The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053706	Pseudomonas aeruginosa strain PAC1 chromosome, complete genome	7564383	1274670	1297299	7564383	integrase,transposase	Salmonella_phage(25.0%)	22	1273926:1273942	1299732:1299748
1273926:1273942	attL	TCTGGTGCGAAAGCCCG	NA	NA	NA	NA
WP_023082813.1|1274670_1277676_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	25.7	5.1e-74
WP_010953865.1|1277684_1278047_+	Tn4652, tnpA repressor protein TnpC	NA	NA	NA	NA	NA
WP_010953868.1|1278607_1279741_-	Ni(II)/Co(II) efflux transporter permease subunit MrdH	NA	NA	NA	NA	NA
WP_010953869.1|1279751_1280039_-	metal-sensing transcriptional repressor MreA	NA	NA	NA	NA	NA
WP_010953870.1|1280156_1280516_+	hypothetical protein	NA	NA	NA	NA	NA
WP_090315687.1|1280550_1280799_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023082810.1|1280807_1281845_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_031297681.1|1281985_1282372_+	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_088171445.1|1284537_1285750_+|transposase	IS3 family transposase	transposase	Q8W6R2	Burkholderia_virus	67.0	4.1e-99
WP_010953879.1|1286266_1286695_-	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_172441387.1|1287141_1287870_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003131969.1|1287967_1288402_-	mercury resistance transcriptional regulator MerR	NA	NA	NA	NA	NA
WP_003131974.1|1288473_1288824_+	mercuric ion transporter MerT	NA	NA	NA	NA	NA
WP_003131987.1|1288836_1289112_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_047710219.1|1289183_1290869_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.3	2.7e-40
WP_000995360.1|1290886_1291252_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_003132004.1|1291248_1291485_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_003132006.1|1291481_1292471_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_003116647.1|1293131_1294502_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_033938195.1|1294835_1295678_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032437899.1|1295795_1296329_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001389365.1|1296534_1297299_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
1299732:1299748	attR	TCTGGTGCGAAAGCCCG	NA	NA	NA	NA
>prophage 2
NZ_CP053706	Pseudomonas aeruginosa strain PAC1 chromosome, complete genome	7564383	1304292	1356249	7564383	integrase,transposase	Escherichia_phage(30.0%)	46	1307362:1307379	1349409:1349426
WP_001389365.1|1304292_1305057_+|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_153549545.1|1305081_1305414_+	GDP-mannose 4,6-dehydratase	NA	A0A1D7XFE8	Escherichia_phage	44.7	1.5e-14
WP_023082278.1|1305410_1306295_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	57.3	2.0e-95
WP_023082273.1|1307129_1308473_-|transposase	IS1380 family transposase	transposase	NA	NA	NA	NA
1307362:1307379	attL	CGCATCTGGTTGGCGGCG	NA	NA	NA	NA
WP_043155999.1|1308696_1309137_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_001389365.1|1309325_1310090_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_041855125.1|1311565_1311778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172441116.1|1311770_1312778_+	DNA cytosine methyltransferase	NA	I6NLI4	Burkholderia_phage	60.9	7.1e-105
WP_023082828.1|1312843_1314214_+|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_033938195.1|1314631_1315474_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_032437899.1|1315591_1316125_+	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_003089120.1|1318289_1318688_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_003089115.1|1318762_1319113_+	mercury transporter MerT	NA	NA	NA	NA	NA
WP_003150552.1|1319125_1319401_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_003089113.1|1319408_1319621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003299771.1|1319633_1322627_-|transposase	Tn3 family transposase	transposase	Q1MVP5	Enterobacteria_phage	47.6	5.7e-259
WP_003150546.1|1322630_1323041_-	putative toxin-antitoxin system toxin component, PIN family	NA	NA	NA	NA	NA
WP_003089107.1|1323040_1323280_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003150544.1|1323481_1324411_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	46.9	1.9e-40
WP_010953882.1|1324554_1325553_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_011005888.1|1325592_1326237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010953884.1|1326217_1326697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003122765.1|1327844_1328387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_160328546.1|1329153_1330344_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_079275384.1|1330327_1331872_+|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_003450769.1|1331858_1334135_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086009756.1|1334131_1334602_+	hypothetical protein	NA	NA	NA	NA	NA
WP_171946279.1|1334760_1334907_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046720545.1|1335036_1335702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003450771.1|1335760_1337155_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003450774.1|1337151_1337901_-	TatD family hydrolase	NA	NA	NA	NA	NA
WP_003450777.1|1337900_1339166_-	7-cyano-7-deazaguanine synthase	NA	NA	NA	NA	NA
WP_031300120.1|1339162_1340008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033873463.1|1340007_1341963_-	NTPase KAP	NA	NA	NA	NA	NA
WP_010794468.1|1342102_1343329_-|transposase	IS256-like element ISPa1328 family transposase	transposase	A0A218MNI5	uncultured_virus	47.1	8.0e-50
WP_003450790.1|1343694_1345917_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003450792.1|1345918_1347079_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003450793.1|1347582_1347879_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003450795.1|1347963_1348410_+	hypothetical protein	NA	A0A2H4J163	uncultured_Caudovirales_phage	26.7	1.5e-06
WP_003450798.1|1348596_1348788_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003450800.1|1348902_1349184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003450802.1|1349180_1349582_-	hypothetical protein	NA	NA	NA	NA	NA
1349409:1349426	attR	CGCATCTGGTTGGCGGCG	NA	NA	NA	NA
WP_003120168.1|1352140_1352788_-	DUF3218 family protein	NA	NA	NA	NA	NA
WP_010895604.1|1352799_1353819_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010895605.1|1353851_1354580_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010466230.1|1355268_1356249_-|transposase	IS5-like element ISPre2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.0	7.0e-97
>prophage 3
NZ_CP053706	Pseudomonas aeruginosa strain PAC1 chromosome, complete genome	7564383	1570662	1610017	7564383	plate,tail	Enterobacteria_phage(50.0%)	31	NA	NA
WP_003122697.1|1570662_1571994_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_003124582.1|1572053_1572530_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003089493.1|1572738_1573284_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_003089494.1|1573306_1574791_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003089495.1|1574864_1575362_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_010793011.1|1575374_1575800_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_010793012.1|1575783_1577577_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_010793013.1|1577540_1578557_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_010793014.1|1578558_1581108_+	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.4	1.2e-76
WP_003116944.1|1581198_1582074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003116945.1|1582143_1582929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010793015.1|1582935_1584939_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.8	1.2e-42
WP_003114514.1|1584949_1585486_+	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_003089513.1|1585508_1585904_-	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_003110901.1|1586180_1586822_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_010793016.1|1587022_1588228_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003114512.1|1588644_1590960_-	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_003089521.1|1590956_1591427_-	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_003104944.1|1591692_1591929_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003089526.1|1592223_1592466_+	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_003104946.1|1592542_1593694_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003114511.1|1593790_1594711_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010793017.1|1595256_1597545_-	acylase	NA	NA	NA	NA	NA
WP_003114509.1|1597667_1598999_-	lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein	NA	NA	NA	NA	NA
WP_003103620.1|1599131_1599611_-	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003120136.1|1599774_1600770_+	FecR family protein	NA	NA	NA	NA	NA
WP_003089547.1|1600870_1602046_+	pyoverdine export/recycling transporter periplasmic adaptor subunit PvdR	NA	NA	NA	NA	NA
WP_003122681.1|1604041_1605466_+	pyoverdine export/recycling transporter outer membrane subunit OmpQ	NA	NA	NA	NA	NA
WP_003139293.1|1605514_1607149_-	pyoverdine maturation tyrosinase PvdP	NA	NA	NA	NA	NA
WP_003103610.1|1607364_1608711_+|tail	pyoverdine-tailoring dipeptidase-like protein PvdM	tail	NA	NA	NA	NA
WP_003114503.1|1608733_1610017_+|tail	pyoverdine-tailoring periplasmic protein PvdN	tail	NA	NA	NA	NA
>prophage 4
NZ_CP053706	Pseudomonas aeruginosa strain PAC1 chromosome, complete genome	7564383	2198805	2205699	7564383	tRNA	uncultured_Caudovirales_phage(83.33%)	9	NA	NA
WP_003090386.1|2198805_2199474_+	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
WP_010793082.1|2199584_2199980_+	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	1.6e-47
