The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042652	Pseudoarcobacter acticola strain KCTC 52212 chromosome, complete genome	3019071	246641	316054	3019071	tRNA,transposase	Bacillus_virus(28.57%)	53	NA	NA
WP_172124263.1|246641_248450_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	34.9	1.2e-110
WP_172128473.1|248560_249076_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172124265.1|249115_250606_-	DUF3373 family protein	NA	NA	NA	NA	NA
WP_172124267.1|250715_251036_-	cytochrome C	NA	NA	NA	NA	NA
WP_172124269.1|251126_252455_+	fibronectin/fibrinogen-binding protein	NA	NA	NA	NA	NA
WP_172124271.1|252503_253868_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_172124273.1|254017_254929_+	methylenetetrahydrofolate reductase	NA	NA	NA	NA	NA
WP_172124275.1|254925_255306_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_172124277.1|255322_255676_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_172124279.1|255840_257400_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_172124281.1|257902_258991_+	ABC transporter ATP-binding protein	NA	F2Y165	Organic_Lake_phycodnavirus	29.3	2.0e-07
WP_172124283.1|259005_260085_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	28.3	6.4e-19
WP_172124285.1|260081_260951_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_172128475.1|261007_261784_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_172124287.1|261795_262074_+	DUF2160 domain-containing protein	NA	NA	NA	NA	NA
WP_172124289.1|262108_263812_+	carbohydrate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_172124291.1|263903_265274_+	glycerol kinase GlpK	NA	NA	NA	NA	NA
WP_172124293.1|265278_265842_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_172124295.1|265885_266284_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172124297.1|266673_267405_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172124149.1|268176_269778_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_172124299.1|269774_271238_-	pyruvate kinase	NA	NA	NA	NA	NA
WP_172124301.1|271249_272872_-	NADP-dependent glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_172124303.1|272963_274622_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_172124305.1|274635_275268_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_172124307.1|275267_277088_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_172124309.1|277080_277779_-	6-phosphogluconolactonase	NA	NA	NA	NA	NA
WP_172128477.1|277768_279046_-	glucose-6-phosphate dehydrogenase	NA	A0A222YYZ2	Synechococcus_phage	33.3	1.3e-55
WP_172124311.1|279174_280539_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_172124313.1|280618_281395_+	complement resistance protein TraT	NA	NA	NA	NA	NA
WP_172124315.1|281533_282292_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_172124317.1|282288_283356_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_172124319.1|283345_283630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172124321.1|283629_284055_+	DUF1566 domain-containing protein	NA	NA	NA	NA	NA
WP_172128479.1|284067_284631_+	serine hydrolase family protein	NA	NA	NA	NA	NA
WP_172128481.1|284642_285653_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	33.8	4.9e-45
WP_172124323.1|285643_286000_+	translation initiation factor SUI1	NA	NA	NA	NA	NA
WP_172124325.1|286147_286582_+	permease	NA	NA	NA	NA	NA
WP_172124327.1|286578_287085_+	permease	NA	NA	NA	NA	NA
WP_172124329.1|287093_288479_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_172124331.1|288582_289362_+	thiazole synthase	NA	NA	NA	NA	NA
WP_172124333.1|290326_291130_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	28.6	1.2e-09
WP_172124335.1|291126_292035_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_172124337.1|292049_293009_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_172124339.1|293174_294410_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_172124149.1|301824_303426_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_172124341.1|303572_304310_-	CRISPR-associated protein Cas6	NA	NA	NA	NA	NA
WP_172124343.1|304419_307893_-	acyl-[ACP]--phospholipid O-acyltransferase	NA	NA	NA	NA	NA
WP_172124345.1|307896_308982_-	cobalamin B12-binding domain-containing protein	NA	NA	NA	NA	NA
WP_172124347.1|308971_311368_-	EAL domain-containing protein	NA	G3MA91	Bacillus_virus	42.1	3.1e-29
WP_172124349.1|311369_314597_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_172124351.1|314689_314860_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172124353.1|314872_316054_-|transposase	transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP042652	Pseudoarcobacter acticola strain KCTC 52212 chromosome, complete genome	3019071	1088346	1137768	3019071	protease,transposase	Bacillus_phage(25.0%)	45	NA	NA
