314.1|2950517_2951138_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	NA	NA	NA	NA
WP_042823315.1|2951127_2951904_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_042823316.1|2951897_2952632_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_042823317.1|2952628_2953231_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_042823318.1|2953227_2954355_-	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_042823319.1|2954351_2955443_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_042823321.1|2955439_2956735_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_042823322.1|2956731_2957646_-	ATP phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_042823323.1|2957642_2957981_-	Trp operon repressor	NA	NA	NA	NA	NA
WP_042823324.1|2958519_2959932_-|tRNA	histidine--tRNA ligase	tRNA	A0A2K9L6G5	Tupanvirus	28.6	5.1e-40
WP_164514263.1|2960008_2960200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171890915.1|2960135_2960801_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_042823326.1|2961225_2961972_-	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_171890917.1|2962073_2963384_-	threonine synthase	NA	NA	NA	NA	NA
WP_042823328.1|2963539_2963854_+	EthD family reductase	NA	NA	NA	NA	NA
WP_042824825.1|2964601_2966254_-	tannase/feruloyl esterase family alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_042823329.1|2966808_2967750_-	homoserine kinase	NA	NA	NA	NA	NA
WP_042823330.1|2967746_2970254_-	bifunctional aspartate kinase/homoserine dehydrogenase I	NA	NA	NA	NA	NA
WP_171891053.1|2971060_2971888_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_171890786.1|2971884_2972199_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_167551809.1|2972744_2972897_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042823348.1|2972992_2973961_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	30.3	2.3e-28
WP_042823349.1|2974055_2975900_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003489768.1|2976090_2976444_-	preprotein translocase subunit YajC	NA	NA	NA	NA	NA
WP_042823350.1|2976575_2977721_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	45.9	2.9e-86
WP_042823351.1|2977790_2978861_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_042823353.1|2979020_2979452_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_042823356.1|2979574_2981071_+	aminotransferase class III-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_134984069.1|2981422_2982130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042823358.1|2984841_2987400_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_042824830.1|2987551_2988184_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_042823359.1|2988507_2990268_-	glycoside hydrolase family 9 protein	NA	NA	NA	NA	NA
WP_171890721.1|2990274_2990562_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042823361.1|2990558_2992337_-	gamma-glutamyltransferase	NA	NA	NA	NA	NA
WP_003489796.1|2992333_2992618_-	YfhL family 4Fe-4S dicluster ferredoxin	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	57.0	1.1e-18
WP_042823364.1|2992849_2993347_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042823365.1|2993393_2993900_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	41.1	6.2e-25
WP_171890919.1|2993896_2994586_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_042823367.1|2994761_2996666_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	36.6	6.7e-112
WP_171890788.1|3001259_3002228_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	51.2	2.0e-88
WP_171890756.1|3002758_3003903_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	59.2	3.1e-88
WP_134812932.1|3004080_3004449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171890921.1|3004577_3005546_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.6	2.9e-87
>prophage 13
NZ_CP053649	Xanthomonas axonopodis pv. vasculorum strain NCPPB 796 chromosome, complete genome	4871233	3051540	3119768	4871233	transposase,tRNA	Burkholderia_phage(18.75%)	59	NA	NA
WP_171890925.1|3051540_3052509_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.3	4.2e-86
WP_171890927.1|3052781_3053810_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.2	5.6e-73
WP_042822155.1|3055560_3056130_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042822153.1|3056327_3057299_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042822151.1|3057713_3058346_+	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	NA	NA	NA	NA