WP_003090389.1|2199976_2200336_+	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090391.1|2200335_2200641_+	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003119979.1|2200637_2200973_+	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.5e-38
WP_003097625.1|2200969_2201953_+	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	3.5e-141
WP_010793083.1|2202040_2203015_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003113366.1|2203019_2204417_-	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097631.1|2204418_2205699_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
>prophage 5
NZ_CP053706	Pseudomonas aeruginosa strain PAC1 chromosome, complete genome	7564383	2326997	2421859	7564383	protease,transposase	uncultured_Mediterranean_phage(20.0%)	51	NA	NA
WP_074198705.1|2326997_2328881_+|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A2L0V0F4	Agrobacterium_phage	32.3	4.4e-39
WP_003090610.1|2328882_2329521_+	radical SAM protein	NA	NA	NA	NA	NA
WP_010793096.1|2329535_2335832_+	DUF4011 domain-containing protein	NA	NA	NA	NA	NA
WP_010793097.1|2335828_2337178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003451853.1|2337342_2337564_+	type I toxin-antitoxin system SymE family toxin	NA	NA	NA	NA	NA
WP_003155927.1|2337959_2338340_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_134536507.1|2341978_2342746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088171342.1|2342742_2345742_-	N-6 DNA methylase	NA	NA	NA	NA	NA
WP_088171343.1|2345738_2346194_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088171344.1|2346557_2346794_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_088171345.1|2346952_2349043_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_172441259.1|2349039_2355405_-	DEAD/DEAH box helicase	NA	A0A1B1IUF6	uncultured_Mediterranean_phage	24.1	7.0e-81
WP_088171347.1|2355543_2360457_-	class I SAM-dependent DNA methyltransferase	NA	A0A1B1IUC6	uncultured_Mediterranean_phage	28.7	1.2e-06
WP_172441260.1|2360470_2363365_-	DEAD/DEAH box helicase family protein	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	27.6	2.5e-46
WP_010466230.1|2364306_2365287_-|transposase	IS5-like element ISPre2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.0	7.0e-97
WP_078458434.1|2365462_2366110_+	peptidase M15	NA	NA	NA	NA	NA
WP_124101420.1|2366345_2366675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172441261.1|2366935_2368264_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_088171595.1|2368429_2370778_+	anti-phage defense ZorAB system ZorA	NA	NA	NA	NA	NA
WP_034020197.1|2370777_2371521_+	OmpA family protein	NA	NA	NA	NA	NA
WP_172441262.1|2373695_2376668_+	DEAD/DEAH box helicase	NA	Q2NP48	Hyphantria_cunea_nuclear_polyhedrosis_virus	26.0	5.1e-26
WP_010466230.1|2376707_2377688_+|transposase	IS5-like element ISPre2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.0	7.0e-97
WP_172441263.1|2378636_2378915_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031691239.1|2379046_2379325_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088171593.1|2379439_2380315_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_078458431.1|2380870_2381485_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088171591.1|2381596_2382319_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088171590.1|2382374_2384645_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_088171589.1|2384647_2386198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058199733.1|2386446_2387031_-	ABATE domain-containing protein	NA	NA	NA	NA	NA
WP_078458428.1|2387162_2388044_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_162598217.1|2388558_2390088_+	diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.8	2.8e-12
WP_088171588.1|2390148_2392830_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_058199742.1|2393301_2394075_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_058199743.1|2394448_2395357_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_009684096.1|2396480_2396813_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_009684097.1|2396809_2397145_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_009684098.1|2397206_2398742_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	45.9	1.6e-116
WP_009684099.1|2398775_2399309_-	NUDIX domain-containing protein	NA	A0A2H4J8B3	uncultured_Caudovirales_phage	96.2	2.4e-67
WP_012316922.1|2399401_2400253_-	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	92.9	1.9e-143
WP_009684101.1|2400264_2401752_-	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	98.4	2.4e-266
WP_058199745.1|2402576_2403581_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_172441264.1|2403740_2404427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034020251.1|2404429_2405506_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_058199747.1|2405498_2406398_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172441265.1|2406394_2408794_-	dynamin family protein	NA	NA	NA	NA	NA
WP_088171587.1|2409497_2411531_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.1	5.4e-19
WP_088171586.1|2411527_2415160_-	exodeoxyribonuclease V subunit beta	NA	S5M596	Bacillus_phage	22.8	1.1e-11
WP_058199751.1|2415156_2418555_-	exodeoxyribonuclease V subunit gamma	NA	NA	NA	NA	NA
WP_078458447.1|2419293_2419887_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010794468.1|2420632_2421859_-|transposase	IS256-like element ISPa1328 family transposase	transposase	A0A218MNI5	uncultured_virus	47.1	8.0e-50
>prophage 6
NZ_CP053706	Pseudomonas aeruginosa strain PAC1 chromosome, complete genome	7564383	2429115	2500709	7564383	transposase	uncultured_virus(18.75%)	58	NA	NA
WP_033983075.1|2429115_2430627_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	53.6	1.5e-122
WP_172441269.1|2430547_2431138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162598221.1|2431487_2434208_+	UvrD-helicase domain-containing protein	NA	A0A1V0SAV1	Catovirus	25.7	2.4e-14
WP_088171579.1|2434471_2434687_-	YgdI/YgdR family lipoprotein	NA	NA	NA	NA	NA
WP_088171578.1|2435203_2435557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088171577.1|2435738_2436401_-	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_088171576.1|2436746_2436944_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	49.2	5.8e-11
WP_172441270.1|2437207_2438887_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_033983075.1|2439370_2440882_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	53.6	1.5e-122
WP_023980255.1|2440945_2441281_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_079388890.1|2441277_2441676_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_088171598.1|2442307_2444224_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088171573.1|2444598_2445075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088171571.1|2446048_2446630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088171570.1|2446655_2446865_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172441271.1|2447221_2448307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088171568.1|2448859_2449858_-	DUF4105 domain-containing protein	NA	NA	NA	NA	NA
WP_088171597.1|2449854_2451783_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_172441400.1|2452032_2453040_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_010466230.1|2453114_2454095_+|transposase	IS5-like element ISPre2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.0	7.0e-97
WP_088171495.1|2454502_2455258_+	acetoacetyl-CoA reductase	NA	NA	NA	NA	NA
WP_088171494.1|2455560_2457261_+	class I poly(R)-hydroxyalkanoic acid synthase	NA	NA	NA	NA	NA
WP_088171493.1|2457287_2458361_+	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_128688850.1|2458357_2461102_+	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	31.7	4.2e-22
WP_128688851.1|2461105_2462221_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_010466230.1|2462461_2463442_+|transposase	IS5-like element ISPre2 family transposase	transposase	A0A077K814	Ralstonia_phage	59.0	7.0e-97
WP_172441401.1|2463563_2464898_+	TolC family outer membrane protein	NA	NA	NA	NA	NA
WP_088171489.1|2465240_2466020_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_088171488.1|2466016_2467225_-	acetate/propionate family kinase	NA	NA	NA	NA	NA
WP_088171487.1|2467221_2468151_-	phosphate acetyltransferase	NA	NA	NA	NA	NA
WP_172441272.1|2468147_2470694_-	DUF3141 domain-containing protein	NA	NA	NA	NA	NA
WP_088171485.1|2470941_2471508_+	phasin family protein	NA	NA	NA	NA	NA
WP_088171484.1|2471541_2472066_-	polyhydroxyalkanoate synthesis repressor PhaR	NA	NA	NA	NA	NA
WP_172441273.1|2473107_2474076_+	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	41.9	1.1e-57
WP_172441274.1|2474155_2474437_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172441275.1|2474676_2475339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172441276.1|2475409_2476003_+	DUF4339 domain-containing protein	NA	NA	NA	NA	NA
WP_172441277.1|2476084_2477089_+	YqaJ viral recombinase family protein	NA	A6XMH8	Bacillus_virus	39.1	4.1e-52
WP_172441278.1|2477168_2478080_+	hydrolase or metal-binding protein	NA	NA	NA	NA	NA
WP_172441279.1|2478149_2478332_+	carbon storage regulator CsrA	NA	A0A0U1UNS3	Pseudomonas_phage	50.8	3.2e-08
WP_172441280.1|2478354_2478534_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172441281.1|2478812_2479310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172441282.1|2479310_2480552_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_172441283.1|2481465_2482632_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172441284.1|2483261_2484320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128688884.1|2484443_2485217_+	CHAP domain-containing protein	NA	NA	NA	NA	NA
