The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	0	8399	4726108	integrase,tRNA	Escherichia_phage(60.0%)	9	215:226	3256:3267
WP_021563296.1|82_640_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.7	5.9e-85
215:226	attL	CTGAAAAAACTG	NA	NA	NA	NA
WP_001514810.1|666_1362_-	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_001514811.1|1710_1959_-	DinI family protein	NA	K7PLW4	Enterobacteria_phage	98.8	3.1e-38
WP_159198181.1|2020_3118_-|integrase	tyrosine-type recombinase/integrase	integrase	S5MDN5	Escherichia_phage	98.9	1.8e-210
WP_000543828.1|3206_4244_+|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
3256:3267	attR	CTGAAAAAACTG	NA	NA	NA	NA
WP_000891404.1|4377_4620_+	envelope stress response protein PspG	NA	NA	NA	NA	NA
WP_000235508.1|4785_5769_-	quinone oxidoreductase	NA	NA	NA	NA	NA
WP_000918363.1|5851_7267_+	replicative DNA helicase	NA	O80281	Escherichia_phage	78.3	4.8e-200
WP_001147328.1|7319_8399_+	alanine racemase	NA	A0A0P0YM39	Yellowstone_lake_mimivirus	27.9	5.2e-29
>prophage 2
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	12586	16199	4726108		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000357740.1|12586_15409_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	56.1	0.0e+00
WP_000168305.1|15662_16199_+	single-stranded DNA-binding protein SSB1	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	1.1e-56
>prophage 3
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	20016	21366	4726108		Moraxella_phage(100.0%)	1	NA	NA
WP_000106882.1|20016_21366_+	guanine/hypoxanthine transporter GhxP	NA	A0A0R6PHV4	Moraxella_phage	71.6	1.8e-159
>prophage 4
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	26949	28908	4726108		Staphylococcus_phage(100.0%)	1	NA	NA
WP_172614221.1|26949_28908_-	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	40.2	3.3e-90
>prophage 5
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	38418	40566	4726108		Escherichia_phage(100.0%)	1	NA	NA
WP_001300547.1|38418_40566_-	formate dehydrogenase subunit alpha	NA	A0A077SK27	Escherichia_phage	23.9	7.0e-33
>prophage 6
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	45811	52180	4726108		Tetraselmis_virus(50.0%)	5	NA	NA
WP_001066019.1|45811_47797_-	alkyl sulfatase YjcS	NA	A0A2P0VMX1	Tetraselmis_virus	44.3	4.2e-149
WP_001171687.1|48069_48999_-	allose kinase	NA	NA	NA	NA	NA
WP_001311314.1|48982_49678_-	D-allulose-6-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_000507106.1|49688_50669_-	D-allose ABC transporter permease	NA	NA	NA	NA	NA
WP_000235257.1|50647_52180_-	D-allose ABC transporter ATP-binding protein AlsA	NA	G3M9Y6	Bacillus_virus	27.4	4.4e-13
>prophage 7
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	58414	59964	4726108		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000611405.1|58414_59095_-	phosphonate C-P lyase system protein PhnL	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	7.1e-08
WP_001075514.1|59205_59964_-	phosphonate C-P lyase system protein PhnK	NA	G3M9Y6	Bacillus_virus	28.2	3.6e-16
>prophage 8
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	65576	66365	4726108		Cedratvirus(100.0%)	1	NA	NA
WP_001193409.1|65576_66365_-	phosphonate ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	30.1	6.5e-13
>prophage 9
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	71401	72904	4726108		Burkholderia_virus(100.0%)	1	NA	NA
WP_001298520.1|71401_72904_+	glycine betaine/L-proline transporter ProP	NA	Q6JIH2	Burkholderia_virus	31.2	2.4e-56
>prophage 10
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	94100	97312	4726108	tRNA	Catovirus(50.0%)	2	NA	NA
WP_001295074.1|94100_95618_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	38.0	2.7e-87
WP_000856829.1|95854_97312_-	dipeptide/tripeptide permease DtpC	NA	A0A0P0IY73	Acinetobacter_phage	29.4	6.8e-48
>prophage 11
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	111588	113572	4726108		Cronobacter_phage(50.0%)	2	NA	NA
WP_001026276.1|111588_111882_+	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000729117.1|111925_113572_+	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
>prophage 12
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	118089	118623	4726108		Morganella_phage(100.0%)	1	NA	NA
WP_001238378.1|118089_118623_-	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
>prophage 13
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	123543	124521	4726108		Tupanvirus(100.0%)	1	NA	NA
WP_000004771.1|123543_124521_+	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	6.8e-28
>prophage 14
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	132504	133050	4726108		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001295188.1|132504_133050_+	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
>prophage 15
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	136965	149996	4726108	tRNA,protease	Vibrio_phage(20.0%)	11	NA	NA
WP_000990333.1|136965_138303_+	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_001122505.1|138312_140160_+	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_001280345.1|140152_141103_+|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001051883.1|141188_141497_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_000460360.1|141572_142853_+	GTPase HflX	NA	NA	NA	NA	NA
WP_000312488.1|142938_144198_+|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_001232412.1|144200_145205_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_001089295.1|145286_145484_+	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_000527955.1|145587_146886_+	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001177639.1|147090_147516_+	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000076332.1|147554_149996_+	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	3.8e-67
>prophage 16
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	153928	155092	4726108		Ralstonia_phage(100.0%)	1	NA	NA
WP_000943964.1|153928_155092_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	4.9e-81
>prophage 17
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	169044	169741	4726108	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_111947175.1|169044_169741_+|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	99.1	3.6e-132
>prophage 18
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	197408	203896	4726108		uncultured_Caudovirales_phage(33.33%)	6	NA	NA
WP_000055072.1|197408_197939_-	inorganic diphosphatase	NA	A0A2H4J8U1	uncultured_Caudovirales_phage	63.9	9.4e-56
WP_000265933.1|198248_199205_+	galactofuranose ABC transporter substrate-binding protein YtfQ	NA	NA	NA	NA	NA
WP_000210557.1|199344_200847_+	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.3	1.8e-11
WP_001297255.1|200860_201883_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_000596015.1|201869_202865_+	sugar ABC transporter permease YjfF	NA	NA	NA	NA	NA
WP_000853753.1|202897_203896_-	class 1 fructose-bisphosphatase	NA	A0A1V0SKX4	Klosneuvirus	42.7	5.7e-70
>prophage 19
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	208212	210973	4726108		Vibrio_phage(100.0%)	2	NA	NA
WP_001106226.1|208212_208677_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	2.5e-52
WP_000187791.1|208834_210973_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.6	9.1e-267
>prophage 20
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	214611	220708	4726108		Paramecium_bursaria_Chlorella_virus(66.67%)	6	NA	NA
WP_172614224.1|214611_215559_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	1.0e-12
WP_001387276.1|215743_215797_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471889.1|215937_218634_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|218839_219226_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|219298_219760_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|219772_220708_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
>prophage 21
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	229011	241126	4726108	integrase,tRNA	Klosneuvirus(20.0%)	8	236261:236274	242160:242173
WP_000416407.1|229011_231867_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786398.1|231866_232310_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|232663_234175_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584109.1|234441_235542_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|235541_236624_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
236261:236274	attL	CGTGGTGGCGCTGG	NA	NA	NA	NA
WP_001332879.1|236742_238245_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.8	2.1e-84
WP_172614225.1|238374_239394_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	3.2e-44
WP_001218930.1|239860_241126_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.0	2.2e-79
242160:242173	attR	CCAGCGCCACCACG	NA	NA	NA	NA
>prophage 22
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	249221	250898	4726108		Escherichia_phage(100.0%)	2	NA	NA