WP_172125801.1|1088346_1089405_-|protease	RIP metalloprotease RseP	protease	NA	NA	NA	NA
WP_172125803.1|1089414_1089957_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_172125805.1|1089956_1090736_-	enoyl-ACP reductase	NA	NA	NA	NA	NA
WP_172125807.1|1090735_1091623_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_172125809.1|1091625_1092093_-	globin	NA	NA	NA	NA	NA
WP_172125811.1|1092092_1093436_-	insulinase family protein	NA	L7RBE7	Acanthamoeba_polyphaga_moumouvirus	30.1	3.1e-39
WP_172125813.1|1093448_1094507_-	quinone-dependent dihydroorotate dehydrogenase	NA	NA	NA	NA	NA
WP_172125815.1|1094592_1096302_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.9	2.7e-56
WP_172125817.1|1096390_1097692_-	murein biosynthesis integral membrane protein MurJ	NA	NA	NA	NA	NA
WP_172125819.1|1097691_1099275_-	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_172125821.1|1099339_1099990_-	desulfoferrodoxin FeS4 iron-binding domain-containing protein	NA	NA	NA	NA	NA
WP_172125823.1|1100048_1100711_-	rubrerythrin family protein	NA	NA	NA	NA	NA
WP_172125441.1|1101031_1102063_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_172125825.1|1102262_1102667_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_172125827.1|1102670_1103588_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_172125829.1|1103590_1104010_-	rRNA maturation RNase YbeY	NA	NA	NA	NA	NA
WP_172125831.1|1104085_1105435_-	DNA repair protein RadA	NA	NA	NA	NA	NA
WP_172125833.1|1105533_1106025_+	ribonuclease H	NA	NA	NA	NA	NA
WP_172125835.1|1106016_1107000_-	lipid A deacylase LpxR family protein	NA	NA	NA	NA	NA
WP_172125837.1|1107061_1107622_+	esterase	NA	NA	NA	NA	NA
WP_172125839.1|1107783_1108839_+|transposase	IS256 family transposase	transposase	A0A218MNI5	uncultured_virus	47.8	3.7e-35
WP_172125626.1|1109022_1110663_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_172125841.1|1111015_1111606_-	hydrogenase-4 component G	NA	NA	NA	NA	NA
WP_172125843.1|1111677_1112322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172125845.1|1112336_1113383_-	signal recognition particle-docking protein FtsY	NA	D6PHS7	uncultured_phage	37.0	6.9e-10
WP_172125847.1|1113392_1113959_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_172125849.1|1114020_1114560_+	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_172125851.1|1114571_1116116_+	ribonuclease Y	NA	NA	NA	NA	NA
WP_172125853.1|1116145_1116742_+	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_172125855.1|1116747_1117548_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_172125857.1|1117544_1118366_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_172125859.1|1118439_1119222_+	TIGR02757 family protein	NA	NA	NA	NA	NA
WP_172125861.1|1119316_1120201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172124149.1|1120412_1122014_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_172125863.1|1122102_1122657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172125865.1|1122663_1123791_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.7	5.7e-18
WP_172125867.1|1123816_1124260_-	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	42.5	1.7e-18
WP_172128563.1|1124303_1126253_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L0W2	Tupanvirus	28.1	3.2e-37
WP_172125868.1|1126745_1127714_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_172125870.1|1127729_1130411_+	AAA family ATPase	NA	I7ATR8	Escherichia_phage	24.5	1.7e-15
WP_172125872.1|1130407_1132723_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172125874.1|1132944_1133295_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172125876.1|1133294_1133639_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172125878.1|1133968_1135999_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172125880.1|1136463_1137768_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP042652	Pseudoarcobacter acticola strain KCTC 52212 chromosome, complete genome	3019071	1195198	1260783	3019071	integrase,transposase	Hokovirus(37.5%)	47	1196719:1196738	1241512:1241531
WP_172125984.1|1195198_1196494_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
1196719:1196738	attL	GATACTTTTGTAGTACTTTT	NA	NA	NA	NA
WP_172125985.1|1196775_1198593_+	TolC family protein	NA	NA	NA	NA	NA
WP_172125986.1|1198605_1199325_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_172125987.1|1199340_1213224_+	DUF4347 domain-containing protein	NA	NA	NA	NA	NA
WP_172125988.1|1213245_1214592_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_172125989.1|1214591_1216712_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_172125990.1|1216838_1217909_+	FIST C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_172125991.1|1218017_1218758_-	ATP-binding protein	NA	K4HZD4	Acidithiobacillus_phage	41.2	1.4e-44