WP_172441285.1|2485340_2487110_-	ATP-dependent helicase	NA	A7KV33	Bacillus_phage	21.8	1.6e-27
WP_172441286.1|2487106_2488180_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_009684101.1|2488581_2490069_+	SulP family inorganic anion transporter	NA	A0A2H4J153	uncultured_Caudovirales_phage	98.4	2.4e-266
WP_012316922.1|2490080_2490932_+	universal stress protein	NA	A0A2H4J154	uncultured_Caudovirales_phage	92.9	1.9e-143
WP_009684099.1|2491024_2491558_+	NUDIX domain-containing protein	NA	A0A2H4J8B3	uncultured_Caudovirales_phage	96.2	2.4e-67
WP_009684098.1|2491591_2493127_-|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	45.9	1.6e-116
WP_009684097.1|2493188_2493524_-	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_009684096.1|2493520_2493853_-	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_128688626.1|2495786_2496533_-	fumarate/nitrate reduction transcriptional regulator Fnr	NA	NA	NA	NA	NA
WP_172441287.1|2497499_2498516_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_128688628.1|2498849_2499221_-	DNA binding protein	NA	NA	NA	NA	NA
WP_088171463.1|2499722_2500709_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	59.7	4.7e-101
>prophage 7
NZ_CP053706	Pseudomonas aeruginosa strain PAC1 chromosome, complete genome	7564383	2564550	2620731	7564383	integrase,tail,tRNA,terminase	Pseudomonas_phage(62.0%)	64	2584288:2584305	2622934:2622951
WP_003160542.1|2564550_2564814_-	hypothetical protein	NA	Q9MC87	Pseudomonas_phage	94.3	9.0e-44
WP_003160543.1|2564849_2565113_-	hypothetical protein	NA	A0A0U4B0B7	Pseudomonas_phage	98.8	1.3e-37
WP_003160544.1|2565109_2565478_-	hypothetical protein	NA	H2BDD6	Pseudomonas_virus	78.7	1.0e-40
WP_003160545.1|2565474_2566104_-	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	96.2	1.7e-112
WP_161558056.1|2566567_2568250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023096650.1|2568640_2568955_-	hypothetical protein	NA	A0A0U4K5I1	Pseudomonas_phage	100.0	3.2e-56
WP_171945743.1|2568954_2569749_-	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	73.0	2.4e-92
WP_171945744.1|2570728_2574391_-	DUF1983 domain-containing protein	NA	A0A0S2SYC5	Pseudomonas_phage	86.6	0.0e+00
WP_128706894.1|2574515_2575040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010793123.1|2575036_2575648_-|tail	tail assembly protein	tail	A0A0S2SYS2	Pseudomonas_phage	82.3	1.2e-86
WP_155951712.1|2575713_2576085_-	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_010793124.1|2576848_2577082_+	hypothetical protein	NA	A0A0S2SY71	Pseudomonas_phage	88.4	3.0e-14
WP_155951713.1|2577062_2577380_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010793126.1|2577330_2578092_-	C40 family peptidase	NA	A0A0S2SY75	Pseudomonas_phage	99.2	8.8e-148
WP_003160549.1|2578094_2578844_-|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	90.8	1.0e-132
WP_003160550.1|2578840_2579179_-|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	97.3	5.8e-59
WP_172441291.1|2579184_2582376_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	40.4	1.4e-154
WP_052156043.1|2582372_2582636_-	DUF1799 domain-containing protein	NA	A0A2R3UAE2	Siphoviridae_environmental_samples	46.0	3.6e-16
WP_003103406.1|2582698_2583079_-|tail	phage tail assembly chaperone	tail	A0A2H4IYQ5	uncultured_Caudovirales_phage	51.2	7.0e-29
WP_012075337.1|2583088_2583742_-|tail	phage tail protein	tail	A0A2H4IZV5	uncultured_Caudovirales_phage	52.8	7.7e-60
WP_033945356.1|2583809_2584220_-	DUF4128 domain-containing protein	NA	A0A2H4J130	uncultured_Caudovirales_phage	47.0	5.4e-27
WP_034086313.1|2584216_2584891_-	hypothetical protein	NA	A0A0S2SY81	Pseudomonas_phage	96.4	7.8e-116
2584288:2584305	attL	CAGCCGGCGCCTGGCTGG	NA	NA	NA	NA
WP_019396738.1|2584894_2585284_-	hypothetical protein	NA	A0A2H4JAS3	uncultured_Caudovirales_phage	55.8	1.3e-33
WP_069953458.1|2585283_2585748_-	hypothetical protein	NA	H9EB35	Vibrio_phage	36.4	6.8e-10
WP_034010882.1|2585731_2586217_-	hypothetical protein	NA	NA	NA	NA	NA
WP_034010881.1|2586258_2587230_-	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	65.0	1.4e-110
WP_031634941.1|2587239_2587983_-	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	75.0	4.9e-87
WP_124181217.1|2588111_2589191_-	hypothetical protein	NA	A0A0S2SY77	Pseudomonas_phage	98.6	2.3e-202
WP_034010879.1|2589187_2590543_-	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	46.3	3.3e-97
WP_128723292.1|2590545_2591841_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.5	3.3e-147
WP_128723291.1|2591827_2592424_-|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	60.5	2.6e-46
WP_034010876.1|2592436_2592733_-	hypothetical protein	NA	A0A125RNL4	Pseudomonas_phage	60.7	4.9e-22
WP_034010874.1|2592735_2593044_-	hypothetical protein	NA	A0A125RNL3	Pseudomonas_phage	55.0	2.2e-17
WP_034010873.1|2593128_2593308_+	type II toxin-antitoxin system HicA family toxin	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	55.0	5.4e-08
WP_128723289.1|2595074_2595524_-	RusA family crossover junction endodeoxyribonuclease	NA	H2BD71	Pseudomonas_phage	98.7	9.6e-78
WP_039027502.1|2595516_2595930_-	hypothetical protein	NA	NA	NA	NA	NA
WP_079380503.1|2596057_2597071_-	hypothetical protein	NA	A0A2H4JCW9	uncultured_Caudovirales_phage	43.2	1.7e-13
WP_003103363.1|2597073_2597646_-	hypothetical protein	NA	J7I4J9	Pseudomonas_phage	100.0	5.5e-102
WP_003451709.1|2598014_2598233_-	helix-turn-helix domain-containing protein	NA	A0A2D1GND2	Pseudomonas_phage	64.7	2.9e-19
WP_121500130.1|2598330_2599182_+	Cro/Cl family transcriptional regulator	NA	A0A2D1GNH0	Pseudomonas_phage	56.8	2.5e-87
WP_172441292.1|2599241_2601233_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_121500132.1|2601363_2601696_-	DUF1654 domain-containing protein	NA	H2BD60	Pseudomonas_phage	71.6	2.8e-34
WP_126545536.1|2602167_2602410_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172441293.1|2603453_2604092_-	acetyltransferase	NA	NA	NA	NA	NA
WP_003099041.1|2604268_2604640_+	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	100.0	8.5e-64
WP_162947151.1|2605217_2605370_+	hypothetical protein	NA	A0A2K8HR67	Pseudomonas_phage	96.8	1.2e-11
WP_033937796.1|2605353_2605575_+	hypothetical protein	NA	H2BD53	Pseudomonas_phage	98.6	8.7e-32
WP_033937794.1|2605571_2605781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023111689.1|2605791_2606700_+	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	72.0	1.6e-124
WP_031673431.1|2606712_2607585_+	recombination protein RecT	NA	Q858E1	Salmonella_phage	73.6	2.3e-104
WP_031754526.1|2607591_2609337_+	AAA family ATPase	NA	H2BD46	Pseudomonas_phage	91.6	6.9e-281
WP_124117754.1|2609500_2609827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010793156.1|2609942_2611721_+	DNA cytosine methyltransferase	NA	Q9ZXI4	Pseudomonas_virus	95.2	1.0e-292
WP_010793157.1|2611772_2611946_-	hypothetical protein	NA	NA	NA	NA	NA
WP_031628312.1|2612148_2612643_+	DUF550 domain-containing protein	NA	L7TI87	Pseudomonas_virus	95.7	2.3e-88
WP_003160553.1|2612639_2612963_+	DUF4406 domain-containing protein	NA	H2BD42	Pseudomonas_phage	100.0	9.4e-59
WP_073674913.1|2612959_2613514_+	hypothetical protein	NA	H2BD41	Pseudomonas_phage	91.2	9.1e-94
WP_025991793.1|2615006_2615393_+	hypothetical protein	NA	A0A2K8HZQ6	Pseudomonas_phage	100.0	2.1e-65
WP_003160559.1|2615468_2615753_+	pyocin activator PrtN family protein	NA	A0A2K8HN48	Pseudomonas_phage	100.0	8.0e-46
WP_031628314.1|2615762_2616869_-|integrase	tyrosine-type recombinase/integrase	integrase	L7TP61	Pseudomonas_virus	99.7	3.5e-214
WP_023911957.1|2616972_2617977_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_003090868.1|2618056_2618980_+	transaldolase	NA	A0A1D8KMI9	Synechococcus_phage	30.0	6.5e-12
WP_003104052.1|2619067_2619550_-	STAS domain-containing protein	NA	NA	NA	NA	NA
WP_003114778.1|2619546_2620731_-	SpoIIE family protein phosphatase	NA	Q56AR1	Bacillus_thuringiensis_phage	31.9	7.3e-08
2622934:2622951	attR	CCAGCCAGGCGCCGGCTG	NA	NA	NA	NA
>prophage 8
NZ_CP053706	Pseudomonas aeruginosa strain PAC1 chromosome, complete genome	7564383	3736904	3802408	7564383	lysis,portal,protease,tRNA,holin,integrase,terminase	Pseudomonas_phage(80.0%)	87	3774046:3774062	3798776:3798792
WP_003092797.1|3736904_3738194_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_010793386.1|3738212_3739328_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_010793387.1|3739324_3740374_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_003092804.1|3740370_3741129_-	type 4a pilus biogenesis protein PilF	NA	NA	NA	NA	NA
WP_003092809.1|3741146_3742286_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_003092811.1|3742310_3742742_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	41.7	7.2e-22
WP_003092814.1|3742985_3743186_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_003092818.1|3743212_3743551_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_003100622.1|3743557_3745417_-	Fe-S protein assembly chaperone HscA	NA	F2Y2E1	Organic_Lake_phycodnavirus	40.1	4.8e-107
WP_003092824.1|3745459_3745981_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_003100617.1|3745988_3746312_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	50.5	9.8e-24
WP_003092829.1|3746339_3746726_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	79.8	1.2e-52
WP_003092832.1|3746761_3747976_-	IscS subfamily cysteine desulfurase	NA	A0A0H3TPH2	Faustovirus	30.2	2.3e-33
WP_003092836.1|3748005_3748497_-	Fe-S cluster assembly transcriptional regulator IscR	NA	NA	NA	NA	NA
WP_003100615.1|3748641_3749418_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_003092842.1|3749417_3750191_-|tRNA	tRNA (cytosine(32)/uridine(32)-2'-O)-methyltransferase TrmJ	tRNA	NA	NA	NA	NA