WP_042822150.1|3058342_3059491_+	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	34.3	5.5e-53
WP_042822148.1|3059484_3060393_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_042822147.1|3060389_3061268_+	2-dehydro-3-deoxygalactonokinase	NA	NA	NA	NA	NA
WP_042822145.1|3061350_3061674_+	ferredoxin family protein	NA	NA	NA	NA	NA
WP_042822144.1|3061803_3062322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042822142.1|3062338_3063247_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_002813792.1|3063339_3063966_+	glycine cleavage system protein R	NA	NA	NA	NA	NA
WP_042822140.1|3063977_3064328_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_042822139.1|3064365_3064848_+	peroxiredoxin	NA	NA	NA	NA	NA
WP_042822138.1|3064930_3066328_+	PhoH family protein	NA	A0A2I7SAD7	Vibrio_phage	37.7	2.6e-73
WP_042822137.1|3066327_3066810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042822136.1|3066816_3067488_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_042822135.1|3067525_3068335_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_042822134.1|3069663_3070656_-	VTT domain-containing protein	NA	NA	NA	NA	NA
WP_042822133.1|3070700_3071645_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_042822131.1|3071779_3072481_+	pirin family protein	NA	NA	NA	NA	NA
WP_042824679.1|3072894_3074853_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	38.6	9.6e-13
WP_171890929.1|3075256_3076225_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.3	8.4e-87
WP_134812518.1|3076276_3076480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_005914053.1|3076749_3076950_+	general stress protein	NA	NA	NA	NA	NA
WP_042824748.1|3077458_3077734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042822848.1|3078235_3078772_+	lipocalin family protein	NA	A0A2I2L3Z7	Orpheovirus	32.5	3.4e-13
WP_042822849.1|3078887_3079364_+	LEA type 2 family protein	NA	NA	NA	NA	NA
WP_042822850.1|3079401_3081195_+	acyl-CoA dehydrogenase C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_042822852.1|3081398_3082055_+	HNH endonuclease	NA	F5B475	Synechococcus_phage	40.2	3.0e-11
WP_134984001.1|3082493_3084410_+	1-deoxy-D-xylulose-5-phosphate synthase	NA	NA	NA	NA	NA
WP_134984000.1|3085691_3086291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042822854.1|3086280_3087435_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_042822855.1|3087425_3088385_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_042822856.1|3090421_3091429_-	TraB/GumN family protein	NA	NA	NA	NA	NA
WP_042822857.1|3091522_3091984_-	cupin domain-containing protein	NA	A0A291AU44	Pandoravirus	40.7	1.8e-18
WP_042822858.1|3092018_3092813_-	WecB/TagA/CpsF family glycosyltransferase	NA	NA	NA	NA	NA
WP_134983999.1|3092817_3093612_-	polysaccharide pyruvyl transferase family protein	NA	A0A1V0SAR6	Catovirus	35.0	9.2e-23
WP_042822861.1|3093648_3094845_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_042822862.1|3094908_3096399_-	lipopolysaccharide biosynthesis protein	NA	NA	NA	NA	NA
WP_042822863.1|3096416_3097466_-	glycosyltransferase	NA	NA	NA	NA	NA
WP_042822864.1|3097462_3098605_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_042824750.1|3098672_3099731_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_134983998.1|3099774_3100863_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_167551803.1|3100859_3102149_-	polysaccharide biosynthesis protein GumE	NA	NA	NA	NA	NA
WP_042822868.1|3102243_3103698_-	undecaprenyl-phosphate glucose phosphotransferase	NA	NA	NA	NA	NA
WP_146089639.1|3103941_3105381_-	GumC family protein	NA	NA	NA	NA	NA
WP_042822871.1|3105362_3106061_-	polysaccharide export protein	NA	NA	NA	NA	NA
WP_042822872.1|3106667_3107024_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003466661.1|3107004_3107304_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	38.9	3.6e-12
WP_042822873.1|3107325_3109704_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_008574581.1|3109805_3110801_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	35.6	3.0e-31
WP_003484828.1|3111088_3111448_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_002811096.1|3111458_3111656_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_134812520.1|3111905_3112448_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	35.2	1.5e-13