WP_097308469.1|249221_249824_+	type 1 fimbria regulatory protein FimB	NA	A0A2L1IV36	Escherichia_phage	52.3	5.3e-55
WP_064669509.1|250301_250898_+	type 1 fimbria regulatory protein FimE	NA	A0A2L1IV36	Escherichia_phage	53.4	2.3e-50
>prophage 23
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	260025	261486	4726108		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000208220.1|260025_261486_+	fructuronate reductase	NA	H8ZJP8	Ostreococcus_tauri_virus	31.9	3.6e-49
>prophage 24
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	268054	268609	4726108		Clostridioides_phage(100.0%)	1	NA	NA
WP_001151859.1|268054_268609_+	RNA 2'-phosphotransferase	NA	A0A2R2ZGT8	Clostridioides_phage	45.6	2.0e-37
>prophage 25
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	293169	298534	4726108		uncultured_Caudovirales_phage(50.0%)	4	NA	NA
WP_000919543.1|293169_294834_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.6	6.2e-13
WP_000410144.1|294882_296244_-	MFS transporter	NA	NA	NA	NA	NA
WP_000091572.1|296458_297373_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000106033.1|297511_298534_+	L-galactonate oxidoreductase	NA	A0A2K9L7I1	Tupanvirus	26.3	2.7e-11
>prophage 26
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	301761	303041	4726108		Shigella_phage(50.0%)	2	NA	NA
WP_000799911.1|301761_302499_-	DNA replication protein DnaC	NA	V5UQI5	Shigella_phage	50.8	7.6e-64
WP_000098818.1|302501_303041_-	primosomal protein DnaT	NA	T1SA92	Salmonella_phage	62.8	2.9e-28
>prophage 27
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	310980	312570	4726108		Streptococcus_phage(100.0%)	1	NA	NA
WP_000175943.1|310980_312570_+	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
>prophage 28
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	319895	321218	4726108		Geobacillus_virus(100.0%)	1	NA	NA
WP_000477811.1|319895_321218_+	thymidine phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	39.8	2.3e-79
>prophage 29
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	327960	333315	4726108		Enterococcus_phage(33.33%)	3	NA	NA
WP_000093810.1|327960_329193_+	multifunctional transcriptional regulator/nicotinamide-nucleotide adenylyltransferase/ribosylnicotinamide kinase NadR	NA	A0A0C5K935	Enterococcus_phage	42.6	1.6e-82
WP_000046749.1|329499_331167_-	energy-dependent translational throttle protein EttA	NA	A0A1V0SKJ1	Klosneuvirus	26.4	3.7e-42
WP_000409451.1|331377_333315_+	murein transglycosylase	NA	A0A1P8CWQ1	Bacillus_phage	34.8	4.0e-11
>prophage 30
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	336657	338771	4726108		Bacillus_phage(50.0%)	2	NA	NA
WP_001188666.1|336657_337347_+	two-component system response regulator CreB	NA	W8CYM9	Bacillus_phage	35.3	2.0e-29
WP_001219560.1|337346_338771_+	two-component system sensor histidine kinase CreC	NA	Q8QKV7	Ectocarpus_siliculosus_virus	20.4	1.6e-09
>prophage 31
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	350540	360958	4726108	transposase	Cyanophage(20.0%)	10	NA	NA
WP_000130189.1|350540_351494_+	transaldolase	NA	A0A127KNC6	Cyanophage	30.9	4.8e-10
WP_001094682.1|351608_352196_+	molybdopterin adenylyltransferase	NA	NA	NA	NA	NA
WP_000528538.1|352230_352797_-	acetate uptake transporter	NA	NA	NA	NA	NA
WP_001102383.1|352945_353659_-	acidic protein MsyB	NA	NA	NA	NA	NA
WP_000843568.1|353684_354089_-	DUF2541 family protein	NA	NA	NA	NA	NA
WP_000516135.1|354465_356382_+	molecular chaperone DnaK	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	51.1	6.9e-149
WP_001118464.1|356470_357601_+	molecular chaperone DnaJ	NA	E3T4P7	Cafeteria_roenbergensis_virus	34.6	4.6e-28
WP_001300563.1|357863_358976_-|transposase	IS4-like element IS421 family transposase	transposase	NA	NA	NA	NA
WP_001181672.1|359053_359263_-	type I toxin-antitoxin system toxin MokC	NA	A0A0P0ZAX5	Stx2-converting_phage	72.5	5.2e-18
WP_000681368.1|359791_360958_+	Na+/H+ antiporter NhaA	NA	A0A2H4J5W3	uncultured_Caudovirales_phage	53.8	9.2e-88
>prophage 32
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	367989	370806	4726108	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001286865.1|367989_370806_+|tRNA	isoleucine--tRNA ligase	tRNA	A0A2K9L260	Tupanvirus	26.1	2.7e-77
>prophage 33
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	375249	376398	4726108		Halovirus(100.0%)	1	NA	NA
WP_001351917.1|375249_376398_+	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	32.6	1.3e-49
>prophage 34
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	381992	387653	4726108		Staphylococcus_phage(50.0%)	4	NA	NA
WP_172614368.1|381992_383546_-	crotonobetaine/carnitine-CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	27.1	2.0e-34
WP_000349924.1|383619_384837_-	L-carnitine CoA-transferase	NA	NA	NA	NA	NA
WP_000347117.1|384965_386108_-	crotonobetainyl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_000787103.1|386138_387653_-	L-carnitine/gamma-butyrobetaine antiport BCCT transporter	NA	A0A2I7QNT1	Vibrio_phage	21.1	3.5e-07
>prophage 35
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	395545	396945	4726108		Bacillus_phage(50.0%)	2	NA	NA
WP_000624375.1|395545_396025_+	type 3 dihydrofolate reductase	NA	A0A219UQN5	Bacillus_phage	46.4	1.0e-29
WP_000257192.1|396102_396945_-	bis(5'-nucleosyl)-tetraphosphatase (symmetrical)	NA	A0A075BTY6	Microcystis_phage	42.0	1.0e-08
>prophage 36
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	406081	411504	4726108		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001117011.1|406081_408988_-	RNA polymerase-associated protein RapA	NA	A0A1B1IUI1	uncultured_Mediterranean_phage	37.9	5.7e-22
WP_000035670.1|409152_411504_-	DNA polymerase II	NA	A0A0P0YM26	Yellowstone_lake_phycodnavirus	25.5	1.3e-37
>prophage 37
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	417952	418651	4726108		Planktothrix_phage(100.0%)	1	NA	NA
WP_000916281.1|417952_418651_-	thiamine ABC transporter ATP-binding protein ThiQ	NA	G9BWD6	Planktothrix_phage	37.2	3.6e-23
>prophage 38
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	431353	433078	4726108		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001295534.1|431353_433078_+	acetolactate synthase 3 large subunit	NA	E5ERI2	Ostreococcus_lucimarinus_virus	26.9	1.4e-36
>prophage 39
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	459167	460211	4726108		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_001217338.1|459167_460211_+	GMP reductase	NA	A0A0N9Q9A5	Chrysochromulina_ericina_virus	56.3	6.3e-104
>prophage 40
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	464456	465008	4726108		Sphingobium_phage(100.0%)	1	NA	NA
WP_000923721.1|464456_465008_+	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	32.3	3.0e-12
>prophage 41
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	473634	475059	4726108		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000102485.1|473634_475059_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.8	4.2e-42
>prophage 42
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	482805	489428	4726108		Mamastrovirus(33.33%)	5	NA	NA
WP_001189647.1|482805_484356_+	multicopper oxidase CueO	NA	A0A0C6DWA2	Mamastrovirus	55.4	2.7e-18
WP_001306211.1|484557_486948_-	quinoprotein glucose dehydrogenase	NA	NA	NA	NA	NA
WP_000683335.1|487153_487690_+	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	33.1	5.1e-17
WP_000651599.1|487730_488393_-	carbonate dehydratase	NA	NA	NA	NA	NA
WP_000150637.1|488501_489428_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	34.0	1.2e-21
>prophage 43
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	492690	493593	4726108		Sodalis_phage(100.0%)	1	NA	NA
WP_000339954.1|492690_493593_+	recombination-promoting nuclease RpnC	NA	Q2A0A7	Sodalis_phage	49.2	7.4e-61
>prophage 44
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	499956	506762	4726108	tRNA	unidentified_phage(50.0%)	6	NA	NA
WP_000174643.1|499956_501375_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	37.9	3.2e-26
WP_000937424.1|501413_502340_-|tRNA	tRNA glutamyl-Q(34) synthetase GluQRS	tRNA	NA	NA	NA	NA
WP_001155227.1|502376_502832_-	RNA polymerase-binding protein DksA	NA	NA	NA	NA	NA
WP_000396036.1|503009_503714_-	DNA/RNA nuclease SfsA	NA	NA	NA	NA	NA
WP_001294700.1|503728_504259_-	RNA 2',3'-cyclic phosphodiesterase	NA	NA	NA	NA	NA
WP_001360098.1|504332_506762_+	ATP-dependent helicase HrpB	NA	A0A0G2Y9F4	Acanthamoeba_polyphaga_mimivirus	30.1	1.3e-38
>prophage 45
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	512005	512803	4726108		Planktothrix_phage(100.0%)	1	NA	NA
WP_001158931.1|512005_512803_+	Fe3+-hydroxamate ABC transporter ATP-binding protein FhuC	NA	G9BWD6	Planktothrix_phage	26.9	2.7e-14
>prophage 46
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	518837	519182	4726108		Lake_Baikal_phage(100.0%)	1	NA	NA