WP_172125992.1|1220516_1222088_+	hypothetical protein	NA	A0A1V0SGX0	Hokovirus	32.3	1.1e-27
WP_172125993.1|1222074_1223187_+	hybrid sensor histidine kinase/response regulator	NA	W8CYM9	Bacillus_phage	31.1	2.6e-07
WP_172125994.1|1223237_1224020_+	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_172125995.1|1224027_1225878_+	HAMP domain-containing histidine kinase	NA	A0A1V0SGX0	Hokovirus	36.1	2.2e-27
WP_172125996.1|1225888_1226548_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172125997.1|1226649_1227924_-	response regulator	NA	NA	NA	NA	NA
WP_172125998.1|1227932_1228649_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_172125999.1|1228940_1229399_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172126000.1|1229535_1231065_+	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	54.5	2.6e-143
WP_172126001.1|1231074_1232208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172126002.1|1233269_1233647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172126003.1|1233639_1234491_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_172126004.1|1234606_1234918_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_172128569.1|1234991_1236059_+|integrase	tyrosine-type recombinase/integrase	integrase	M5AAB1	Nitratiruptor_phage	33.0	5.7e-44
WP_172126005.1|1236127_1238032_-	cache domain-containing protein	NA	A0A1V0SGX0	Hokovirus	25.9	1.4e-08
WP_172124157.1|1238090_1239449_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_172126006.1|1239615_1240671_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_172126007.1|1240752_1241499_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_172126008.1|1241572_1241755_+	hypothetical protein	NA	NA	NA	NA	NA
1241512:1241531	attR	GATACTTTTGTAGTACTTTT	NA	NA	NA	NA
WP_172126009.1|1242322_1244215_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_172126010.1|1244234_1245266_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_172126011.1|1245262_1246081_+	thiazole synthase	NA	NA	NA	NA	NA
WP_172126012.1|1246361_1246706_-	DUF3147 family protein	NA	NA	NA	NA	NA
WP_172126013.1|1246689_1247919_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_172126014.1|1247908_1248568_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_172126015.1|1248637_1248910_-	metal/formaldehyde-sensitive transcriptional repressor	NA	NA	NA	NA	NA
WP_172126016.1|1248980_1249925_+	CDF family Co(II)/Ni(II) efflux transporter DmeF	NA	NA	NA	NA	NA
WP_172126017.1|1250010_1250349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172126018.1|1250566_1251706_-	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_172126019.1|1251860_1252259_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172126020.1|1252463_1252925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172128571.1|1253469_1254372_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172126021.1|1254468_1255851_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	41.4	1.5e-100
WP_172126022.1|1255925_1256804_-	RluA family pseudouridine synthase	NA	NA	NA	NA	NA
WP_172126023.1|1257028_1257454_+	arsenate reductase family protein	NA	NA	NA	NA	NA
WP_172126024.1|1257438_1257738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172126025.1|1258432_1259692_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_172126026.1|1259777_1260176_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172124293.1|1260219_1260783_+|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP042652	Pseudoarcobacter acticola strain KCTC 52212 chromosome, complete genome	3019071	2408612	2441013	3019071	protease,transposase	Agrobacterium_phage(12.5%)	29	NA	NA
WP_172127294.1|2408612_2410838_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	40.2	3.0e-148
WP_172127296.1|2410840_2411140_-|protease	ATP-dependent Clp protease adaptor ClpS	protease	A0A218MMY6	uncultured_virus	37.6	2.5e-13
WP_172127298.1|2411209_2411842_+	dethiobiotin synthase	NA	NA	NA	NA	NA
WP_172127300.1|2412160_2413291_+	aldolase	NA	NA	NA	NA	NA
WP_172127302.1|2413306_2415826_+	AMP-binding protein	NA	A0A2K9L3I8	Tupanvirus	26.9	3.1e-16
WP_172127304.1|2415835_2416906_+	MaoC family dehydratase	NA	NA	NA	NA	NA
WP_172127306.1|2416933_2417917_+	CoA ester lyase	NA	NA	NA	NA	NA
WP_172127308.1|2418147_2419641_+	fumarate hydratase	NA	NA	NA	NA	NA
WP_172127310.1|2419823_2420660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172127312.1|2420695_2422072_-|transposase	transposase	transposase	O80301	Enterobacteria_phage	30.5	8.7e-21
WP_172127314.1|2422434_2425248_-	nitrate- and nitrite sensing domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	35.4	3.5e-08