WP_003092845.1|3750342_3751158_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_003092848.1|3751262_3751811_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_003100612.1|3751994_3752915_-	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	43.9	1.9e-51
WP_003100609.1|3752925_3754788_-	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_003092856.1|3754847_3755186_-	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	42.4	5.8e-11
WP_003100607.1|3755229_3756348_-|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	49.9	6.7e-96
WP_003113798.1|3756360_3757404_-|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_031687662.1|3757829_3758165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003129771.1|3758295_3758520_-	hypothetical protein	NA	A0A1W6JT95	Pseudomonas_phage	100.0	9.4e-34
WP_172441300.1|3758592_3758832_-	hypothetical protein	NA	A0A0S2SY98	Pseudomonas_phage	92.3	1.5e-32
WP_128708449.1|3758828_3759131_-	hypothetical protein	NA	A0A0S2SY61	Pseudomonas_phage	84.0	1.7e-41
WP_003159084.1|3759725_3760007_-	hypothetical protein	NA	A0A1W6JTD4	Pseudomonas_phage	97.8	3.0e-45
WP_023124665.1|3760006_3760567_-	hypothetical protein	NA	A0A1B0YZW5	Pseudomonas_phage	96.2	3.0e-97
WP_023103657.1|3760571_3760763_-	hypothetical protein	NA	A0A1B0Z2L3	Pseudomonas_phage	96.8	7.8e-29
WP_023124664.1|3760755_3761343_-	hypothetical protein	NA	A0A1B0Z051	Pseudomonas_phage	91.3	7.6e-99
WP_034004903.1|3761372_3763031_-	hypothetical protein	NA	A0A0A0YRR5	Pseudomonas_phage	97.1	0.0e+00
WP_003129734.1|3763027_3763432_-	hypothetical protein	NA	A0A0A0YR47	Pseudomonas_phage	97.8	5.8e-66
WP_034004904.1|3763442_3763988_-	hypothetical protein	NA	A0A1W6JT85	Pseudomonas_phage	98.3	7.0e-99
WP_023124660.1|3763987_3764398_-	hypothetical protein	NA	A0A1W6JT78	Pseudomonas_phage	92.6	4.4e-53
WP_023124659.1|3764400_3766098_-	hypothetical protein	NA	A0A1W6JTA3	Pseudomonas_phage	94.5	3.1e-310
WP_003159076.1|3766097_3766619_-	hypothetical protein	NA	A0A1W6JT98	Pseudomonas_phage	96.5	3.1e-96
WP_003159075.1|3766658_3769142_-	tape measure protein	NA	A0A1B0YZV6	Pseudomonas_phage	97.6	0.0e+00
WP_003129708.1|3769244_3769547_-	hypothetical protein	NA	A0A1B0YZV7	Pseudomonas_phage	86.0	5.3e-40
WP_071534551.1|3769604_3770132_-	DUF4124 domain-containing protein	NA	A0A1B0Z2K9	Pseudomonas_phage	94.9	1.9e-88
WP_010791967.1|3770276_3771029_-	hypothetical protein	NA	A0A1W6JT83	Pseudomonas_phage	100.0	9.6e-139
WP_010791968.1|3771030_3771225_-	hypothetical protein	NA	A0A1W6JT79	Pseudomonas_phage	100.0	3.0e-28
WP_010791969.1|3771228_3771699_-	hypothetical protein	NA	A0A1W6JT75	Pseudomonas_phage	100.0	2.2e-88
WP_010791970.1|3771695_3772025_-	hypothetical protein	NA	A0A1W6JT71	Pseudomonas_phage	100.0	3.1e-57
WP_003129701.1|3772021_3772339_-	DUF2190 family protein	NA	A0A1W6JT93	Pseudomonas_phage	100.0	4.6e-50
WP_023465050.1|3772405_3774499_-|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	98.4	0.0e+00
3774046:3774062	attL	GGCGCATGTCGTCCGCA	NA	NA	NA	NA
WP_172441301.1|3774458_3776105_-|portal	phage portal protein	portal	A0A1W6JTB6	Pseudomonas_phage	99.5	0.0e+00
WP_003159069.1|3776104_3776320_-	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	100.0	6.5e-32
WP_012613704.1|3776310_3778275_-|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	98.6	0.0e+00
WP_003159067.1|3778246_3778792_-|terminase	terminase small subunit	terminase	A0A1B0Z033	Pseudomonas_phage	98.9	2.1e-95
WP_019396612.1|3778943_3779687_-	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	99.2	8.3e-135
WP_172441403.1|3779683_3780154_-|lysis	lysis protein	lysis	A0A1B0Z001	Pseudomonas_phage	91.0	2.9e-69
WP_071537640.1|3780153_3780708_-	HNH endonuclease	NA	A0A2D1GDR6	Mycobacterium_phage	45.3	1.8e-17
WP_172441303.1|3780707_3781325_-	glycoside hydrolase family 19 protein	NA	A0A1B0Z086	Pseudomonas_phage	91.2	2.2e-104
WP_004353177.1|3781321_3781654_-|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	96.4	1.9e-54
WP_003085732.1|3781739_3782270_-	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	37.3	1.2e-26
WP_172441304.1|3782798_3783356_-	hypothetical protein	NA	A0A0A0YRV6	Pseudomonas_phage	93.6	2.6e-72
WP_172441305.1|3783352_3783637_-	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	97.7	1.6e-41
WP_172441307.1|3783633_3785445_-	AAA family ATPase	NA	A0A0U4B0G9	Pseudomonas_phage	70.0	4.5e-259
WP_172441309.1|3786495_3786810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050157694.1|3786806_3787121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172441311.1|3787117_3788263_-	hypothetical protein	NA	A0A1W6JTB9	Pseudomonas_phage	95.0	1.3e-62
WP_172441312.1|3788352_3788628_-	hypothetical protein	NA	A0A1W6JTB7	Pseudomonas_phage	95.6	1.2e-38
WP_120322826.1|3788624_3788933_-	hypothetical protein	NA	A0A0A0YWH5	Pseudomonas_phage	82.4	6.7e-38
WP_079387383.1|3788929_3789127_-	hypothetical protein	NA	A0A1W6JTC3	Pseudomonas_phage	66.1	1.2e-11
WP_134637559.1|3789198_3789516_-	hypothetical protein	NA	A0A1W6JTB5	Pseudomonas_phage	76.2	6.9e-38
WP_120322829.1|3789835_3790126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120322830.1|3790122_3790623_-	KilA-N domain-containing protein	NA	Q9XJS9	Pseudomonas_phage	60.5	7.2e-50
WP_120322831.1|3790619_3790925_-	helix-turn-helix transcriptional regulator	NA	A0A127KNT2	Pseudomonas_phage	53.0	4.0e-11
WP_031640411.1|3791034_3791694_+	helix-turn-helix domain-containing protein	NA	A0A1W6JTC8	Pseudomonas_phage	73.8	2.1e-60
WP_033982245.1|3791842_3792229_+	helix-turn-helix transcriptional regulator	NA	A0A1W6JTA9	Pseudomonas_phage	97.6	1.5e-58
WP_128668135.1|3792239_3792530_+	hypothetical protein	NA	A0A1W6JTA7	Pseudomonas_phage	99.0	2.1e-46
WP_015980928.1|3792540_3793338_+	Bro-N domain-containing protein	NA	A0A1W6JTB0	Pseudomonas_phage	100.0	4.9e-149
WP_033866987.1|3793412_3793643_+	Arc family DNA-binding protein	NA	A0A1W6JTB4	Pseudomonas_phage	92.1	4.1e-32
WP_015648187.1|3793645_3793981_+	hypothetical protein	NA	A0A1W6JTA6	Pseudomonas_phage	89.2	9.1e-49
WP_172441102.1|3793977_3794799_+	hypothetical protein	NA	A0A0A0YUE9	Pseudomonas_phage	89.5	3.5e-126
WP_051677900.1|3794795_3795323_+	hypothetical protein	NA	A0A0A0YRT2	Pseudomonas_phage	98.0	1.2e-50
WP_003085682.1|3795435_3795627_+	hypothetical protein	NA	A0A0A0YQ21	Pseudomonas_phage	100.0	9.2e-30
WP_033866986.1|3795623_3796313_+	hypothetical protein	NA	A0A0A0YUE3	Pseudomonas_phage	93.9	8.6e-118
WP_033866990.1|3796317_3796665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033866985.1|3796657_3796987_+	hypothetical protein	NA	A0A1W6JT94	Pseudomonas_phage	96.3	4.0e-57
WP_023083766.1|3797129_3798308_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	96.3	8.7e-211
WP_014603615.1|3798374_3798818_+	SocA family protein	NA	I6R0L8	Salmonella_phage	56.8	4.3e-46
3798776:3798792	attR	TGCGGACGACATGCGCC	NA	NA	NA	NA
WP_172441313.1|3799801_3800440_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003119438.1|3800682_3801018_+	TM2 domain-containing protein	NA	A0A240F358	Aeromonas_phage	41.7	5.6e-06
WP_010793873.1|3801191_3801710_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_010793872.1|3801706_3802408_+	VRR-NUC domain-containing protein	NA	Q8W6S1	Burkholderia_virus	47.6	6.6e-49
>prophage 9
NZ_CP053706	Pseudomonas aeruginosa strain PAC1 chromosome, complete genome	7564383	3903974	3913072	7564383	coat,integrase	Pseudomonas_phage(90.0%)	12	3903247:3903276	3913957:3913986
3903247:3903276	attL	AGGGTTCGATTCCCTTCGCCCGCTCCAGAT	NA	NA	NA	NA
WP_172441314.1|3903974_3904964_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	52.9	1.8e-92
WP_172441315.1|3904963_3906256_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	93.1	2.0e-245
WP_172441318.1|3906485_3907760_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	89.9	6.3e-207
WP_003114150.1|3907763_3908120_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_172441320.1|3908124_3909441_-	attachment protein	NA	Q56VP1	Pseudomonas_phage	55.8	6.4e-45
WP_003125072.1|3909592_3909841_-|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	92.7	2.0e-32
WP_003115979.1|3909853_3910105_-	hypothetical protein	NA	NA	NA	NA	NA
WP_128706979.1|3910226_3910661_-	DNA-binding protein	NA	Q56VP5	Pseudomonas_phage	97.2	1.4e-62
WP_172441322.1|3911828_3912116_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	87.4	2.5e-47
WP_128653041.1|3912119_3912332_-	hypothetical protein	NA	Q56VP8	Pseudomonas_phage	91.4	3.5e-30
WP_033994734.1|3912333_3912549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172441325.1|3912649_3913072_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	39.6	2.6e-08
3913957:3913986	attR	AGGGTTCGATTCCCTTCGCCCGCTCCAGAT	NA	NA	NA	NA
>prophage 10
NZ_CP053706	Pseudomonas aeruginosa strain PAC1 chromosome, complete genome	7564383	4398876	4449558	7564383	coat,integrase,capsid,tRNA	Pseudomonas_phage(60.0%)	47	4429623:4429638	4454791:4454872
WP_003117437.1|4398876_4399425_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003099339.1|4399472_4399988_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_003099337.1|4399987_4400530_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_010793771.1|4400548_4401337_+	molecular chaperone	NA	NA	NA	NA	NA
WP_010793770.1|4401353_4403726_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_003117435.1|4403722_4404670_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_010793769.1|4404671_4406045_-	MFS transporter	NA	NA	NA	NA	NA
WP_003099324.1|4406324_4407347_-	ferrochelatase	NA	NA	NA	NA	NA
WP_003457067.1|4407343_4408261_-	TIGR01777 family protein	NA	NA	NA	NA	NA
WP_003099318.1|4408674_4409658_+	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003099314.1|4409810_4410767_+	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_010793768.1|4410776_4411676_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	39.1	8.5e-17
WP_023912004.1|4411672_4413118_+	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	27.8	1.4e-45