WP_001295564.1|518837_519182_+	iron-sulfur cluster insertion protein ErpA	NA	A0A2H4N7M3	Lake_Baikal_phage	51.4	4.5e-27
>prophage 47
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	523111	524536	4726108	protease	uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000753946.1|523111_524536_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	1.9e-26
>prophage 48
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	537133	537892	4726108		Flavobacterium_phage(100.0%)	1	NA	NA
WP_001295562.1|537133_537892_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
>prophage 49
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	546720	550836	4726108		Emiliania_huxleyi_virus(50.0%)	2	NA	NA
WP_000569430.1|546720_547317_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	1.0e-26
WP_001294757.1|547353_550836_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	36.9	2.2e-209
>prophage 50
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	563841	564873	4726108		Planktothrix_phage(100.0%)	1	NA	NA
WP_000594006.1|563841_564873_-	methionine ABC transporter ATP-binding protein MetN	NA	G9BWD6	Planktothrix_phage	39.7	9.4e-36
>prophage 51
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	571384	579016	4726108		Indivirus(25.0%)	8	NA	NA
WP_000997010.1|571384_572188_+	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	36.2	2.4e-39
WP_097308483.1|572184_573099_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001230983.1|573339_574140_+	endonuclease/exonuclease/phosphatase family protein	NA	NA	NA	NA	NA
WP_000644685.1|574814_576173_-	murein transglycosylase D	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	36.0	5.8e-09
WP_001052715.1|576244_577000_-	hydroxyacylglutathione hydrolase	NA	NA	NA	NA	NA
WP_001326702.1|577033_577756_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_172614233.1|577752_578220_-	ribonuclease HI	NA	J9Q745	Salmonella_phage	59.4	3.6e-51
WP_001340895.1|578284_579016_+	DNA polymerase III subunit epsilon	NA	A0A1X9SH08	Bradyrhizobium_phage	39.0	4.5e-40
>prophage 52
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	584343	592612	4726108	transposase	uncultured_Caudovirales_phage(100.0%)	5	NA	NA
WP_074404518.1|584343_585801_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.5	3.4e-23
WP_001077738.1|585800_586178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172614234.1|586646_587783_+|transposase	ISAs1 family transposase	transposase	NA	NA	NA	NA
WP_001372445.1|587853_588303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000015446.1|588379_592612_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	43.1	6.4e-22
>prophage 53
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	598714	602633	4726108		Caulobacter_phage(50.0%)	6	NA	NA
WP_000284050.1|598714_599293_+	D-sedoheptulose 7-phosphate isomerase	NA	A0A067XQR2	Caulobacter_phage	32.0	1.1e-14
WP_000333380.1|599498_600266_+	class II glutamine amidotransferase	NA	NA	NA	NA	NA
WP_001225679.1|600236_600977_-	murein L,D-transpeptidase	NA	NA	NA	NA	NA
WP_000615983.1|601132_601411_-	type II toxin-antitoxin system mRNA interferase toxin YafQ	NA	NA	NA	NA	NA
WP_000729703.1|601413_601674_-	type II toxin-antitoxin system antitoxin DinJ	NA	NA	NA	NA	NA
WP_000056849.1|601883_602633_+	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	38.5	9.0e-20
>prophage 54
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	616610	619568	4726108		Hokovirus(50.0%)	2	NA	NA
WP_000859525.1|616610_617006_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	50.7	6.6e-30
WP_172614235.1|617123_619568_-	glycosyltransferase	NA	A0A1V0SAN7	Catovirus	43.2	7.2e-34
>prophage 55
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	649022	656604	4726108		Streptococcus_phage(50.0%)	6	NA	NA
WP_000749863.1|649022_650078_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	61.1	9.1e-119
WP_001285288.1|650365_651469_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893278.1|651480_652734_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.2	9.8e-96
WP_001111348.1|653050_653461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000121359.1|653439_654396_-	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_000667026.1|654405_656604_-	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	2.5e-38
>prophage 56
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	673595	674921	4726108		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_001046307.1|673595_674921_-	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
>prophage 57
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	680496	686416	4726108	holin	Catovirus(50.0%)	4	NA	NA
WP_001159094.1|680496_682167_-|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_000089110.1|682180_683653_-	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001335745.1|683666_684254_-	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000131044.1|684382_686416_+|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
>prophage 58
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	697772	698822	4726108		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_000692754.1|697772_698822_+	NADPH-dependent aldehyde reductase YahK	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	42.6	2.8e-72
>prophage 59
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	707594	709481	4726108		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000010285.1|707594_709481_+	propionate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	29.4	7.0e-53
>prophage 60
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	712679	713579	4726108		Lactobacillus_phage(100.0%)	1	NA	NA
WP_000952503.1|712679_713579_-	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	27.3	4.2e-16
>prophage 61
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	718119	722399	4726108		Herpes_simplex_virus(50.0%)	2	NA	NA
WP_097308470.1|718119_721194_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	99.9	0.0e+00
WP_000805902.1|721316_722399_-	DNA-binding transcriptional repressor LacI	NA	C6ZCU4	Enterobacteria_phage	100.0	7.5e-193
>prophage 62
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	727809	729770	4726108		Ostreococcus_lucimarinus_virus(50.0%)	2	NA	NA
WP_000044314.1|727809_728760_+	acetaldehyde dehydrogenase	NA	G9E526	Ostreococcus_lucimarinus_virus	35.2	8.7e-36
WP_001013499.1|728756_729770_+	4-hydroxy-2-oxovalerate aldolase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	31.1	1.2e-43
>prophage 63
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	733148	734258	4726108		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_063080503.1|733148_734258_-	S-(hydroxymethyl)glutathione dehydrogenase	NA	A0A0K0KVL7	Prochlorococcus_phage	28.6	1.2e-31
>prophage 64
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	739558	740326	4726108		Planktothrix_phage(100.0%)	1	NA	NA
WP_000939375.1|739558_740326_+	taurine ABC transporter ATP-binding subunit	NA	G9BWD6	Planktothrix_phage	40.3	8.6e-26
>prophage 65
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	747220	748378	4726108		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000830741.1|747220_748378_-	OXA-12 family class D beta-lactamase AmpH	NA	A0A2H4JAN9	uncultured_Caudovirales_phage	22.1	5.1e-06
>prophage 66
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	755792	756908	4726108		Bacillus_phage(100.0%)	1	NA	NA
WP_172614242.1|755792_756908_+	diguanylate cyclase AdrA	NA	A0A127AWB9	Bacillus_phage	34.5	1.1e-18
>prophage 67
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	761197	771274	4726108		Bacillus_phage(60.0%)	7	NA	NA
WP_001298537.1|761197_762109_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	63.6	2.7e-103
WP_001219309.1|762233_763142_+	fructokinase	NA	NA	NA	NA	NA
WP_001326926.1|763386_764571_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_063080620.1|764696_767843_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001221319.1|767839_769042_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|769231_769921_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893623.1|769978_771274_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.7e-26
>prophage 68
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	778226	787207	4726108	tRNA	uncultured_Mediterranean_phage(60.0%)	10	NA	NA
WP_135561649.1|778226_779354_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	46.1	1.6e-89
WP_000007629.1|779376_779709_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	33.0	2.8e-10
WP_000934822.1|779736_781584_+	protein translocase subunit SecD	NA	NA	NA	NA	NA
WP_000046637.1|781594_782566_+	protein translocase subunit SecF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	37.9	1.0e-44
WP_000974813.1|782694_783042_+	HNH nuclease family protein	NA	NA	NA	NA	NA
WP_001295328.1|783218_784103_-	nucleoside-specific channel-forming protein Tsx	NA	NA	NA	NA	NA