WP_042822876.1|3112496_3114401_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.3	1.4e-125
WP_171890931.1|3116983_3118085_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	1.5e-42
WP_171890933.1|3118924_3119239_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171890935.1|3119309_3119768_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.2	5.1e-34
>prophage 14
NZ_CP053649	Xanthomonas axonopodis pv. vasculorum strain NCPPB 796 chromosome, complete genome	4871233	3487757	3559329	4871233	transposase	Burkholderia_phage(18.18%)	43	NA	NA
WP_171890953.1|3487757_3488726_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.9	1.7e-87
WP_042825416.1|3489449_3489890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171890955.1|3489989_3490793_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	33.7	2.5e-07
WP_134812338.1|3490790_3491090_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042821125.1|3492208_3492448_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042821124.1|3493638_3494304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042821123.1|3494655_3495129_-	DUF3574 domain-containing protein	NA	NA	NA	NA	NA
WP_042824522.1|3495358_3497794_+	TonB-dependent receptor	NA	A0A0P0I887	Acinetobacter_phage	23.6	9.7e-15
WP_171890957.1|3498240_3499319_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	43.7	3.0e-53
WP_171890782.1|3500640_3501784_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	59.2	1.8e-88
WP_042823491.1|3502894_3503653_+	trehalose-phosphatase	NA	NA	NA	NA	NA
WP_042823490.1|3503702_3505481_+	glycoside hydrolase family 15 protein	NA	NA	NA	NA	NA
WP_042823488.1|3505477_3506845_+	alpha,alpha-trehalose-phosphate synthase (UDP-forming)	NA	NA	NA	NA	NA
WP_171891058.1|3507474_3509913_+	glucose/quinate/shikimate family membrane-bound PQQ-dependent dehydrogenase	NA	NA	NA	NA	NA
WP_171890959.1|3512682_3517704_-	avirulence protein	NA	NA	NA	NA	NA
WP_171890961.1|3522805_3526597_-	avirulence protein	NA	NA	NA	NA	NA
WP_167551778.1|3527538_3527733_+|transposase	transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	52.3	1.4e-12
WP_042823485.1|3528264_3528549_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042823484.1|3528545_3528728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042823483.1|3528854_3529652_+	D-alanyl-D-alanine carboxypeptidase family protein	NA	NA	NA	NA	NA
WP_171890963.1|3530409_3530796_-	DUF423 domain-containing protein	NA	NA	NA	NA	NA
WP_042821562.1|3530879_3532058_-	polyketide cyclase	NA	NA	NA	NA	NA
WP_042821561.1|3532407_3533049_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_042821560.1|3533048_3534245_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_042821559.1|3534489_3535089_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_042821558.1|3535092_3535830_+	septum site-determining protein MinC	NA	NA	NA	NA	NA
WP_042821556.1|3535865_3536675_+	septum site-determining protein MinD	NA	NA	NA	NA	NA
WP_003484370.1|3536677_3536935_+	cell division topological specificity factor MinE	NA	NA	NA	NA	NA
WP_042821555.1|3537003_3537495_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042821554.1|3537669_3538959_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_042821553.1|3538951_3539668_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.3	4.4e-24
WP_042821551.1|3539884_3541618_+	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_042821550.1|3541716_3542481_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_042821549.1|3542477_3544145_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_042821548.1|3544255_3546274_+	M2 family metallopeptidase	NA	NA	NA	NA	NA
WP_042821546.1|3546348_3546753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042824628.1|3546769_3548023_-	multidrug effflux MFS transporter	NA	NA	NA	NA	NA
WP_042821545.1|3548302_3550459_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	27.6	7.0e-33
WP_171890965.1|3550455_3551805_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_042821541.1|3551785_3552589_-	sulfotransferase	NA	M4QPS9	Synechococcus_phage	28.4	2.4e-26
WP_042824626.1|3553019_3553208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171890967.1|3553660_3556597_+	aminomethyl-transferring glycine dehydrogenase	NA	M4QFZ1	Prochlorococcus_phage	50.5	2.8e-258
WP_171890730.1|3558360_3559329_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.9	9.9e-88
>prophage 15