WP_172124293.1|2425614_2426178_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_172126026.1|2426221_2426620_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172127316.1|2426678_2427068_+	large conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_172127318.1|2427103_2427667_-	flavin reductase family protein	NA	NA	NA	NA	NA
WP_172127320.1|2427679_2427904_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172127322.1|2427894_2429121_-	MFS transporter	NA	NA	NA	NA	NA
WP_172127324.1|2429062_2430772_-	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_172127326.1|2430758_2431466_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172127350.1|2431476_2432940_-	BatD family protein	NA	NA	NA	NA	NA
WP_172125880.1|2433227_2434532_+|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
WP_172127357.1|2434848_2435922_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172127359.1|2435936_2436308_-	response regulator	NA	Q56AR1	Bacillus_thuringiensis_phage	27.1	4.8e-06
WP_172127361.1|2436468_2437257_+	flagellar basal-body rod protein FlgG	NA	NA	NA	NA	NA
WP_172127363.1|2437273_2437648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172127365.1|2437658_2437880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172127367.1|2437935_2438598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172127369.1|2438702_2439449_-	ATP-binding protein	NA	A0A059NT77	Lactococcus_phage	28.5	2.3e-23
WP_172127371.1|2439471_2441013_-|transposase	IS21 family transposase	transposase	K4I413	Acidithiobacillus_phage	37.9	1.6e-84
>prophage 5
NZ_CP042652	Pseudoarcobacter acticola strain KCTC 52212 chromosome, complete genome	3019071	2449535	2504320	3019071	integrase,tRNA,transposase	Enterobacteria_phage(23.08%)	59	2469898:2469914	2512706:2512722
WP_172127397.1|2449535_2450474_-|tRNA	glycine--tRNA ligase subunit alpha	tRNA	NA	NA	NA	NA
WP_172127399.1|2450474_2450708_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_172127401.1|2450707_2451202_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	40.8	2.0e-20
WP_172127403.1|2451242_2452505_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172127405.1|2452522_2453809_-	U32 family peptidase	NA	Q6DW11	Phage_TP	37.5	3.5e-48
WP_172127407.1|2453932_2456779_-	cache domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	31.5	2.5e-06
WP_172127409.1|2456895_2458617_-|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_172127411.1|2459002_2460532_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_172127413.1|2460534_2461401_-	NAD(+)/NADH kinase	NA	NA	NA	NA	NA
WP_172127415.1|2461604_2463710_-	elongation factor G	NA	A0A2K5B2A5	Erysipelothrix_phage	24.7	6.2e-50
WP_172127417.1|2463719_2464187_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_172127419.1|2464198_2464582_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_172127421.1|2464857_2466003_+	MFS transporter	NA	NA	NA	NA	NA
WP_172127423.1|2466027_2466219_-	YwbE family protein	NA	NA	NA	NA	NA
WP_172127425.1|2466218_2466719_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172127427.1|2466766_2467582_-	DUF2971 domain-containing protein	NA	NA	NA	NA	NA
WP_172127429.1|2467780_2468377_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172127431.1|2468378_2468645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172127433.1|2468742_2469681_-	hypothetical protein	NA	NA	NA	NA	NA
2469898:2469914	attL	CAAAGAATAATTTTTTA	NA	NA	NA	NA
WP_172127435.1|2469951_2470206_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_172127437.1|2470202_2471510_+	HipA domain-containing protein	NA	NA	NA	NA	NA
WP_172127439.1|2471978_2472251_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_172127441.1|2472254_2472488_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_172127443.1|2472703_2473054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172127445.1|2473813_2474176_-	hypothetical protein	NA	A0A0P0ZCT8	Stx2-converting_phage	47.0	7.4e-20
WP_172127447.1|2474178_2474472_-	type II toxin-antitoxin system HigB family toxin	NA	A0A0P0ZE17	Stx2-converting_phage	44.2	1.4e-16
WP_172127449.1|2474722_2475034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172124293.1|2475121_2475685_-|transposase	IS630 family transposase	transposase	NA	NA	NA	NA
WP_172124295.1|2475728_2476127_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_172127451.1|2476175_2476910_-|integrase	site-specific integrase	integrase	Q7M297	Enterobacteria_phage	30.4	1.5e-27
WP_172128695.1|2476935_2477118_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172127453.1|2477163_2477367_-	DUF4102 domain-containing protein	NA	NA	NA	NA	NA
WP_172127455.1|2477706_2477958_-	type II toxin-antitoxin system YafQ family toxin	NA	NA	NA	NA	NA