WP_001326929.1|784401_784941_-	DUF3251 domain-containing protein	NA	NA	NA	NA	NA
WP_000543535.1|785091_785541_+	transcriptional regulator NrdR	NA	NA	NA	NA	NA
WP_001150457.1|785544_786648_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	35.8	2.8e-54
WP_001021161.1|786736_787207_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	47.4	1.3e-29
>prophage 69
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	808766	813813	4726108	protease	Agrobacterium_phage(25.0%)	4	NA	NA
WP_000122253.1|808766_809390_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	63.9	2.9e-64
WP_000130305.1|809515_810790_+|protease	ATP-dependent protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	56.4	8.7e-132
WP_001295325.1|810977_813332_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	52.4	1.6e-224
WP_001043542.1|813540_813813_+	DNA-binding protein HU-beta	NA	A7KV42	Bacillus_phage	58.4	1.1e-20
>prophage 70
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	816941	817637	4726108		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000817220.1|816941_817637_-	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	67.6	5.5e-88
>prophage 71
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	820960	824507	4726108		Bacillus_phage(100.0%)	2	NA	NA
WP_001235649.1|820960_822733_+	SmdA family multidrug ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	29.1	3.4e-49
WP_001256201.1|822725_824507_+	SmdB family multidrug efflux ABC transporter permease/ATP-binding protein	NA	W8CYL7	Bacillus_phage	27.1	2.3e-42
>prophage 72
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	833343	836493	4726108		Leptospira_phage(100.0%)	1	NA	NA
WP_001132469.1|833343_836493_-	multidrug efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.9	6.2e-54
>prophage 73
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	843501	852063	4726108		Klosneuvirus(25.0%)	8	NA	NA
WP_000127356.1|843501_844053_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	47.3	3.7e-31
WP_000122013.1|844181_846113_+	DNA polymerase III subunit gamma/tau	NA	A0A1L2BWV7	Bacteriophage	41.5	5.1e-43
WP_000467098.1|846165_846495_+	YbaB/EbfC family nucleoid-associated protein	NA	NA	NA	NA	NA
WP_001195025.1|846494_847100_+	recombination protein RecR	NA	NA	NA	NA	NA
WP_000678201.1|847209_849084_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	38.0	1.0e-117
WP_001220233.1|849264_849909_+	adenylate kinase	NA	NA	NA	NA	NA
WP_001250103.1|850144_851107_+	ferrochelatase	NA	NA	NA	NA	NA
WP_000801813.1|851103_852063_-	acetyl esterase	NA	L7RDF8	Acanthamoeba_polyphaga_moumouvirus	24.3	3.8e-15
>prophage 74
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	860307	863469	4726108		Escherichia_phage(50.0%)	2	NA	NA
WP_000806442.1|860307_860649_+	HigA family addiction module antidote protein	NA	A0A222YWD7	Escherichia_phage	75.5	3.2e-41
WP_000083955.1|860964_863469_-	copper-exporting P-type ATPase CopA	NA	A0A218MNH6	uncultured_virus	38.4	2.9e-115
>prophage 75
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	868008	868686	4726108		Bacillus_virus(100.0%)	1	NA	NA
WP_001157540.1|868008_868686_+	iron ABC transporter ATP-binding protein FetA	NA	G3M9Y6	Bacillus_virus	34.3	1.4e-27
>prophage 76
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	871822	879630	4726108		Planktothrix_phage(50.0%)	3	NA	NA
WP_001110573.1|871822_872509_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_000561872.1|872505_874920_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_172614244.1|875349_879630_+	rhs element protein RhsD	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.1	1.7e-22
>prophage 77
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	886003	887785	4726108		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_001096881.1|886003_887785_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.0	3.5e-38
>prophage 78
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	893975	895121	4726108		Streptococcus_phage(100.0%)	1	NA	NA
WP_001333621.1|893975_895121_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	41.6	9.1e-48
>prophage 79
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	906698	909829	4726108	tRNA	Moumouvirus(50.0%)	4	NA	NA
WP_000912347.1|906698_908084_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143535.1|908119_908641_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|908748_908961_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729155.1|908962_909829_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
>prophage 80
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	924129	926245	4726108		Hokovirus(50.0%)	2	NA	NA
WP_000253842.1|924129_925572_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	3.0e-11
WP_000770953.1|925561_926245_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
>prophage 81
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	929390	932534	4726108		Leptospira_phage(100.0%)	1	NA	NA
WP_000573948.1|929390_932534_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.1	9.8e-60
>prophage 82
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	944833	950875	4726108		Tupanvirus(50.0%)	3	NA	NA
WP_000077805.1|944833_948715_+	enterobactin non-ribosomal peptide synthetase EntF	NA	A0A2K9KZV5	Tupanvirus	29.0	1.6e-59
WP_000096692.1|948929_950063_+	LPS O-antigen length regulator	NA	NA	NA	NA	NA
WP_000140647.1|950059_950875_-	iron-enterobactin ABC transporter ATP-binding protein	NA	A0A1V0SJ29	Klosneuvirus	22.0	7.3e-07
>prophage 83
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	965422	967245	4726108		uncultured_marine_virus(50.0%)	2	NA	NA
WP_000502945.1|965422_966052_-	ParB-like nuclease domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	52.8	2.9e-56
WP_000029825.1|966024_967245_-	phosphoadenosine phosphosulfate reductase	NA	A0A220GKF8	Streptococcus_phage	32.8	2.1e-58
>prophage 84
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	970428	972543	4726108		Bacillus_virus(50.0%)	2	NA	NA
WP_000887629.1|970428_971994_+	alkyl hydroperoxide reductase subunit F	NA	G3MA85	Bacillus_virus	34.3	2.2e-44
WP_000278509.1|972114_972543_-	universal stress protein UspG	NA	A0A1W6JNV4	Morganella_phage	39.2	1.1e-19
>prophage 85
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	987967	988614	4726108		Morganella_phage(50.0%)	2	NA	NA
WP_000034825.1|987967_988177_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	2.7e-22
WP_000939747.1|988230_988614_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	53.6	6.8e-24
>prophage 86
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	993427	995866	4726108		Stx2-converting_phage(50.0%)	2	NA	NA
WP_001092082.1|993427_994639_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	47.4	1.2e-101
WP_001231430.1|994777_995866_-	endolytic peptidoglycan transglycosylase RlpA	NA	F5B3X9	Synechococcus_phage	53.2	3.6e-09
>prophage 87
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1002876	1005459	4726108	tRNA	Staphylococcus_phage(100.0%)	1	NA	NA
WP_001340834.1|1002876_1005459_-|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	42.5	1.0e-184
>prophage 88
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1012398	1015931	4726108		Bathycoccus_sp._RCC1105_virus(50.0%)	3	NA	NA
WP_000367875.1|1012398_1014069_-	molecular chaperone HscC	NA	E5ESM6	Bathycoccus_sp._RCC1105_virus	32.6	4.0e-76
WP_001207520.1|1014152_1015088_-	pyrimidine-specific ribonucleoside hydrolase RihA	NA	NA	NA	NA	NA
WP_000631384.1|1015205_1015931_-	glutamate/aspartate ABC transporter ATP binding protein GltL	NA	G9BWD6	Planktothrix_phage	38.6	7.6e-32
>prophage 89
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1021814	1022855	4726108		Pseudomonas_phage(100.0%)	1	NA	NA
WP_001018040.1|1021814_1022855_-	PhoH family protein	NA	A0A0S0MVD6	Pseudomonas_phage	46.6	4.1e-47
>prophage 90
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1026989	1028654	4726108		Ostreococcus_tauri_virus(100.0%)	1	NA	NA
WP_000337077.1|1026989_1028654_-	asparagine synthase B	NA	A9YVS6	Ostreococcus_tauri_virus	39.5	6.1e-85
>prophage 91
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1033420	1037234	4726108	tRNA	Vibrio_phage(50.0%)	2	NA	NA
WP_001023094.1|1033420_1035367_+	PTS N-acetyl glucosamine transporter subunit IIABC	NA	A0A2I7SAJ6	Vibrio_phage	47.3	1.6e-07
WP_001287154.1|1035569_1037234_+|tRNA	glutamine--tRNA ligase	tRNA	A0A222YZ70	Escherichia_phage	99.1	0.0e+00
>prophage 92
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1050532	1063259	4726108		Bacillus_phage(25.0%)	8	NA	NA
WP_000186076.1|1050532_1051210_-	two-component system response regulator KdpE	NA	W8CYM9	Bacillus_phage	30.6	2.0e-26
WP_001310640.1|1051206_1053891_-	two-component system sensor histidine kinase KdbD	NA	A0A1V0SGX0	Hokovirus	26.8	5.0e-12
WP_001300431.1|1053883_1054456_-	K(+)-transporting ATPase subunit C	NA	NA	NA	NA	NA
WP_000087939.1|1054464_1056513_-	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.0	2.4e-27