NZ_CP053649	Xanthomonas axonopodis pv. vasculorum strain NCPPB 796 chromosome, complete genome	4871233	3623668	3649432	4871233	transposase	Burkholderia_phage(33.33%)	23	NA	NA
WP_171890970.1|3623668_3624637_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.6	2.2e-87
WP_167551835.1|3624688_3625174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171890811.1|3625244_3626213_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.6	8.4e-87
WP_167551771.1|3626307_3626475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042821493.1|3626471_3627941_-	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	33.2	2.7e-28
WP_042821492.1|3627945_3628668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042821491.1|3628667_3629303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042821490.1|3629366_3631748_-	DEAD/DEAH box helicase family protein	NA	NA	NA	NA	NA
WP_042821489.1|3631916_3632180_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171890971.1|3633598_3634567_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	51.2	3.4e-88
WP_134812939.1|3635122_3636877_+	YdiU family protein	NA	NA	NA	NA	NA
WP_171890972.1|3636842_3637648_-|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	38.5	4.5e-09
WP_042825105.1|3637794_3638226_+	toxin-activating lysine-acyltransferase	NA	NA	NA	NA	NA
WP_042825106.1|3638288_3639566_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_134812906.1|3639666_3640212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134812873.1|3640368_3640893_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134984150.1|3640937_3641576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134812907.1|3641642_3642173_-	hypothetical protein	NA	NA	NA	NA	NA
WP_171890973.1|3642651_3643754_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.9	1.2e-44
WP_171891060.1|3643835_3644622_+|transposase	IS5 family transposase	transposase	A0A0N9SHJ4	Paenibacillus_phage	37.5	4.1e-07
WP_134812930.1|3644684_3645179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_167551838.1|3645206_3646016_-	pesticin	NA	A0A2H5BFZ4	Vibrio_phage	38.3	6.5e-24
WP_171890837.1|3648288_3649432_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	59.2	1.8e-88
>prophage 16
NZ_CP053649	Xanthomonas axonopodis pv. vasculorum strain NCPPB 796 chromosome, complete genome	4871233	3959365	4017816	4871233	transposase	Staphylococcus_phage(21.43%)	49	NA	NA
WP_171890985.1|3959365_3960106_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
WP_134984105.1|3960262_3960979_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_134984106.1|3960968_3963629_-	sensor histidine kinase KdpD	NA	B5LWN0	Feldmannia_species_virus	27.7	4.6e-10
WP_042824269.1|3963683_3964313_-	potassium-transporting ATPase subunit KdpC	NA	NA	NA	NA	NA
WP_042824270.1|3964353_3966402_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	28.1	2.0e-37
WP_042824271.1|3966414_3968208_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_005910961.1|3968223_3968316_-	potassium-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_042824272.1|3969004_3969820_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134812660.1|3969816_3970569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042824981.1|3971264_3972290_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042824275.1|3973471_3974824_-	F-box protein	NA	NA	NA	NA	NA
WP_042822664.1|3976666_3977641_-	thiamine-phosphate kinase	NA	NA	NA	NA	NA
WP_042822663.1|3977750_3978230_-	transcription antitermination factor NusB	NA	NA	NA	NA	NA
WP_042822661.1|3978226_3978691_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	40.3	1.1e-23
WP_042822660.1|3979041_3980181_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	34.0	1.8e-51
WP_042822658.1|3980177_3980780_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	38.1	2.3e-26
WP_134984094.1|3981348_3981972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_134984093.1|3982024_3983134_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.4	8.3e-46
WP_146089651.1|3983130_3983616_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_003490311.1|3983612_3984137_-	transcriptional repressor NrdR	NA	NA	NA	NA	NA
WP_134984092.1|3984239_3985493_-	serine hydroxymethyltransferase	NA	A0A219Y950	Aeromonas_phage	54.1	1.0e-100
WP_134812492.1|3988176_3988416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042822652.1|3989263_3989749_-	RcnB family protein	NA	NA	NA	NA	NA