WP_003099307.1|4413243_4413765_-	acyloxyacyl hydrolase	NA	A0A2H4J0I5	uncultured_Caudovirales_phage	69.8	1.4e-59
WP_003099300.1|4413898_4414696_-	glutamate racemase	NA	NA	NA	NA	NA
WP_003099296.1|4414685_4415444_-	molybdopterin-synthase adenylyltransferase MoeB	NA	NA	NA	NA	NA
WP_003121049.1|4415437_4416268_-	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_003099290.1|4416269_4417352_-	peptide chain release factor 1	NA	A0A0S4KWG0	Pseudomonas_phage	48.3	5.6e-07
WP_003095001.1|4417369_4418638_-|tRNA	glutamyl-tRNA reductase	tRNA	NA	NA	NA	NA
WP_019726913.1|4418781_4420554_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_003095005.1|4420558_4421176_+	lipoprotein localization protein LolB	NA	NA	NA	NA	NA
WP_003099284.1|4421177_4422026_+	4-(cytidine 5'-diphospho)-2-C-methyl-D-erythritol kinase	NA	NA	NA	NA	NA
WP_003099281.1|4422192_4423134_+	ribose-phosphate pyrophosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	4.1e-46
WP_003099279.1|4423250_4423865_+	50S ribosomal protein L25/general stress protein Ctc	NA	NA	NA	NA	NA
WP_003099278.1|4423906_4424491_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_003099270.1|4424531_4425632_+	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_010793765.1|4425837_4427049_+|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	34.1	3.7e-55
WP_071536035.1|4427323_4427644_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_010793764.1|4427670_4428663_+	restriction endonuclease	NA	NA	NA	NA	NA
WP_010793763.1|4428983_4430699_+	type I restriction-modification system subunit M	NA	NA	NA	NA	NA
4429623:4429638	attL	TTCCTCGGCCAGTTCG	NA	NA	NA	NA
WP_172441334.1|4430688_4431735_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
4429623:4429638	attL	TTCCTCGGCCAGTTCG	NA	NA	NA	NA
WP_172441336.1|4431731_4431965_+	hypothetical protein	NA	NA	NA	NA	NA
WP_010793761.1|4431978_4433289_+	nucleotidyltransferase	NA	NA	NA	NA	NA
WP_071536034.1|4433281_4433854_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_010793760.1|4433898_4437051_+	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	29.9	6.1e-70
WP_010793758.1|4437706_4438570_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_010793757.1|4439171_4440314_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121358421.1|4440910_4441348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003162405.1|4441394_4442402_-|integrase	tyrosine-type recombinase/integrase	integrase	F1BUS9	Erwinia_phage	47.1	3.7e-77
WP_124138583.1|4442398_4443691_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	92.0	4.0e-241
4442581:4442596	attR	CGAACTGGCCGAGGAA	NA	NA	NA	NA
WP_172441337.1|4443921_4445196_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	88.5	7.9e-202
4442581:4442596	attR	CGAACTGGCCGAGGAA	NA	NA	NA	NA
WP_003114150.1|4445199_4445556_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	100.0	7.9e-59
WP_172441338.1|4445560_4446883_-	attachment protein	NA	Q56VP1	Pseudomonas_phage	57.3	4.3e-49
WP_023127902.1|4447034_4447283_-|capsid	major capsid protein	capsid	Q56VP2	Pseudomonas_phage	91.5	1.3e-31
WP_003115979.1|4447295_4447547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003140508.1|4447668_4448103_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	100.0	3.8e-63
WP_115282332.1|4449270_4449558_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	87.4	2.5e-47
4454791:4454872	attR	ATTCATAATGCTGATGTCCCAGGTTCAAGTCCCGGTGTAGCCACCATATTTTTCAAGGGGTTAGCGCAAGCTAACCCCTTTT	NA	NA	NA	NA
>prophage 11
NZ_CP053706	Pseudomonas aeruginosa strain PAC1 chromosome, complete genome	7564383	5168038	5206067	7564383	integrase,transposase	Shigella_phage(16.67%)	25	5176172:5176189	5210232:5210249
WP_004352797.1|5168038_5168905_-|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	47.3	4.6e-60
WP_172441350.1|5168901_5169195_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_078451229.1|5169572_5170949_+|transposase	IS30-like element ISPa37 family transposase	transposase	W5R8L2	Staphylococcus_phage	33.7	1.1e-42
WP_010794468.1|5172007_5173234_+|transposase	IS256-like element ISPa1328 family transposase	transposase	A0A218MNI5	uncultured_virus	47.1	8.0e-50
WP_021263740.1|5173271_5176313_-	DEAD/DEAH box helicase	NA	Q2NP48	Hyphantria_cunea_nuclear_polyhedrosis_virus	26.4	1.9e-28
5176172:5176189	attL	CGGTTTGCAGCGCCTTGA	NA	NA	NA	NA
WP_023096322.1|5176313_5178326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012077892.1|5178322_5179087_-	OmpA family protein	NA	NA	NA	NA	NA
WP_012077893.1|5179086_5181213_-	anti-phage defense ZorAB system ZorA	NA	NA	NA	NA	NA
WP_012077894.1|5181265_5182342_-	DUF91 domain-containing protein	NA	NA	NA	NA	NA
WP_012077895.1|5182359_5184003_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_012077896.1|5183999_5185469_-	SAM-dependent DNA methyltransferase	NA	J7I0U9	Acinetobacter_phage	33.9	7.9e-28
WP_012077897.1|5185471_5186413_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_012077898.1|5186829_5189196_-	DEAD/DEAH box helicase family protein	NA	A0A2I5ARD8	Synechococcus_phage	27.2	1.8e-05
WP_012077900.1|5189588_5190236_-	hypothetical protein	NA	NA	NA	NA	NA
WP_025297754.1|5190301_5190589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165567215.1|5191238_5191562_+	plasmid pRiA4b ORF-3 family protein	NA	NA	NA	NA	NA
WP_012077903.1|5192303_5193320_+	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_012077904.1|5193378_5195091_+	dynamin family protein	NA	NA	NA	NA	NA
WP_012077905.1|5195104_5197348_+	dynamin family protein	NA	NA	NA	NA	NA
WP_012077906.1|5197344_5199435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_160328552.1|5200344_5201160_+	UvrD-helicase domain-containing protein	NA	NA	NA	NA	NA
WP_153565776.1|5201233_5201776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_169311248.1|5202239_5203394_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_124083333.1|5203609_5204119_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010794470.1|5204102_5206067_-|integrase	integrase	integrase	NA	NA	NA	NA
5210232:5210249	attR	TCAAGGCGCTGCAAACCG	NA	NA	NA	NA
>prophage 12
NZ_CP053706	Pseudomonas aeruginosa strain PAC1 chromosome, complete genome	7564383	6067861	6107439	7564383	tail,capsid,transposase,integrase,head	Pseudomonas_phage(92.59%)	55	6068694:6068710	6097529:6097545
WP_003094179.1|6067861_6068221_-	hypothetical protein	NA	A0A0S4L0M4	Pseudomonas_phage	100.0	6.5e-61
WP_031638311.1|6068223_6068787_-	regulatory protein GemA	NA	Q5ZR14	Pseudomonas_phage	98.9	5.6e-99
6068694:6068710	attL	TCGCCTGCAGCTTCTGC	NA	NA	NA	NA
WP_034075666.1|6068773_6069241_-	hypothetical protein	NA	J9STM8	Pseudomonas_phage	83.2	2.5e-60
WP_016852434.1|6069240_6069432_-	hypothetical protein	NA	J9RW45	Pseudomonas_phage	100.0	5.0e-28
WP_033953845.1|6070117_6070741_-	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	93.2	1.1e-103
WP_033953843.1|6070733_6070934_-	bacteriophage protein	NA	J9RWL7	Pseudomonas_phage	95.5	4.8e-29
WP_033953841.1|6070926_6071460_-	hypothetical protein	NA	J9STN6	Pseudomonas_phage	98.9	5.6e-93
WP_033953838.1|6071449_6072130_-	hypothetical protein	NA	J9SNC1	Pseudomonas_phage	97.3	8.4e-126
WP_014603990.1|6072129_6072414_-	hypothetical protein	NA	J9SGZ7	Pseudomonas_phage	100.0	3.4e-44
WP_031630705.1|6072410_6072752_-	hypothetical protein	NA	J9RWC3	Pseudomonas_phage	96.5	8.7e-55
WP_031630704.1|6072753_6073920_-	AAA family ATPase	NA	J9SHF3	Pseudomonas_phage	98.7	1.3e-214
WP_172441361.1|6073919_6075704_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	J9STP5	Pseudomonas_phage	98.5	0.0e+00
WP_031636328.1|6075707_6076682_-	hypothetical protein	NA	J9SND0	Pseudomonas_phage	88.0	1.5e-139
WP_031636327.1|6076691_6077006_-	hypothetical protein	NA	J9SVM2	Pseudomonas_phage	99.0	2.0e-50
WP_031636325.1|6077002_6077263_-	hypothetical protein	NA	J9RWD0	Pseudomonas_phage	94.2	4.3e-38
WP_031636324.1|6077255_6077744_-	hypothetical protein	NA	J9SVV8	Pseudomonas_phage	98.8	1.4e-90
WP_023127889.1|6077867_6078092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023123664.1|6078376_6078607_-	DNA-binding protein	NA	J9RWM8	Pseudomonas_phage	100.0	3.2e-37
WP_044264506.1|6078696_6079083_+	helix-turn-helix domain-containing protein	NA	J9SH16	Pseudomonas_phage	65.4	3.9e-11
WP_126620882.1|6079107_6079575_+	hypothetical protein	NA	J9SVN1	Pseudomonas_phage	79.9	2.4e-63
WP_031636322.1|6079591_6079795_+	hypothetical protein	NA	A0A0S4L2S2	Pseudomonas_phage	65.7	5.9e-19
WP_031636321.1|6079767_6080523_-	hypothetical protein	NA	A0A0S4L2W3	Pseudomonas_phage	84.3	2.5e-70
WP_003094225.1|6080735_6080993_+	membrane protein	NA	A0A0S4L5C0	Pseudomonas_phage	100.0	7.2e-38
WP_162832300.1|6080995_6081154_+	hypothetical protein	NA	J9SNF4	Pseudomonas_phage	96.2	2.9e-21
WP_031638435.1|6081150_6081780_+	transglycosylase SLT domain-containing protein	NA	J9SHG5	Pseudomonas_phage	99.5	8.4e-120
WP_023657073.1|6081960_6082572_+	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	97.5	3.5e-99
WP_003094234.1|6082575_6082965_+	hypothetical protein	NA	A0A0S4L2V7	Pseudomonas_phage	100.0	5.2e-64
WP_003094236.1|6082954_6083263_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	100.0	1.7e-54
WP_003094238.1|6083268_6083844_+	DUF3486 family protein	NA	J9SNV5	Pseudomonas_phage	100.0	7.4e-91
WP_003139988.1|6083845_6085549_+	hypothetical protein	NA	A0A0S4L072	Pseudomonas_phage	99.8	0.0e+00
WP_003152194.1|6085548_6087027_+	DUF935 family protein	NA	J9RWN4	Pseudomonas_phage	100.0	1.4e-287
WP_031630688.1|6087026_6088277_+|head	phage head morphogenesis protein	head	J9SWK6	Pseudomonas_phage	100.0	1.5e-240
WP_031630686.1|6088273_6088846_+	phage virion morphogenesis protein	NA	J9SN67	Pseudomonas_phage	96.8	4.3e-99
WP_023442965.1|6089064_6090312_+	peptidase	NA	J9SGT4	Pseudomonas_phage	93.3	7.3e-184
WP_003152198.1|6090315_6090693_+	DUF2190 family protein	NA	A0A0S4L3C3	Pseudomonas_phage	98.4	3.5e-57