WP_000741131.1|1056535_1058209_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_001272653.1|1058208_1058298_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000424924.1|1058610_1058817_+	YbfA family protein	NA	NA	NA	NA	NA
WP_061360238.1|1059059_1063259_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.6	5.6e-26
>prophage 93
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1066732	1069782	4726108		Hokovirus(50.0%)	2	NA	NA
WP_000207142.1|1066732_1068151_+	deoxyribodipyrimidine photo-lyase	NA	A0A1V0SGL1	Hokovirus	32.4	3.1e-61
WP_001032689.1|1068300_1069782_-	dipeptide permease DtpD	NA	A0A0P0IY73	Acinetobacter_phage	28.2	2.5e-45
>prophage 94
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1073160	1073952	4726108		Kaumoebavirus(100.0%)	1	NA	NA
WP_001113989.1|1073160_1073952_+	endonuclease VIII	NA	A0A1V0CNR6	Kaumoebavirus	27.5	7.5e-09
>prophage 95
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1110482	1114002	4726108		Vibrio_phage(33.33%)	4	NA	NA
WP_000345410.1|1110482_1111202_+	nicotinamide riboside transporter PnuC	NA	A0A126HGA3	Vibrio_phage	32.7	9.2e-22
WP_000951292.1|1111198_1112140_-	CDF family zinc transporter ZitB	NA	A0A1V0SED0	Indivirus	28.2	2.2e-23
WP_000784351.1|1112253_1112634_-	periplasmic protein	NA	NA	NA	NA	NA
WP_001109196.1|1112949_1114002_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	49.4	3.4e-81
>prophage 96
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1118355	1124929	4726108		Tupanvirus(33.33%)	7	NA	NA
WP_001265438.1|1118355_1119372_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	46.0	6.1e-80
WP_000096869.1|1119632_1121105_-	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	28.3	7.2e-13
WP_001147439.1|1121172_1121961_-	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_000891515.1|1122089_1122239_+	multidrug efflux pump accessory protein AcrZ	NA	NA	NA	NA	NA
WP_000101984.1|1122405_1123179_+	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000604034.1|1123178_1123868_+	molybdate ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000891692.1|1123870_1124929_+	molybdenum ABC transporter ATP-binding protein ModC	NA	G9BWD6	Planktothrix_phage	35.9	1.5e-20
>prophage 97
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1135284	1136574	4726108		Klosneuvirus(100.0%)	1	NA	NA
WP_001295303.1|1135284_1136574_-	adenosylmethionine--8-amino-7-oxononanoate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.5	5.3e-20
>prophage 98
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1143055	1143964	4726108		Streptococcus_phage(100.0%)	1	NA	NA
WP_001295302.1|1143055_1143964_-	uridine diphosphate-N-acetylglucosamine-binding protein YvcK	NA	A1IMD5	Streptococcus_phage	31.1	1.4e-27
>prophage 99
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1154561	1169373	4726108		Anomala_cuprea_entomopoxvirus(14.29%)	13	NA	NA
WP_001326787.1|1154561_1156298_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	29.8	2.3e-18
WP_000743444.1|1156290_1157286_-	secretion protein HlyD	NA	NA	NA	NA	NA
WP_097308387.1|1157288_1157960_-	DNA-binding transcriptional regulator CecR	NA	NA	NA	NA	NA
WP_000007101.1|1158188_1159553_+	ATP-dependent RNA helicase RhlE	NA	A0A1V0SBR7	Catovirus	31.8	1.5e-52
WP_001145126.1|1159784_1160267_-	N-glycosidase YbiA	NA	A0A0H3TLU0	Faustovirus	52.0	9.8e-36
WP_001340191.1|1160386_1162537_+	ATP-dependent DNA helicase DinG	NA	A0A127AW80	Bacillus_phage	26.1	3.7e-42
WP_000386551.1|1162564_1163527_+	DNA-binding protein YbiB	NA	NA	NA	NA	NA
WP_000443530.1|1163667_1164753_+	hydroxycarboxylate dehydrogenase HcXB	NA	NA	NA	NA	NA
WP_000849301.1|1164981_1165242_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000146343.1|1165506_1165773_-	C4-type zinc finger protein YbiI	NA	E5G6L7	Salmonella_phage	45.6	6.9e-07
WP_000990177.1|1165846_1166524_-	PKHD-type hydroxylase YbiX	NA	Q5GQB0	Synechococcus_phage	30.1	1.2e-18
WP_172614248.1|1166565_1168848_-	catecholate siderophore receptor Fiu	NA	NA	NA	NA	NA
WP_000710619.1|1169112_1169373_-	DUF1471 domain-containing protein	NA	A0A1B2ICL8	Erwinia_phage	51.0	1.6e-05
>prophage 100
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1173057	1178282	4726108		Planktothrix_phage(33.33%)	7	NA	NA
WP_000569083.1|1173057_1173780_-	glutamine ABC transporter ATP-binding protein GlnQ	NA	G9BWD6	Planktothrix_phage	42.7	5.6e-35
WP_001159065.1|1173776_1174436_-	glutamine ABC transporter permease GlnP	NA	NA	NA	NA	NA
WP_000843866.1|1174574_1175321_-	glutamine ABC transporter substrate-binding protein GlnH	NA	NA	NA	NA	NA
WP_000100800.1|1175724_1176228_-	DNA starvation/stationary phase protection protein Dps	NA	A0A222YYG6	Streptomyces_phage	29.0	4.9e-06
WP_001295297.1|1176526_1177414_-	threonine/homoserine exporter RhtA	NA	NA	NA	NA	NA
WP_120795379.1|1177648_1177714_+	protein YliM	NA	NA	NA	NA	NA
WP_001295296.1|1177766_1178282_+	outer membrane protein OmpX	NA	H6WZM8	Escherichia_phage	33.8	1.1e-16
>prophage 101
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1183279	1191621	4726108		Tupanvirus(33.33%)	6	NA	NA
WP_000961458.1|1183279_1184872_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.7	6.9e-62
WP_000168797.1|1185112_1186378_-	DUF1479 domain-containing protein	NA	NA	NA	NA	NA
WP_000114272.1|1186529_1187345_-	sugar-phosphatase YbiV	NA	NA	NA	NA	NA
WP_000209342.1|1187490_1189923_-	glycyl radical protein	NA	A0A076YHZ7	Citrobacter_phage	44.9	1.6e-09
WP_001295295.1|1189928_1190828_-	glycyl-radical enzyme activating protein	NA	NA	NA	NA	NA
WP_001336208.1|1190958_1191621_+	fructose-6-phosphate aldolase	NA	C7BV14	Synechococcus_phage	32.5	2.8e-25
>prophage 102
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1194836	1196708	4726108		Planktothrix_phage(100.0%)	1	NA	NA
WP_001301279.1|1194836_1196708_+	glutathione ABC transporter ATP-binding protein GsiA	NA	G9BWD6	Planktothrix_phage	29.7	5.2e-16
>prophage 103
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1208043	1209246	4726108		Stx2-converting_phage(100.0%)	1	NA	NA
WP_001300708.1|1208043_1209246_+	serine-type D-Ala-D-Ala carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	48.0	1.1e-99
>prophage 104
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1215754	1303680	4726108	head,terminase,capsid,lysis,protease,tail,integrase,portal,tRNA,plate	Salmonella_phage(55.56%)	93	1212795:1212810	1307392:1307407
1212795:1212810	attL	GTTACCGCCATCGCCA	NA	NA	NA	NA
WP_001471277.1|1215754_1216786_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	56.1	2.5e-105
WP_001321204.1|1216972_1217164_-	hypothetical protein	NA	A0A0R6PIH8	Moraxella_phage	68.2	4.0e-09
WP_016245839.1|1217179_1217749_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	43.4	1.9e-38
WP_001247707.1|1217874_1218096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000460893.1|1218128_1218638_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	98.8	5.8e-87
WP_000956182.1|1218645_1218846_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	98.5	7.1e-33
WP_000963473.1|1218809_1219151_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	99.1	4.6e-56
WP_001244167.1|1219218_1219452_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	93.5	5.0e-30
WP_000752613.1|1219451_1219679_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	100.0	2.7e-36
WP_000196280.1|1219675_1219978_+	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	42.1	9.8e-10
WP_172480984.1|1219974_1220832_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	97.2	5.1e-160
WP_172480983.1|1220828_1223243_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.4	0.0e+00
WP_001154434.1|1223394_1223583_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217575.1|1223594_1223828_+	DinI family protein	NA	E5G6M1	Salmonella_phage	100.0	4.7e-36
WP_000094764.1|1224098_1224314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021556032.1|1224313_1225156_+	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.1	1.1e-58
WP_172480982.1|1225451_1226498_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	87.9	7.8e-171
WP_172480981.1|1226497_1228264_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.3	0.0e+00
WP_172480980.1|1228406_1229240_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	92.1	1.5e-121
WP_172480979.1|1229256_1230315_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.1	8.4e-181
WP_172480978.1|1230318_1230969_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	94.9	1.6e-110
WP_000673530.1|1231064_1231529_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	89.0	1.9e-76
WP_000868175.1|1231528_1231732_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|1231735_1231951_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_033817172.1|1231931_1232444_+	lysozyme	NA	E5G6N1	Salmonella_phage	91.7	9.0e-88
WP_000727851.1|1232445_1232823_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	3.9e-16