WP_042822651.1|3989972_3991634_+	energy-dependent translational throttle protein EttA	NA	A0A1B0RXA0	Streptococcus_phage	28.8	5.4e-41
WP_042822650.1|3991821_3992160_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042822649.1|3992320_3993151_-	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_042822647.1|3993208_3993784_-	S-(hydroxymethyl)glutathione synthase	NA	NA	NA	NA	NA
WP_042822646.1|3993852_3994962_-	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	30.7	1.7e-35
WP_042822645.1|3995028_3995304_-	formaldehyde-responsive transcriptional repressor FrmR	NA	NA	NA	NA	NA
WP_042822643.1|3995425_3996760_-|transposase	ISL3 family transposase	transposase	A0A2D1GQC1	Lysinibacillus_phage	38.8	4.4e-86
WP_134812490.1|3997468_3998086_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_171890986.1|3998196_3999165_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.6	1.9e-86
WP_134812937.1|3999337_3999541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_134984185.1|3999539_3999749_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171890987.1|3999758_4001135_-|transposase	IS5 family transposase	transposase	K4ICS3	Acidithiobacillus_phage	59.4	7.5e-73
WP_042825367.1|4001665_4002820_+	2-aminoethylphosphonate--pyruvate transaminase	NA	NA	NA	NA	NA
WP_042825368.1|4002819_4004142_+	O-acetylhomoserine aminocarboxypropyltransferase/cysteine synthase	NA	NA	NA	NA	NA
WP_042825370.1|4004167_4005208_+	fatty acid desaturase family protein	NA	NA	NA	NA	NA
WP_134812940.1|4005225_4006086_+	gamma-glutamyl-gamma-aminobutyrate hydrolase family protein	NA	NA	NA	NA	NA
WP_042825376.1|4006122_4006722_+	LysE family translocator	NA	NA	NA	NA	NA
WP_134812941.1|4006789_4007743_+	homoserine O-succinyltransferase	NA	NA	NA	NA	NA
WP_042825379.1|4007790_4009143_+	glutamine synthetase	NA	NA	NA	NA	NA
WP_171890739.1|4009954_4010890_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_042821443.1|4011729_4012830_-	glycosyltransferase	NA	A0A142BZU7	Faustovirus	28.9	9.8e-15
WP_042824610.1|4012907_4013687_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_042821444.1|4013683_4015183_+	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	24.9	1.9e-13
WP_042821445.1|4015215_4016142_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042821446.1|4016141_4016711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042821447.1|4016853_4017816_-|transposase	IS1595 family transposase	transposase	NA	NA	NA	NA
>prophage 17
NZ_CP053649	Xanthomonas axonopodis pv. vasculorum strain NCPPB 796 chromosome, complete genome	4871233	4093574	4173968	4871233	transposase,protease	Ralstonia_phage(16.67%)	54	NA	NA
WP_171890992.1|4093574_4094705_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	58.2	3.5e-92
WP_042821267.1|4096130_4097096_+	phosphoenolpyruvate mutase	NA	NA	NA	NA	NA
WP_042821266.1|4097092_4098310_+	phosphonopyruvate decarboxylase	NA	NA	NA	NA	NA
WP_042821265.1|4098306_4099260_+	diiron oxygenase	NA	NA	NA	NA	NA
WP_042821264.1|4099256_4100009_+	NTP transferase domain-containing protein	NA	NA	NA	NA	NA
WP_042821263.1|4099993_4101994_+	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1X9VNR2	Mimivirus	29.4	4.5e-26
WP_042821262.1|4103477_4104317_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_042824566.1|4105017_4105725_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042821261.1|4105785_4106472_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_042821259.1|4107744_4108368_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_042821258.1|4108712_4109414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042821257.1|4109586_4111581_-	M1 family metallopeptidase	NA	NA	NA	NA	NA
WP_042821256.1|4111701_4112592_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_042821255.1|4112782_4113544_-	bifunctional demethylmenaquinone methyltransferase/2-methoxy-6-polyprenyl-1,4-benzoquinol methylase UbiE	NA	NA	NA	NA	NA
WP_042821254.1|4115289_4116378_+	HlyD family secretion protein	NA	NA	NA	NA	NA
WP_042824564.1|4116490_4116991_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_008571705.1|4116987_4117443_+	nucleoside deaminase	NA	NA	NA	NA	NA
WP_167551787.1|4117476_4117614_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042821253.1|4117642_4119010_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A2H5BJT2	Erwinia_phage	29.1	6.8e-42