WP_172128697.1|2477961_2478192_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_172127457.1|2478472_2478697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172127459.1|2478671_2479193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172127461.1|2479193_2479592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172127463.1|2479624_2479924_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172127465.1|2479988_2480438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172127467.1|2480427_2481099_+	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_172127469.1|2481659_2482586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172124149.1|2482776_2484378_+|transposase	IS1634 family transposase	transposase	NA	NA	NA	NA
WP_172127471.1|2484477_2485134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172127473.1|2485594_2485888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172127475.1|2485959_2486622_-	AAA family ATPase	NA	A4JWV7	Burkholderia_virus	36.9	5.0e-14
WP_172127477.1|2486790_2487018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172127479.1|2487088_2487343_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172127481.1|2487437_2488112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172127483.1|2488255_2488810_-	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	47.5	4.9e-39
WP_172127485.1|2489500_2490532_+	YbfB/YjiJ family MFS transporter	NA	NA	NA	NA	NA
WP_172127487.1|2490571_2491630_+|transposase	IS630 family transposase	transposase	S5VXX4	Leptospira_phage	32.1	2.2e-40
WP_172127489.1|2491869_2492850_-	nucleotidyl transferase AbiEii/AbiGii toxin family protein	NA	NA	NA	NA	NA
WP_172127491.1|2492842_2493457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172127493.1|2493561_2493930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172127495.1|2495535_2496549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172127497.1|2496586_2497795_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_172127499.1|2497787_2499275_-	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	31.0	1.0e-35
WP_172127501.1|2499443_2500292_-	Abi family protein	NA	A3QSC6	Clostridium_virus	33.0	1.1e-34
WP_172127503.1|2503090_2504320_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	31.9	3.1e-54
2512706:2512722	attR	CAAAGAATAATTTTTTA	NA	NA	NA	NA
>prophage 6
NZ_CP042652	Pseudoarcobacter acticola strain KCTC 52212 chromosome, complete genome	3019071	2651720	2658699	3019071	tRNA	Campylobacter_virus(33.33%)	9	NA	NA
WP_172127735.1|2651720_2652404_+	7-cyano-7-deazaguanine synthase QueC	NA	M1PKZ7	Cellulophaga_phage	37.1	1.2e-26
WP_172127737.1|2652404_2652938_+	6-carboxytetrahydropterin synthase	NA	H6SU72	Campylobacter_virus	52.2	2.7e-47
WP_172127739.1|2652930_2653695_+	7-carboxy-7-deazaguanine synthase QueE	NA	D5GV09	Campylobacter_virus	45.6	6.3e-53
WP_172127741.1|2653762_2654506_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.4	2.3e-15
WP_128359949.1|2654598_2654829_+	acyl carrier protein	NA	M4QDG5	Prochlorococcus_phage	66.0	7.0e-08
WP_172127743.1|2654939_2656196_+	beta-ketoacyl-ACP synthase II	NA	NA	NA	NA	NA
WP_172127745.1|2656264_2657203_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_172127747.1|2657247_2657577_-	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_172127749.1|2657706_2658699_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	34.5	1.6e-32
>prophage 7
NZ_CP042652	Pseudoarcobacter acticola strain KCTC 52212 chromosome, complete genome	3019071	2698358	2710419	3019071	tRNA	Bacillus_phage(22.22%)	12	NA	NA
WP_172127825.1|2698358_2699882_+	bifunctional GNAT family N-acetyltransferase/carbon-nitrogen hydrolase family protein	NA	M1HRJ8	Acanthocystis_turfacea_Chlorella_virus	29.5	8.8e-06
WP_172127827.1|2699917_2700880_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	28.5	1.5e-11
WP_172127829.1|2700881_2702231_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	34.5	8.2e-56
WP_172127831.1|2702243_2703017_-	4-hydroxy-tetrahydrodipicolinate reductase	NA	NA	NA	NA	NA
WP_172127833.1|2703030_2703960_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	43.9	7.1e-59
WP_172127835.1|2704202_2704520_-	thioredoxin	NA	A0A0K2FIM3	Achromobacter_phage	37.6	9.0e-14
WP_172127837.1|2704707_2707263_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.3	1.1e-74
WP_172127839.1|2707272_2707752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172127841.1|2707861_2708434_+	C40 family peptidase	NA	X5JAJ3	Clostridium_phage	34.2	2.7e-08
WP_172127843.1|2708449_2709016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172127845.1|2709132_2709753_+	C40 family peptidase	NA	S5MM68	Bacillus_phage	37.7	8.8e-13
WP_172128713.1|2710110_2710419_+	C40 family peptidase	NA	S5MM68	Bacillus_phage	42.1	1.6e-15