WP_172480977.1|1232819_1233248_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	75.9	2.4e-46
WP_172480976.1|1233343_1233775_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	93.0	4.9e-71
WP_053902632.1|1233767_1234214_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	85.6	3.0e-63
WP_172480975.1|1234282_1234861_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	84.9	3.4e-91
WP_000177580.1|1234857_1235217_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	87.4	3.2e-52
WP_172480974.1|1235203_1236112_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	89.7	3.0e-142
WP_172480973.1|1236104_1236710_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.0	2.0e-110
WP_172614250.1|1236706_1238107_+|tail	phage tail protein	tail	M1TAS6	Escherichia_phage	78.7	2.6e-153
WP_160527389.1|1238133_1238574_+|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	67.6	4.4e-51
WP_097408203.1|1238545_1239148_-|tail	tail fiber assembly protein	tail	M1SV83	Escherichia_phage	91.0	1.7e-98
WP_172614369.1|1239147_1239663_-|tail	tail fiber protein	tail	Q9MCR6	Enterobacteria_phage	69.5	6.7e-59
WP_020218818.1|1239693_1240260_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.3	1.4e-86
WP_172480966.1|1240402_1241575_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	90.8	1.2e-204
WP_038988793.1|1241584_1242100_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	95.3	1.6e-89
WP_172480967.1|1242154_1242457_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	88.0	3.1e-40
WP_000763312.1|1242471_1242591_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	87.2	1.1e-12
WP_172480968.1|1242583_1245661_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	64.0	0.0e+00
WP_000980391.1|1245657_1246143_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	81.2	1.7e-67
WP_172480969.1|1246139_1247240_+	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	86.9	2.9e-176
WP_000972391.1|1247330_1247549_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	69.0	7.5e-20
WP_001024876.1|1247783_1249469_-	aspartate:alanine antiporter	NA	NA	NA	NA	NA
WP_000681108.1|1249738_1250116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001195240.1|1250145_1250403_-	glutaredoxin 1	NA	A0A2I7SAE2	Vibrio_phage	61.9	8.6e-23
WP_159140869.1|1250562_1251555_+	oxygen-insensitive NADPH nitroreductase	NA	NA	NA	NA	NA
WP_000684321.1|1251615_1252518_+	30S ribosomal protein S6--L-glutamate ligase	NA	I3ULC9	Synechococcus_phage	34.4	2.6e-37
WP_000203025.1|1252605_1253082_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_000126072.1|1253432_1254545_+	spermidine/putrescine ABC transporter substrate-binding protein PotF	NA	NA	NA	NA	NA
WP_000996005.1|1254639_1255773_+	putrescine ABC transporter ATP-binding subunit PotG	NA	G3M9Y6	Bacillus_virus	34.0	1.4e-29
WP_000105430.1|1255782_1256736_+	putrescine ABC transporter permease PotH	NA	NA	NA	NA	NA
WP_001061658.1|1256732_1257578_+	putrescine ABC transporter permease PotI	NA	NA	NA	NA	NA
WP_000389260.1|1257637_1258126_+	YbjO family protein	NA	NA	NA	NA	NA
WP_001149682.1|1258166_1259294_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	27.3	1.0e-27
WP_001295339.1|1259492_1260224_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000464491.1|1260514_1261183_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_001001691.1|1261182_1261899_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_000756569.1|1261905_1262637_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000027205.1|1262654_1263383_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	6.0e-29
WP_001270734.1|1263600_1264116_-	lipoprotein	NA	NA	NA	NA	NA
WP_001160737.1|1264241_1264565_+	heavy metal-binding domain-containing protein	NA	NA	NA	NA	NA
WP_001252135.1|1264561_1265392_+	N-acetylmuramoyl-L-alanine amidase AmiD	NA	A0A1B0UZW5	Roseobacter_phage	30.0	5.7e-07
WP_001338420.1|1265388_1266402_-	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001136554.1|1266500_1267931_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000566376.1|1267941_1268943_-	low-specificity L-threonine aldolase	NA	NA	NA	NA	NA
WP_172614251.1|1268979_1270698_-	ubiquinone-dependent pyruvate dehydrogenase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	8.1e-32
WP_000178677.1|1270830_1271799_-	NADH oxidoreductase	NA	NA	NA	NA	NA
WP_000458809.1|1271810_1273463_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_000491142.1|1273606_1274506_-	L-lysine exporter LysO	NA	NA	NA	NA	NA
WP_001298299.1|1275000_1275696_-	aquaporin Z	NA	NA	NA	NA	NA
WP_000599802.1|1276121_1277780_+	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_001380339.1|1277776_1278733_-	DUF535 domain-containing protein	NA	NA	NA	NA	NA
WP_000746443.1|1278883_1279999_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_000188144.1|1279995_1281942_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_000410785.1|1282014_1282239_-	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_000520781.1|1282561_1282882_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|1282912_1285189_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|1285873_1286092_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|1286376_1287081_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_000543083.1|1287122_1288844_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.4	9.9e-22
WP_001043598.1|1288844_1290611_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_000537418.1|1290733_1291699_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	8.5e-63
WP_000228473.1|1292243_1292738_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000077038.1|1292872_1296862_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_001295343.1|1297020_1297632_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|1297642_1298986_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|1299076_1300369_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850303.1|1300607_1303052_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	6.6e-221
WP_000213098.1|1303062_1303680_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
1307392:1307407	attR	TGGCGATGGCGGTAAC	NA	NA	NA	NA
>prophage 105
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1309988	1313203	4726108		Tetraselmis_virus(100.0%)	2	NA	NA
WP_000111043.1|1309988_1310729_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001292822.1|1310920_1313203_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.0e-162
>prophage 106
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1317301	1318390	4726108		Streptococcus_phage(100.0%)	1	NA	NA
WP_000057138.1|1317301_1318390_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
>prophage 107
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1323476	1328018	4726108		Bacillus_phage(100.0%)	3	NA	NA
WP_000167336.1|1323476_1323761_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000705764.1|1323968_1326233_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|1326269_1328018_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
>prophage 108
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1342723	1353856	4726108	tRNA	Rhodobacter_phage(20.0%)	8	NA	NA
WP_001295932.1|1342723_1343272_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109486.1|1343298_1343946_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462691.1|1344167_1345358_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000977920.1|1345542_1346631_-	porin OmpF	NA	Q1MVN1	Enterobacteria_phage	54.3	1.8e-98
WP_000117881.1|1347232_1348633_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
WP_001297200.1|1348801_1350004_-	nicotinate phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000193859.1|1350269_1352882_+	aminopeptidase N	NA	A0A0P0IY26	Acinetobacter_phage	22.6	4.1e-19
WP_001090508.1|1353088_1353856_-	aliphatic sulfonates ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.0	5.7e-30
>prophage 109
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1369778	1371686	4726108		Tupanvirus(100.0%)	1	NA	NA
WP_000053089.1|1369778_1371686_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	29.7	1.4e-53
>prophage 110
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1384296	1386351	4726108		Bacillus_phage(100.0%)	1	NA	NA
WP_112877380.1|1384296_1386351_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	27.9	5.9e-21
>prophage 111
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1390584	1391244	4726108	protease	uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000375136.1|1390584_1391244_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	55.3	4.0e-48
>prophage 112
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1409354	1424025	4726108	transposase	Acinetobacter_phage(16.67%)	16	NA	NA
WP_085947598.1|1409354_1410516_+|transposase	IS3-like element IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	40.6	4.0e-51