WP_042821252.1|4119110_4119662_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_042821251.1|4120047_4120965_-	tyrosine recombinase XerC	NA	S5M872	Bacillus_phage	24.4	1.7e-12
WP_042821250.1|4121164_4121836_-	DUF484 family protein	NA	NA	NA	NA	NA
WP_042821249.1|4121832_4122687_-	diaminopimelate epimerase	NA	NA	NA	NA	NA
WP_042821248.1|4122676_4122931_-	lipoprotein	NA	NA	NA	NA	NA
WP_003482768.1|4122987_4123386_-	YbaN family protein	NA	NA	NA	NA	NA
WP_042824563.1|4123501_4125610_-	oligopeptidase B	NA	F2Y2Z7	Organic_Lake_phycodnavirus	26.3	3.9e-28
WP_042821247.1|4125719_4126904_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_042821246.1|4127310_4129404_-	S9 family peptidase	NA	NA	NA	NA	NA
WP_042821245.1|4129471_4129783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042821244.1|4130136_4130706_+	lipocalin family protein	NA	NA	NA	NA	NA
WP_042821243.1|4130816_4131782_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_171890993.1|4131791_4131947_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042821242.1|4132297_4133098_+	DUF481 domain-containing protein	NA	NA	NA	NA	NA
WP_042821241.1|4133256_4134171_-	hydroxymethylbilane synthase	NA	NA	NA	NA	NA
WP_042821240.1|4134201_4134939_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_042821239.1|4134969_4136022_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	33.0	1.8e-18
WP_042821238.1|4136026_4136695_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_042821237.1|4136830_4138768_-	glucans biosynthesis glucosyltransferase MdoH	NA	NA	NA	NA	NA
WP_042821234.1|4143560_4145048_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	57.1	4.9e-126
WP_042821233.1|4145422_4146871_+	cellulase family glycosylhydrolase	NA	G0YQI7	Erwinia_phage	33.9	4.8e-54
WP_134812353.1|4147254_4149393_+	cache domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	41.6	9.8e-11
WP_042821232.1|4149991_4152586_-	PAS domain S-box protein	NA	G3MA91	Bacillus_virus	28.6	1.9e-08
WP_042821231.1|4152838_4155718_+	insulinase family protein	NA	NA	NA	NA	NA
WP_042821230.1|4156286_4157216_+	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_171891068.1|4157328_4158234_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042821228.1|4158834_4159587_-	endonuclease	NA	NA	NA	NA	NA
WP_171891069.1|4162785_4163094_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171890994.1|4163130_4164232_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	41.0	1.9e-42
WP_017155500.1|4164929_4165841_-	magnesium transporter	NA	NA	NA	NA	NA
WP_042821304.1|4166076_4167072_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042821305.1|4167159_4168536_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_134812368.1|4170291_4170624_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042821306.1|4170825_4172472_+	glycoside hydrolase family 6 protein	NA	NA	NA	NA	NA
WP_171890995.1|4172846_4173968_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	56.5	2.6e-87
>prophage 18
NZ_CP053649	Xanthomonas axonopodis pv. vasculorum strain NCPPB 796 chromosome, complete genome	4871233	4188684	4227678	4871233	transposase,tRNA,integrase	Burkholderia_virus(16.67%)	25	4187916:4187931	4226168:4226183
4187916:4187931	attL	GCTGGCCGAACTGGGC	NA	NA	NA	NA
WP_171890996.1|4188684_4189900_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	65.5	2.6e-93
WP_042821220.1|4189952_4190267_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171890997.1|4190798_4191613_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_171890998.1|4191957_4192581_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042824551.1|4192925_4194512_-	SDR family oxidoreductase	NA	M1NLX1	Moumouvirus	27.3	3.8e-36
WP_171890999.1|4197836_4198265_-	type II toxin-antitoxin system VapC family toxin	NA	NA	NA	NA	NA
WP_042824658.1|4198261_4198516_-	type II toxin-antitoxin system Phd/YefM family antitoxin	NA	NA	NA	NA	NA
WP_042821842.1|4198941_4202490_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_171890837.1|4205987_4207132_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	59.2	1.8e-88
WP_042825274.1|4208018_4209113_-|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	36.9	2.4e-53
WP_171891000.1|4210912_4211899_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_008572796.1|4212047_4212293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_008572798.1|4212559_4214437_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	35.5	1.8e-37