WP_128622770.1|6090704_6091634_+|capsid	phage capsid protein	capsid	Q5ZQX7	Pseudomonas_phage	97.1	1.1e-173
WP_003094256.1|6091680_6091875_+	hypothetical protein	NA	A0A0S4L2Y0	Pseudomonas_phage	100.0	6.0e-29
WP_003094258.1|6091874_6092201_+	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	100.0	1.1e-51
WP_003094261.1|6092208_6092718_+	DUF1320 domain-containing protein	NA	A0A0S4L0B5	Pseudomonas_phage	100.0	1.0e-91
WP_003094263.1|6092719_6093175_+	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	100.0	8.5e-82
WP_003139972.1|6093171_6093381_+	hypothetical protein	NA	A0A0S4L313	Pseudomonas_phage	100.0	2.4e-31
WP_003094267.1|6093384_6094137_+	hypothetical protein	NA	A0A0S4L1I6	Pseudomonas_phage	100.0	4.6e-141
WP_003152203.1|6094138_6094645_+	hypothetical protein	NA	J9STK7	Pseudomonas_phage	96.4	1.3e-86
WP_162836281.1|6094641_6094785_+	hypothetical protein	NA	J9SN84	Pseudomonas_phage	95.7	7.9e-18
WP_033965901.1|6094871_6098714_+|tail	phage tail tape measure protein	tail	A0A0S4L7E6	Pseudomonas_phage	95.2	0.0e+00
6097529:6097545	attR	GCAGAAGCTGCAGGCGA	NA	NA	NA	NA
WP_128622769.1|6098721_6099678_+	hypothetical protein	NA	A0A0A7DK02	Pseudomonas_phage	96.5	6.6e-185
WP_014604005.1|6099679_6100603_+	hypothetical protein	NA	B7SE07	Pseudomonas_virus	93.8	5.4e-176
WP_034040267.1|6100602_6102306_+	hypothetical protein	NA	B7SE08	Pseudomonas_virus	98.2	0.0e+00
WP_052163572.1|6102295_6103117_+	phage BR0599 family protein	NA	I6PBD5	Pseudomonas_phage	99.2	2.1e-155
WP_003126844.1|6103125_6103365_+	hypothetical protein	NA	I6P9F0	Pseudomonas_phage	98.7	4.4e-37
WP_004367213.1|6103361_6103580_+	hypothetical protein	NA	I6P9E8	Pseudomonas_phage	100.0	3.4e-36
WP_128622592.1|6103569_6105777_+	hypothetical protein	NA	I6PCB1	Pseudomonas_phage	98.5	0.0e+00
WP_034040256.1|6106618_6106921_+	hypothetical protein	NA	A0SMR0	Pseudomonas_virus	84.0	5.2e-43
WP_034040253.1|6106917_6107136_+	hypothetical protein	NA	I6PBD6	Pseudomonas_phage	88.9	1.3e-27
WP_015649550.1|6107214_6107439_+	hypothetical protein	NA	H1ZZG9	Pseudomonas_virus	100.0	4.2e-34
>prophage 13
NZ_CP053706	Pseudomonas aeruginosa strain PAC1 chromosome, complete genome	7564383	6559338	6651989	7564383	plate,integrase,tail,tRNA	Pseudomonas_phage(34.09%)	91	6649767:6649783	6655712:6655728
WP_003113167.1|6559338_6560538_-|tRNA	tyrosine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003129241.1|6560822_6562166_+	peptidoglycan DD-metalloendopeptidase family protein	NA	O03937	Lactobacillus_phage	44.1	3.0e-18
WP_003113168.1|6562168_6563260_+	anhydro-N-acetylmuramic acid kinase	NA	NA	NA	NA	NA
WP_003085254.1|6563313_6563664_-	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	53.2	3.0e-26
WP_003120826.1|6563741_6564164_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_172441368.1|6564164_6564884_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003113169.1|6564883_6565918_-	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_003113170.1|6566208_6566631_+	protoporphyrinogen oxidase HemJ	NA	NA	NA	NA	NA
WP_003085244.1|6566647_6567616_+	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_003085240.1|6567737_6568820_+	DUF805 domain-containing protein	NA	NA	NA	NA	NA
WP_010793480.1|6568880_6569681_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_003121853.1|6569720_6571202_-	AAA family ATPase	NA	U5XJW0	Phormidium_phage	33.8	3.9e-67
WP_003085225.1|6571280_6571619_+	histidine triad nucleotide-binding protein	NA	NA	NA	NA	NA
WP_003085224.1|6571718_6572366_+	2-polyprenyl-3-methyl-6-methoxy-1,4-benzoquinone monooxygenase	NA	NA	NA	NA	NA
WP_003101641.1|6572420_6573215_-	adenosylmethionine decarboxylase	NA	NA	NA	NA	NA
WP_003085219.1|6573534_6573957_-	OsmC family protein	NA	NA	NA	NA	NA
WP_003085214.1|6574228_6574873_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_003113174.1|6574934_6575771_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
WP_003085203.1|6575767_6576817_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085194.1|6576818_6577424_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	2.1e-75
WP_003118930.1|6577842_6578073_-	hypothetical protein	NA	C8ZKF3	Pseudomonas_phage	71.6	1.4e-24
WP_003113177.1|6578069_6578372_-	hypothetical protein	NA	A0A0H5B141	Pseudomonas_phage	71.0	4.4e-34
WP_010793481.1|6578371_6579424_-	hypothetical protein	NA	A0A0H5AXZ9	Pseudomonas_phage	50.9	2.9e-64
WP_010793483.1|6580409_6584063_-|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	57.0	0.0e+00
WP_003113183.1|6584121_6584724_-|tail	tail assembly protein	tail	A0A1V0E8A0	Vibrio_phage	57.8	2.2e-53
WP_003113184.1|6584778_6585549_-	C40 family peptidase	NA	A0A2D1GNP8	Pseudomonas_phage	55.6	4.2e-81
WP_010793484.1|6585551_6586247_-|tail	phage minor tail protein L	tail	A0A1B0VNE0	Pseudomonas_phage	49.8	7.4e-69
WP_003113186.1|6586254_6586596_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	40.0	1.4e-17
WP_003113187.1|6586588_6588424_-|tail	phage tail tape measure protein	tail	A0A0S2SYD9	Pseudomonas_phage	36.2	1.2e-28
WP_003113188.1|6588470_6588725_-	hypothetical protein	NA	A0A2H4PI34	Pseudomonas_phage	38.4	6.3e-10
WP_003113189.1|6588754_6589102_-|tail	phage tail assembly chaperone family protein, TAC	tail	NA	NA	NA	NA
WP_003113190.1|6589113_6589608_-	hypothetical protein	NA	A0A286S1Q8	Klebsiella_phage	56.5	1.4e-45
WP_003118919.1|6589922_6590180_-	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003118918.1|6590176_6590539_-	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	1.9e-15
WP_003113192.1|6590535_6591165_-	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	1.6e-86
WP_010793485.1|6591197_6592187_-	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	1.3e-106
WP_003101635.1|6592244_6592451_-|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_010793486.1|6592425_6593298_-|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	1.3e-75
WP_010793487.1|6593307_6595545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085178.1|6595714_6596059_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_003085175.1|6596073_6596577_-|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003121848.1|6596589_6597750_-|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	1.2e-188
WP_003118913.1|6597792_6598251_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010793488.1|6598247_6600323_-|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	49.8	2.1e-196
WP_003129210.1|6600324_6600858_-|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.0	6.7e-62
WP_003085151.1|6600850_6601738_-	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_003085143.1|6601734_6602061_-	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003118909.1|6602213_6602771_-|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	70.3	6.0e-45
WP_003113200.1|6602767_6603283_-	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	42.9	4.1e-32
WP_003118908.1|6603304_6603754_-	hypothetical protein	NA	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003118907.1|6604117_6604477_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085132.1|6604524_6604725_-	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_010793490.1|6605182_6605953_+	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	58.7	5.1e-71
WP_003113203.1|6606052_6606367_+	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003085126.1|6606683_6608162_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003099532.1|6608234_6609053_-	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085122.1|6609052_6609727_-	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099535.1|6609850_6610681_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_010793491.1|6610786_6612034_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099539.1|6612147_6613194_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|6613249_6614359_-	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003085106.1|6614592_6615627_-	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085103.1|6615755_6616388_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003142788.1|6616433_6618827_-	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_010793492.1|6618978_6620040_+	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_003099547.1|6620040_6620799_-	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_010793493.1|6620800_6621475_-	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_010793494.1|6621471_6622488_-	phosphotransferase	NA	NA	NA	NA	NA
WP_003109031.1|6623760_6625473_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	82.1	8.0e-282
WP_003113209.1|6625605_6628380_+	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_010793495.1|6628360_6629653_+	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_003117956.1|6629649_6630636_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003085087.1|6630751_6631558_+	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003085085.1|6631594_6631975_+	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003099572.1|6631974_6632826_+	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2R4ALP3	Aeromonas_phage	44.2	2.4e-08
WP_003099577.1|6632869_6633202_+	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003085078.1|6633480_6635403_+	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099579.1|6635503_6636775_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003099581.1|6636771_6638325_+	SpoVR family protein	NA	NA	NA	NA	NA
WP_003085071.1|6638419_6638926_+	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003117955.1|6638969_6640202_+	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.3	2.0e-77