WP_025650455.1|1410513_1410831_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000087763.1|1411272_1411485_-	cold shock-like protein CspH	NA	NA	NA	NA	NA
WP_000066490.1|1411770_1411983_+	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
WP_071528578.1|1411993_1412182_+	cold-shock protein	NA	NA	NA	NA	NA
WP_001315395.1|1412156_1412387_+	protein YmcE	NA	NA	NA	NA	NA
WP_001019197.1|1412376_1412550_+	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_000818479.1|1412597_1413671_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_071586436.1|1413742_1416487_-	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	31.9	7.8e-37
WP_025650454.1|1416569_1417598_+	TMAO reductase system periplasmic protein TorT	NA	NA	NA	NA	NA
WP_001120112.1|1417570_1418263_-	two-component system response regulator TorR	NA	W8CYM9	Bacillus_phage	28.0	4.5e-18
WP_001230242.1|1418392_1419565_+	pentaheme c-type cytochrome TorC	NA	NA	NA	NA	NA
WP_001062100.1|1419564_1422111_+	trimethylamine-N-oxide reductase TorA	NA	A0A077SK27	Escherichia_phage	29.3	1.0e-70
WP_000209869.1|1422107_1422707_+	molecular chaperone TorD	NA	NA	NA	NA	NA
WP_000024560.1|1422799_1423105_-	chaperone modulator CbpM	NA	NA	NA	NA	NA
WP_000420617.1|1423104_1424025_-	curved DNA-binding protein	NA	A0A1V0SIM1	Klosneuvirus	43.0	4.2e-11
>prophage 113
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1428330	1430430	4726108		Enterobacteria_phage(100.0%)	3	NA	NA
WP_001273658.1|1428330_1428504_+	general stress protein	NA	Q9KX95	Enterobacteria_phage	96.3	4.9e-06
WP_001240628.1|1428586_1429915_-	pyrimidine utilization transport protein G	NA	Q9KX94	Enterobacteria_phage	98.4	1.0e-231
WP_001028095.1|1429935_1430430_-	pyrimidine utilization flavin reductase protein F	NA	Q9KX93	Enterobacteria_phage	97.9	5.0e-51
>prophage 114
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1445542	1446331	4726108		Cronobacter_phage(100.0%)	1	NA	NA
WP_032161624.1|1445542_1446331_+	phosphate starvation-inducible protein PhoH	NA	R4II13	Cronobacter_phage	76.2	7.8e-91
>prophage 115
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1453147	1454515	4726108		Bacillus_phage(100.0%)	1	NA	NA
WP_025650440.1|1453147_1454515_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.3	1.3e-19
>prophage 116
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1458088	1458922	4726108		Pelagibacter_phage(100.0%)	1	NA	NA
WP_001189321.1|1458088_1458922_-	curli production assembly/transport protein CsgG	NA	M1ICK2	Pelagibacter_phage	40.1	5.1e-40
>prophage 117
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1463833	1464367	4726108		Red_sea_bream_iridovirus(100.0%)	1	NA	NA
WP_000857405.1|1463833_1464367_+	O-acetyl-ADP-ribose deacetylase	NA	Q71G61	Red_sea_bream_iridovirus	40.2	5.9e-26
>prophage 118
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1473675	1474596	4726108		Morganella_phage(100.0%)	1	NA	NA
WP_000183364.1|1473675_1474596_-	kdo(2)-lipid IV(A) lauroyltransferase	NA	A0A1W6JP29	Morganella_phage	41.5	8.6e-57
>prophage 119
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1479256	1479502	4726108		Salmonella_phage(100.0%)	1	NA	NA
WP_001217754.1|1479256_1479502_-	DNA damage-inducible protein I	NA	H6WRY5	Salmonella_phage	48.7	7.7e-13
>prophage 120
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1495385	1496327	4726108		Brevibacillus_phage(100.0%)	1	NA	NA
WP_001295441.1|1495385_1496327_+	flagellar assembly peptidoglycan hydrolase FlgJ	NA	S5M633	Brevibacillus_phage	31.3	3.6e-10
>prophage 121
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1508684	1509866	4726108		Trichoplusia_ni_ascovirus(50.0%)	2	NA	NA
WP_001008535.1|1508684_1509419_+	3-oxoacyl-ACP reductase FabG	NA	Q06VL0	Trichoplusia_ni_ascovirus	34.1	1.3e-15
WP_000103754.1|1509629_1509866_+	acyl carrier protein	NA	B2ZXV3	Ralstonia_phage	45.2	1.5e-10
>prophage 122
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1513138	1514781	4726108		Pseudomonas_phage(50.0%)	2	NA	NA
WP_001257000.1|1513138_1513780_+	dTMP kinase	NA	Q2Z0N0	Pseudomonas_phage	36.9	4.5e-28
WP_001267956.1|1513776_1514781_+	DNA polymerase III subunit delta'	NA	A0A1U9WR94	Streptococcus_virus	31.8	6.4e-05
>prophage 123
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1527087	1527345	4726108		Erwinia_phage(100.0%)	1	NA	NA
WP_000800153.1|1527087_1527345_+	multiple stress resistance protein BhsA	NA	A0A1B2IFR9	Erwinia_phage	37.1	9.6e-06
>prophage 124
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1534633	1538374	4726108		Planktothrix_phage(50.0%)	4	NA	NA
WP_001033694.1|1534633_1535335_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	40.3	1.1e-35
WP_001251348.1|1535334_1536579_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291270.1|1536607_1537519_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952737.1|1537534_1538374_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.7e-23
>prophage 125
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1541631	1543609	4726108		Mycoplasma_phage(100.0%)	2	NA	NA
WP_000799401.1|1541631_1542489_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|1542472_1543609_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
>prophage 126
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1548630	1550001	4726108		Bodo_saltans_virus(100.0%)	1	NA	NA
WP_000423742.1|1548630_1550001_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
>prophage 127
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1553137	1556870	4726108		Enterobacteria_phage(66.67%)	5	NA	NA
WP_000444488.1|1553137_1554388_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	96.3	3.2e-22
WP_001295666.1|1554490_1554814_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	65.4	3.0e-41
WP_123002225.1|1555350_1555461_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000373101.1|1555513_1555918_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332303.1|1556138_1556870_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	2.7e-53
>prophage 128
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1573576	1575264	4726108		Morganella_phage(50.0%)	2	NA	NA
WP_000897370.1|1573576_1573996_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.9	3.1e-38
WP_000457616.1|1573995_1575264_+	DNA polymerase V catalytic protein	NA	I6RSM4	Salmonella_phage	83.4	7.9e-210
>prophage 129
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1601933	1604685	4726108		uncultured_Caudovirales_phage(50.0%)	2	NA	NA
WP_001033352.1|1601933_1603613_-	C4-dicarboxylic acid transporter DauA	NA	A0A2H4J153	uncultured_Caudovirales_phage	23.6	1.3e-23
WP_001298109.1|1603737_1604685_-	ribose-phosphate diphosphokinase	NA	A0A2K9L2G2	Tupanvirus	37.8	3.9e-44
>prophage 130
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1607821	1616072	4726108	transposase	Pseudomonas_phage(25.0%)	10	NA	NA
WP_000804726.1|1607821_1608904_+	peptide chain release factor 1	NA	W8EDB3	Pseudomonas_phage	41.6	1.5e-07
WP_000456454.1|1608903_1609737_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000200378.1|1609733_1610126_+	SirB family protein	NA	NA	NA	NA	NA
WP_001257044.1|1610129_1610939_+	tetratricopeptide repeat-containing protein	NA	NA	NA	NA	NA
WP_000811065.1|1610974_1611829_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	39.0	8.3e-46
WP_000170957.1|1611977_1612085_-	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_085947770.1|1612281_1613651_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
WP_072127060.1|1613959_1614067_-	type I toxin-antitoxin system toxin Ldr family protein	NA	NA	NA	NA	NA
WP_001295620.1|1614471_1615572_-	sodium-potassium/proton antiporter ChaA	NA	NA	NA	NA	NA
WP_001146444.1|1615841_1616072_+	putative cation transport regulator ChaB	NA	A5IZT6	Spodoptera_litura_granulovirus	40.0	8.5e-06
>prophage 131
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1627327	1637691	4726108		Escherichia_phage(25.0%)	10	NA	NA
WP_000702660.1|1627327_1628866_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	40.8	6.3e-20
WP_000571699.1|1628862_1629573_+	nitrate reductase molybdenum cofactor assembly chaperone	NA	NA	NA	NA	NA
WP_001160110.1|1629572_1630250_+	respiratory nitrate reductase subunit gamma	NA	NA	NA	NA	NA
WP_000555849.1|1631328_1632171_-	formyltetrahydrofolate deformylase	NA	M4QRX9	Synechococcus_phage	47.6	1.1e-13
WP_001300748.1|1632220_1632679_-	YchJ family protein	NA	NA	NA	NA	NA
WP_001300664.1|1632791_1633697_+	patatin-like phospholipase RssA	NA	NA	NA	NA	NA
WP_000193447.1|1633788_1634802_+	two-component system response regulator RssB	NA	NA	NA	NA	NA
WP_074577251.1|1635003_1635912_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	46.8	1.8e-59
WP_001287378.1|1636055_1636469_-	DNA-binding transcriptional regulator H-NS	NA	NA	NA	NA	NA
WP_000068079.1|1637073_1637691_+	thymidine kinase	NA	A0A0A0YP64	Citrobacter_phage	53.6	1.3e-53
>prophage 132