WP_042823944.1|4214545_4214986_-|tRNA	D-tyrosyl-tRNA(Tyr) deacylase	tRNA	NA	NA	NA	NA
WP_171891001.1|4214984_4216001_+	lauroyl acyltransferase	NA	NA	NA	NA	NA
WP_042823947.1|4216050_4216572_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_042823948.1|4216816_4217950_+	GTP cyclohydrolase II RibA	NA	A0A2H4PQS2	Staphylococcus_phage	40.9	4.7e-28
WP_042824925.1|4218088_4218565_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_042823949.1|4218561_4220067_+	PH domain-containing protein	NA	NA	NA	NA	NA
WP_134812625.1|4220142_4221201_-	CDP-glycerol glycerophosphotransferase family protein	NA	NA	NA	NA	NA
WP_042823950.1|4221201_4222026_+	glycosyltransferase family 2 protein	NA	NA	NA	NA	NA
WP_042824927.1|4222226_4223504_-	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_042823951.1|4223672_4225394_-	glycosyltransferase family 39 protein	NA	NA	NA	NA	NA
WP_042823952.1|4225444_4226755_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
4226168:4226183	attR	GCCCAGTTCGGCCAGC	NA	NA	NA	NA
WP_042823954.1|4226754_4227678_-|tRNA	methionyl-tRNA formyltransferase	tRNA	NA	NA	NA	NA
>prophage 19
NZ_CP053649	Xanthomonas axonopodis pv. vasculorum strain NCPPB 796 chromosome, complete genome	4871233	4732001	4798340	4871233	transposase,tail	Burkholderia_phage(16.67%)	35	NA	NA
WP_171891019.1|4732001_4732970_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	50.9	2.9e-87
WP_171891020.1|4734300_4735401_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_171891021.1|4735628_4739741_+	avirulence protein	NA	NA	NA	NA	NA
WP_042824435.1|4743225_4744470_+	GAF domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_042825022.1|4744639_4746241_-	glucan biosynthesis protein D	NA	NA	NA	NA	NA
WP_042824436.1|4746308_4747286_-	DUF4380 domain-containing protein	NA	NA	NA	NA	NA
WP_171891022.1|4747846_4748161_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_042825024.1|4749090_4749906_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	A0A127AWE5	Bacillus_phage	27.0	6.3e-19
WP_171891022.1|4750902_4751217_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_171891077.1|4751256_4751919_-|transposase	transposase family protein	transposase	NA	NA	NA	NA
WP_042821227.1|4751915_4752233_-	DUF1153 domain-containing protein	NA	NA	NA	NA	NA
WP_042822422.1|4759862_4761044_+	benzoate/H(+) symporter BenE family transporter	NA	NA	NA	NA	NA
WP_042822421.1|4761120_4763025_-	GAF domain-containing protein	NA	B5LWN8	Feldmannia_species_virus	33.3	1.5e-18
WP_042822420.1|4763021_4763615_-	biliverdin-producing heme oxygenase	NA	NA	NA	NA	NA
WP_042822418.1|4763714_4764965_-	tetracycline resistance MFS efflux pump	NA	NA	NA	NA	NA
WP_042822416.1|4765240_4767403_-	lytic murein transglycosylase	NA	NA	NA	NA	NA
WP_134812474.1|4767945_4768332_-	YchJ family protein	NA	NA	NA	NA	NA
WP_134984074.1|4768373_4769216_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_042824440.1|4770451_4774483_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_042824441.1|4774973_4775675_-	DUF4194 domain-containing protein	NA	NA	NA	NA	NA
WP_042824443.1|4775661_4777131_-	DUF3375 domain-containing protein	NA	NA	NA	NA	NA
WP_134984073.1|4777150_4777753_-	GTP cyclohydrolase I FolE	NA	E7DN69	Pneumococcus_phage	50.0	2.4e-47
WP_042824445.1|4777883_4778336_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_134812688.1|4778422_4778641_+	DUF1656 domain-containing protein	NA	NA	NA	NA	NA
WP_042824448.1|4779555_4781007_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_042824449.1|4783444_4784806_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.4	6.4e-32
WP_042824450.1|4786636_4787164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042824451.1|4787433_4787640_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042824452.1|4787626_4788739_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_134812871.1|4788915_4789422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_042825027.1|4790235_4790529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042824454.1|4790715_4792335_+	enterochelin esterase	NA	NA	NA	NA	NA
WP_042824456.1|4792438_4792837_-	DUF2384 domain-containing protein	NA	NA	NA	NA	NA
WP_042824457.1|4792940_4793351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042824461.1|4797974_4798340_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	60.3	3.9e-29