WP_003099585.1|6640174_6640717_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_031628438.1|6640707_6641061_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003085061.1|6641144_6641714_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003129196.1|6641792_6642818_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_003085057.1|6643018_6643234_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_003085042.1|6643303_6643753_+	GatB/YqeY domain-containing protein	NA	A0A292GL36	Xanthomonas_phage	38.8	5.0e-18
WP_003118894.1|6643835_6645830_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	40.7	3.8e-73
WP_003085035.1|6645909_6647763_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.8	1.2e-36
WP_010793497.1|6647869_6651607_+	bifunctional diguanylate cyclase/phosphodiesterase	NA	A0A127AWB9	Bacillus_phage	35.4	4.8e-13
6649767:6649783	attL	CCCAGGGCTTCACCGCC	NA	NA	NA	NA
WP_172441369.1|6651827_6651989_+|integrase	integrase	integrase	NA	NA	NA	NA
WP_172441369.1|6651827_6651989_+|integrase	integrase	integrase	NA	NA	NA	NA
6655712:6655728	attR	CCCAGGGCTTCACCGCC	NA	NA	NA	NA
>prophage 14
NZ_CP053706	Pseudomonas aeruginosa strain PAC1 chromosome, complete genome	7564383	6726500	6735218	7564383		Pseudomonas_phage(60.0%)	10	NA	NA
WP_015649550.1|6726500_6726725_-	hypothetical protein	NA	H1ZZG9	Pseudomonas_virus	100.0	4.2e-34
WP_034040253.1|6726803_6727022_-	hypothetical protein	NA	I6PBD6	Pseudomonas_phage	88.9	1.3e-27
WP_034040256.1|6727018_6727321_-	hypothetical protein	NA	A0SMR0	Pseudomonas_virus	84.0	5.2e-43
WP_128622592.1|6728162_6730370_-	hypothetical protein	NA	I6PCB1	Pseudomonas_phage	98.5	0.0e+00
WP_004367213.1|6730359_6730578_-	hypothetical protein	NA	I6P9E8	Pseudomonas_phage	100.0	3.4e-36
WP_003126844.1|6730574_6730814_-	hypothetical protein	NA	I6P9F0	Pseudomonas_phage	98.7	4.4e-37
WP_052163572.1|6730822_6731644_-	phage BR0599 family protein	NA	I6PBD5	Pseudomonas_phage	99.2	2.1e-155
WP_034040267.1|6731633_6733337_-	hypothetical protein	NA	B7SE08	Pseudomonas_virus	98.2	0.0e+00
WP_014604005.1|6733336_6734260_-	hypothetical protein	NA	B7SE07	Pseudomonas_virus	93.8	5.4e-176
WP_128622769.1|6734261_6735218_-	hypothetical protein	NA	A0A0A7DK02	Pseudomonas_phage	96.5	6.6e-185
>prophage 15
NZ_CP053706	Pseudomonas aeruginosa strain PAC1 chromosome, complete genome	7564383	6739292	6770360	7564383	integrase,head,transposase,holin	Pseudomonas_phage(95.0%)	41	6753276:6753293	6768133:6768150
WP_003152203.1|6739292_6739799_-	hypothetical protein	NA	J9STK7	Pseudomonas_phage	96.4	1.3e-86
WP_003139972.1|6740555_6740765_-	hypothetical protein	NA	A0A0S4L313	Pseudomonas_phage	100.0	2.4e-31
WP_003094263.1|6740761_6741217_-	hypothetical protein	NA	A0A0S4L2X9	Pseudomonas_phage	100.0	8.5e-82
WP_003094261.1|6741218_6741728_-	DUF1320 domain-containing protein	NA	A0A0S4L0B5	Pseudomonas_phage	100.0	1.0e-91
WP_003094258.1|6741735_6742062_-	hypothetical protein	NA	A0A0S4L5D5	Pseudomonas_phage	100.0	1.1e-51
WP_003094256.1|6742061_6742256_-	hypothetical protein	NA	A0A0S4L2Y0	Pseudomonas_phage	100.0	6.0e-29
WP_003152198.1|6743242_6743620_-	DUF2190 family protein	NA	A0A0S4L3C3	Pseudomonas_phage	98.4	3.5e-57
WP_023442965.1|6743623_6744871_-	peptidase	NA	J9SGT4	Pseudomonas_phage	93.3	7.3e-184
WP_031630686.1|6745089_6745662_-	phage virion morphogenesis protein	NA	J9SN67	Pseudomonas_phage	96.8	4.3e-99
WP_031630688.1|6745658_6746909_-|head	phage head morphogenesis protein	head	J9SWK6	Pseudomonas_phage	100.0	1.5e-240
WP_003152194.1|6746908_6748387_-	DUF935 family protein	NA	J9RWN4	Pseudomonas_phage	100.0	1.4e-287
WP_003139988.1|6748386_6750090_-	hypothetical protein	NA	A0A0S4L072	Pseudomonas_phage	99.8	0.0e+00
WP_003094238.1|6750091_6750667_-	DUF3486 family protein	NA	J9SNV5	Pseudomonas_phage	100.0	7.4e-91
WP_003094236.1|6750672_6750981_-	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	100.0	1.7e-54
WP_003094234.1|6750970_6751360_-	hypothetical protein	NA	A0A0S4L2V7	Pseudomonas_phage	100.0	5.2e-64
WP_023657073.1|6751363_6751975_-	hypothetical protein	NA	A0A0S4L1H0	Pseudomonas_phage	97.5	3.5e-99
WP_031638435.1|6752155_6752785_-	transglycosylase SLT domain-containing protein	NA	J9SHG5	Pseudomonas_phage	99.5	8.4e-120
WP_162832300.1|6752781_6752940_-	hypothetical protein	NA	J9SNF4	Pseudomonas_phage	96.2	2.9e-21
WP_003094225.1|6752942_6753200_-	membrane protein	NA	A0A0S4L5C0	Pseudomonas_phage	100.0	7.2e-38
6753276:6753293	attL	CTGATGGGCATCCTGCTC	NA	NA	NA	NA
WP_172441372.1|6753412_6754546_+	hypothetical protein	NA	J9SWJ3	Pseudomonas_phage	98.2	2.3e-184
WP_031655031.1|6754656_6755046_-	helix-turn-helix domain-containing protein	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	39.7	2.1e-12
WP_023123664.1|6755151_6755382_+	DNA-binding protein	NA	J9RWM8	Pseudomonas_phage	100.0	3.2e-37
WP_023657615.1|6755395_6755887_+	hypothetical protein	NA	J9SGQ9	Pseudomonas_phage	78.5	2.1e-62
WP_023123663.1|6756014_6756503_+	hypothetical protein	NA	J9SHM0	Pseudomonas_phage	100.0	7.5e-92
WP_023123662.1|6756495_6756756_+	hypothetical protein	NA	J9SNT9	Pseudomonas_phage	100.0	9.3e-41
WP_023123661.1|6756752_6757067_+	hypothetical protein	NA	J9SUN0	Pseudomonas_phage	99.0	1.0e-49
WP_172441373.1|6757076_6758051_+	hypothetical protein	NA	J9SW46	Pseudomonas_phage	95.5	3.3e-147
WP_172441374.1|6758054_6759839_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	J9STP5	Pseudomonas_phage	97.5	0.0e+00
WP_016852441.1|6759838_6761005_+	AAA family ATPase	NA	J9SVV1	Pseudomonas_phage	100.0	1.0e-216
WP_016852440.1|6761006_6761348_+	hypothetical protein	NA	J9RWC3	Pseudomonas_phage	99.1	3.5e-56
WP_014603990.1|6761344_6761629_+	hypothetical protein	NA	J9SGZ7	Pseudomonas_phage	100.0	3.4e-44
WP_033953838.1|6761628_6762309_+	hypothetical protein	NA	J9SNC1	Pseudomonas_phage	97.3	8.4e-126
WP_033953841.1|6762298_6762832_+	hypothetical protein	NA	J9STN6	Pseudomonas_phage	98.9	5.6e-93
WP_033953843.1|6762824_6763025_+	bacteriophage protein	NA	J9RWL7	Pseudomonas_phage	95.5	4.8e-29
WP_033953845.1|6763017_6763641_+	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	93.2	1.1e-103
WP_016852434.1|6764326_6764518_+	hypothetical protein	NA	J9RW45	Pseudomonas_phage	100.0	5.0e-28
WP_034075666.1|6764517_6764985_+	hypothetical protein	NA	J9STM8	Pseudomonas_phage	83.2	2.5e-60
WP_031638311.1|6764971_6765535_+	regulatory protein GemA	NA	Q5ZR14	Pseudomonas_phage	98.9	5.6e-99
WP_003094179.1|6765537_6765897_+	hypothetical protein	NA	A0A0S4L0M4	Pseudomonas_phage	100.0	6.5e-61
WP_003114310.1|6766254_6768291_+	oligopeptide transporter, OPT family	NA	NA	NA	NA	NA
6768133:6768150	attR	CTGATGGGCATCCTGCTC	NA	NA	NA	NA
WP_003119234.1|6768398_6770360_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	26.6	3.3e-21
>prophage 16
NZ_CP053706	Pseudomonas aeruginosa strain PAC1 chromosome, complete genome	7564383	6885065	6944238	7564383	lysis,portal,protease,holin,tRNA,terminase	Pseudomonas_phage(87.76%)	75	NA	NA
WP_010793388.1|6885065_6887918_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.0	1.0e-148
WP_003100590.1|6888038_6888407_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003100593.1|6888418_6888847_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_003092867.1|6888843_6890331_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	36.1	1.0e-51
WP_003100594.1|6890667_6891480_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_003115256.1|6891563_6892487_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_003092864.1|6892678_6893797_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_003092863.1|6893789_6894857_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_003100603.1|6894988_6895486_-	RDD family protein	NA	NA	NA	NA	NA
WP_003119288.1|6895615_6897196_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_031631670.1|6898761_6899073_+	outer membrane protein assembly factor BamE	NA	J7HXI2	Pseudomonas_phage	87.3	7.9e-47
WP_033987580.1|6899191_6899842_+	hypothetical protein	NA	A0A0U4J8W4	Pseudomonas_phage	98.6	6.4e-123
WP_071538382.1|6900060_6901224_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079381619.1|6901635_6901983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023910260.1|6901979_6902294_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_023910258.1|6902296_6902602_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_033987582.1|6902663_6902966_-	hypothetical protein	NA	A0A0A0YRS6	Pseudomonas_phage	96.0	2.0e-50
WP_033987626.1|6902962_6903304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033987583.1|6903308_6903998_-	hypothetical protein	NA	A0A0A0YUE3	Pseudomonas_phage	37.2	1.1e-29
WP_033987585.1|6904170_6904362_-	hypothetical protein	NA	A0A1W6JTB8	Pseudomonas_phage	96.6	1.6e-26
WP_033987586.1|6905742_6906078_-	hypothetical protein	NA	A0A1W6JTA6	Pseudomonas_phage	88.3	7.7e-48
WP_033987588.1|6906080_6906311_-	Arc family DNA-binding protein	NA	A0A1W6JTB4	Pseudomonas_phage	93.4	6.9e-32
WP_021205288.1|6906408_6906642_-	hypothetical protein	NA	A0A0A0YQ28	Pseudomonas_phage	100.0	6.6e-38
WP_172441375.1|6906644_6907031_-	helix-turn-helix transcriptional regulator	NA	A0A1W6JTA9	Pseudomonas_phage	94.1	3.2e-53
WP_107236447.1|6907221_6907299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012613694.1|6907351_6907711_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019396631.1|6907707_6908001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023465045.1|6908986_6909325_+	hypothetical protein	NA	A0A1W6JTD1	Pseudomonas_phage	49.4	7.9e-08
WP_023110578.1|6909321_6909714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023103992.1|6910019_6910370_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031654981.1|6910366_6910645_+	hypothetical protein	NA	A0A1W6JTC3	Pseudomonas_phage	96.7	8.4e-40
WP_034004616.1|6910641_6910950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172441376.1|6910942_6911239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023099118.1|6911235_6911565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023099117.1|6911557_6911893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172441377.1|6911889_6912642_+	hypothetical protein	NA	A0A1X9SFG7	Acinetobacter_phage	52.5	1.5e-19
WP_050157694.1|6912638_6912953_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172441309.1|6912949_6913264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172441307.1|6914315_6916127_+	AAA family ATPase	NA	A0A0U4B0G9	Pseudomonas_phage	70.0	4.5e-259
WP_172441305.1|6916123_6916408_+	hypothetical protein	NA	A0A1W6JTC1	Pseudomonas_phage	97.7	1.6e-41
WP_172441304.1|6916404_6916962_+	hypothetical protein	NA	A0A0A0YRV6	Pseudomonas_phage	93.6	2.6e-72
WP_003085732.1|6917490_6918021_+	Rha family transcriptional regulator	NA	A0A2D1GLJ3	Escherichia_phage	37.3	1.2e-26
WP_004353177.1|6918106_6918439_+|holin	phage holin, lambda family	holin	A0A1W6JTC7	Pseudomonas_phage	96.4	1.9e-54
WP_172441303.1|6918435_6919053_+	glycoside hydrolase family 19 protein	NA	A0A1B0Z086	Pseudomonas_phage	91.2	2.2e-104
WP_071537640.1|6919052_6919607_+	HNH endonuclease	NA	A0A2D1GDR6	Mycobacterium_phage	45.3	1.8e-17
WP_172441403.1|6919606_6920077_+|lysis	lysis protein	lysis	A0A1B0Z001	Pseudomonas_phage	91.0	2.9e-69
WP_019396612.1|6920073_6920817_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	99.2	8.3e-135
WP_023114595.1|6920967_6921513_+|terminase	terminase small subunit	terminase	A0A1W6JT69	Pseudomonas_phage	100.0	3.1e-94
WP_023114594.1|6921484_6923464_+|terminase	phage terminase large subunit family protein	terminase	A0A1W6JT68	Pseudomonas_phage	99.1	0.0e+00
WP_003159069.1|6923454_6923670_+	hypothetical protein	NA	A0A1W6JT66	Pseudomonas_phage	100.0	6.5e-32
WP_172441301.1|6923669_6925316_+|portal	phage portal protein	portal	A0A1W6JTB6	Pseudomonas_phage	99.5	0.0e+00
WP_023465050.1|6925275_6927369_+|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	98.4	0.0e+00
WP_003129701.1|6927435_6927753_+	DUF2190 family protein	NA	A0A1W6JT93	Pseudomonas_phage	100.0	4.6e-50
WP_010791970.1|6927749_6928079_+	hypothetical protein	NA	A0A1W6JT71	Pseudomonas_phage	100.0	3.1e-57
WP_010791969.1|6928075_6928546_+	hypothetical protein	NA	A0A1W6JT75	Pseudomonas_phage	100.0	2.2e-88
WP_010791968.1|6928549_6928744_+	hypothetical protein	NA	A0A1W6JT79	Pseudomonas_phage	100.0	3.0e-28
WP_010791967.1|6928745_6929498_+	hypothetical protein	NA	A0A1W6JT83	Pseudomonas_phage	100.0	9.6e-139
WP_071534551.1|6929642_6930170_+	DUF4124 domain-containing protein	NA	A0A1B0Z2K9	Pseudomonas_phage	94.9	1.9e-88
WP_003129708.1|6930227_6930530_+	hypothetical protein	NA	A0A1B0YZV7	Pseudomonas_phage	86.0	5.3e-40
WP_172441378.1|6930632_6933116_+	tape measure protein	NA	A0A1B0YZV6	Pseudomonas_phage	98.1	0.0e+00
WP_016852557.1|6933156_6933678_+	hypothetical protein	NA	A0A1W6JT98	Pseudomonas_phage	98.3	3.7e-97
WP_172441379.1|6933677_6935375_+	hypothetical protein	NA	A0A1W6JTA3	Pseudomonas_phage	97.5	0.0e+00
WP_033867084.1|6935377_6935788_+	hypothetical protein	NA	A0A1B0YZV0	Pseudomonas_phage	97.1	2.2e-65
WP_033867086.1|6935787_6936333_+	hypothetical protein	NA	A0A0A0YWE1	Pseudomonas_phage	96.1	1.6e-95
WP_033867088.1|6936344_6936767_+	hypothetical protein	NA	A0A1W6JT91	Pseudomonas_phage	95.7	3.8e-68
WP_071537772.1|6936753_6938247_+	hypothetical protein	NA	A0A1B0YZU9	Pseudomonas_phage	99.0	3.6e-286
WP_033867090.1|6938269_6938857_+	hypothetical protein	NA	A0A1W6JT86	Pseudomonas_phage	93.8	4.3e-102
WP_034059266.1|6938849_6939041_+	hypothetical protein	NA	A0A1B0Z2L3	Pseudomonas_phage	98.4	1.6e-29
WP_023124665.1|6939045_6939606_+	hypothetical protein	NA	A0A1B0YZW5	Pseudomonas_phage	96.2	3.0e-97
WP_003159084.1|6939605_6939887_+	hypothetical protein	NA	A0A1W6JTD4	Pseudomonas_phage	97.8	3.0e-45
WP_128708449.1|6940481_6940784_+	hypothetical protein	NA	A0A0S2SY61	Pseudomonas_phage	84.0	1.7e-41
WP_033867099.1|6940780_6941023_+	hypothetical protein	NA	A0A0S3UFY6	Pseudomonas_phage	97.3	5.1e-33
WP_010793874.1|6941538_6942417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085795.1|6942504_6943188_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003085798.1|6943296_6944238_+	alpha/beta hydrolase	NA	A0A1D8EUH4	Mycobacterium_phage	33.3	4.4e-08
>prophage 17
NZ_CP053706	Pseudomonas aeruginosa strain PAC1 chromosome, complete genome	7564383	7081284	7139843	7564383	integrase,transposase,tRNA	uncultured_virus(14.29%)	60	7093875:7093891	7126544:7126560
WP_003102377.1|7081284_7083000_-|tRNA	proline--tRNA ligase	tRNA	NA	NA	NA	NA
WP_003086091.1|7083107_7083515_+	PaaI family thioesterase	NA	NA	NA	NA	NA
WP_003112576.1|7083578_7084910_-	outer membrane porin OprD	NA	NA	NA	NA	NA
WP_003107742.1|7085628_7086057_+	HIT domain-containing protein	NA	NA	NA	NA	NA
WP_003086099.1|7086057_7086267_+	protein SlyX	NA	NA	NA	NA	NA
WP_003106665.1|7086315_7086930_-	cold-shock protein	NA	A0A1X9IGI9	Lactococcus_phage	46.8	1.4e-10
WP_003086103.1|7087144_7087615_-	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	36.4	6.6e-21
WP_003123218.1|7088054_7089830_+|tRNA	aspartate--tRNA ligase	tRNA	A0A1V0SIS0	Klosneuvirus	27.8	1.1e-12
WP_003086107.1|7089896_7090643_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_003112575.1|7090727_7091252_+	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	24.4	2.6e-05
WP_003086122.1|7091268_7091874_+	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_003086123.1|7091884_7092943_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	26.8	4.0e-05
WP_003086124.1|7092995_7093442_+	tol-pal system-associated acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_003086125.1|7093443_7094139_+	protein TolQ	NA	NA	NA	NA	NA
7093875:7093891	attL	CGTCGGCCTGTTCGGTA	NA	NA	NA	NA
WP_003086126.1|7094161_7094602_+	protein TolR	NA	NA	NA	NA	NA
WP_003117096.1|7094604_7095648_+	cell envelope integrity protein TolA	NA	NA	NA	NA	NA
WP_003112572.1|7095644_7096943_+	Tol-Pal system protein TolB	NA	NA	NA	NA	NA
WP_003111417.1|7096995_7097502_+	peptidoglycan-associated lipoprotein Pal	NA	NA	NA	NA	NA
WP_003120698.1|7097511_7098336_+	tol-pal system protein YbgF	NA	NA	NA	NA	NA
WP_003120697.1|7098407_7099202_+	7-carboxy-7-deazaguanine synthase QueE	NA	NA	NA	NA	NA
WP_003111415.1|7099217_7099892_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	38.8	5.0e-30
WP_015503393.1|7100397_7101678_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_023111839.1|7101674_7103597_-	TraI domain-containing protein	NA	NA	NA	NA	NA
WP_079388890.1|7103790_7104189_+	IS66 family insertion sequence hypothetical protein	NA	NA	NA	NA	NA
WP_023980255.1|7104185_7104521_+	IS66 family insertion sequence element accessory protein TnpB	NA	NA	NA	NA	NA
WP_033983075.1|7104584_7106096_+|transposase	IS66 family transposase	transposase	A0A218MNE7	uncultured_virus	53.6	1.5e-122
WP_023082828.1|7106346_7107717_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_003123387.1|7107911_7108805_-	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	34.6	4.1e-11
WP_003123386.1|7108932_7109403_+	PAS domain-containing protein	NA	NA	NA	NA	NA
WP_003123385.1|7109499_7109922_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_003123384.1|7109918_7110674_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_023980440.1|7110677_7111925_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_015503642.1|7111921_7112737_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_015503641.1|7112708_7113977_+	class I SAM-dependent methyltransferase	NA	A0A2I2L5L3	Orpheovirus	31.9	1.5e-43
WP_023111836.1|7113976_7114468_+	DUF2878 domain-containing protein	NA	NA	NA	NA	NA
WP_015503639.1|7114432_7114588_-	DUF2256 domain-containing protein	NA	NA	NA	NA	NA
WP_015503638.1|7114584_7116126_-	cryptochrome/photolyase family protein	NA	A0A1V0SE91	Indivirus	28.6	2.8e-52
WP_003123379.1|7116122_7116428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015503637.1|7116424_7116979_-	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_031277313.1|7116975_7117482_-	chalcone isomerase family protein	NA	NA	NA	NA	NA
WP_094867530.1|7117884_7119011_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	38.7	8.4e-46
WP_023980673.1|7119513_7121025_-	2Fe-2S iron-sulfur cluster binding domain-containing protein	NA	NA	NA	NA	NA
WP_015503633.1|7121163_7121577_+	DUF1924 domain-containing protein	NA	NA	NA	NA	NA
WP_015503632.1|7121591_7122401_+	diheme cytochrome c	NA	NA	NA	NA	NA
WP_023111833.1|7122796_7124164_-	two-component sensor histidine kinase	NA	NA	NA	NA	NA
WP_015503630.1|7124160_7124823_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	38.2	2.8e-33
WP_015503629.1|7124825_7125467_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_015503628.1|7125463_7126270_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_015503627.1|7126256_7126937_-	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
7126544:7126560	attR	TACCGAACAGGCCGACG	NA	NA	NA	NA
WP_015503626.1|7126945_7128412_-	AMP-binding protein	NA	A0A1V0SBX8	Catovirus	25.3	3.4e-15
WP_015503625.1|7128401_7129079_-	thermostable hemolysin	NA	NA	NA	NA	NA
WP_015503624.1|7129212_7129506_+|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
WP_023111832.1|7129905_7130256_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_023111831.1|7130259_7130532_-	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_015503621.1|7130650_7131004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023111830.1|7131033_7132569_-	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_015503619.1|7132565_7132883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019484421.1|7134281_7135220_-	TIGR03756 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_079760180.1|7135219_7135609_-	TIGR03757 family integrating conjugative element protein	NA	NA	NA	NA	NA
WP_011005944.1|7136876_7139843_-|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	97.6	0.0e+00