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1646101	1648116	4726108		Planktothrix_phage(50.0%)	2	NA	NA
WP_000110954.1|1646101_1647115_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppD	NA	G9BWD6	Planktothrix_phage	31.7	2.0e-14
WP_000994905.1|1647111_1648116_+	murein tripeptide/oligopeptide ABC transporter ATP binding protein OppF	NA	G3M9Y6	Bacillus_virus	30.7	2.3e-15
>prophage 133
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1659774	1662732	4726108		Acinetobacter_phage(100.0%)	2	NA	NA
WP_000983871.1|1659774_1661136_-	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	4.3e-36
WP_000763511.1|1661136_1662732_-	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	3.8e-52
>prophage 134
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1669701	1674993	4726108	protease	Chrysochromulina_ericina_virus(33.33%)	4	NA	NA
WP_000559286.1|1669701_1670460_-	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.9	4.4e-06
WP_000422045.1|1670679_1671729_+|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_001031530.1|1671764_1672016_-	YciN family protein	NA	NA	NA	NA	NA
WP_001297122.1|1672395_1674993_+	type I DNA topoisomerase	NA	A0A2K9L1Q2	Tupanvirus	34.7	1.7e-86
>prophage 135
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1679917	1680508	4726108		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001176295.1|1679917_1680508_-	GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.9	7.7e-43
>prophage 136
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1688325	1693982	4726108		Lactococcus_phage(50.0%)	5	NA	NA
WP_000484984.1|1688325_1690260_-	exoribonuclease II	NA	Q0GXV6	Lactococcus_phage	27.9	3.1e-32
WP_001335988.1|1690327_1691455_-	CMD domain-containing protein	NA	NA	NA	NA	NA
WP_000506490.1|1691598_1692387_-	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_000565727.1|1692754_1693108_-	DUF559 domain-containing protein	NA	NA	NA	NA	NA
WP_000573407.1|1693175_1693982_-	peptide ABC transporter ATP-binding protein SapF	NA	G3M9Y6	Bacillus_virus	28.6	7.2e-15
>prophage 137
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1706897	1708163	4726108		Klosneuvirus(100.0%)	1	NA	NA
WP_172614259.1|1706897_1708163_+	4-aminobutyrate transaminase	NA	A0A1V0SKB7	Klosneuvirus	26.8	1.7e-23
>prophage 138
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1722167	1723250	4726108		Indivirus(100.0%)	1	NA	NA
WP_000057955.1|1722167_1723250_+	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.4	4.0e-13
>prophage 139
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1739869	1740385	4726108		Streptococcus_phage(100.0%)	1	NA	NA
WP_000945011.1|1739869_1740385_-	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	42.8	1.1e-24
>prophage 140
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1746711	1753982	4726108	tRNA	Bacillus_phage(20.0%)	6	NA	NA
WP_000628058.1|1746711_1747944_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
WP_000387388.1|1748198_1749182_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123737.1|1749659_1751033_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000081417.1|1751161_1752097_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	97.7	1.1e-144
WP_001300461.1|1752273_1752708_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.8e-28
WP_000837921.1|1752848_1753982_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.5	1.1e-117
>prophage 141
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1758942	1759932	4726108		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000762236.1|1758942_1759932_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	1.5e-70
>prophage 142
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1797590	1801493	4726108		Klosneuvirus(100.0%)	1	NA	NA
WP_000139543.1|1797590_1801493_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
>prophage 143
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1804945	1805894	4726108		Escherichia_phage(50.0%)	2	NA	NA
WP_000428998.1|1804945_1805476_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	44.9	3.1e-19
WP_000731833.1|1805720_1805894_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
>prophage 144
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1817700	1827874	4726108	transposase	Escherichia_phage(20.0%)	10	NA	NA
WP_000826416.1|1817700_1818909_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SL42	Escherichia_phage	93.0	1.7e-206
WP_001326689.1|1818948_1820163_-	BenE family transporter YdcO	NA	NA	NA	NA	NA
WP_000429155.1|1820215_1820752_+	DNA-binding transcriptional regulator SutR	NA	NA	NA	NA	NA
WP_001303492.1|1820824_1822786_+	23S rRNA 5-hydroxycytidine C2501 synthase	NA	Q6DW11	Phage_TP	28.3	3.5e-23
WP_000494244.1|1822877_1823108_-	YncJ family protein	NA	NA	NA	NA	NA
WP_000813794.1|1823329_1823506_+	type II toxin-antitoxin system mRNA interferase toxin HicA	NA	A0A0M3LQ86	Mannheimia_phage	57.9	3.6e-12
WP_001270286.1|1823551_1823968_+	type II toxin-antitoxin system antitoxin HicB	NA	F1C593	Cronobacter_phage	57.8	6.3e-31
WP_000760626.1|1824046_1825453_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_000047424.1|1825697_1826843_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000220396.1|1826860_1827874_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	37.9	2.1e-27
>prophage 145
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1835006	1837109	4726108		Salmonella_phage(100.0%)	1	NA	NA
WP_000689363.1|1835006_1837109_-	TonB-dependent receptor	NA	A0A1B0VCF0	Salmonella_phage	65.3	5.3e-134
>prophage 146
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1842015	1848065	4726108	transposase	Ralstonia_phage(50.0%)	3	NA	NA
WP_172614261.1|1842015_1844124_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	26.0	5.6e-27
WP_042405549.1|1844575_1846375_+	RHS repeat protein	NA	NA	NA	NA	NA
WP_032494872.1|1847096_1848065_-|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	96.0	2.5e-179
>prophage 147
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1852128	1853673	4726108		Escherichia_phage(100.0%)	1	NA	NA
WP_000702535.1|1852128_1853673_-	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	39.2	6.4e-20
>prophage 148
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1860557	1860848	4726108		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000768384.1|1860557_1860848_-	lipoprotein	NA	Q1MVN1	Enterobacteria_phage	65.1	2.1e-25
>prophage 149
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1867039	1868480	4726108		Escherichia_phage(50.0%)	2	NA	NA
WP_000781370.1|1867039_1867324_-	HigA family addiction module antidote protein	NA	A0A2L1IV52	Escherichia_phage	51.1	1.2e-20
WP_000642433.1|1867469_1868480_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	25.3	9.6e-25
>prophage 150
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1871753	1873659	4726108		Planktothrix_phage(100.0%)	2	NA	NA
WP_001285536.1|1871753_1872680_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.6	4.1e-14
WP_172614263.1|1872672_1873659_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.7	1.4e-17
>prophage 151
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1877975	1881764	4726108		Klosneuvirus(50.0%)	2	NA	NA
WP_172614264.1|1877975_1880357_-	oxygen-sensing cyclic-di-GMP phosphodiesterase	NA	A0A1V0SL97	Klosneuvirus	22.0	1.6e-09
WP_000426292.1|1880381_1881764_-	diguanylate cyclase DosC	NA	G3MA91	Bacillus_virus	31.5	2.0e-17
>prophage 152
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1908073	1909609	4726108		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001194860.1|1908073_1909609_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	23.6	7.2e-16
>prophage 153
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1926250	1926634	4726108		Streptococcus_phage(100.0%)	1	NA	NA
WP_000091199.1|1926250_1926634_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
>prophage 154
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1929636	1930527	4726108		Bacillus_phage(100.0%)	1	NA	NA
WP_000592814.1|1929636_1930527_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.7	8.2e-20
>prophage 155
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1936562	1956308	4726108	tail	Escherichia_phage(30.77%)	20	NA	NA
WP_000214712.1|1936562_1936766_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527809.1|1936800_1938261_-	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.6	1.5e-42
WP_000347482.1|1938349_1939633_-	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_120795384.1|1940236_1940350_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|1940418_1940652_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086522.1|1940968_1941559_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	39.3	1.5e-25
WP_000885600.1|1941656_1942232_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	96.9	1.8e-105
WP_001360138.1|1943915_1944026_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836066.1|1944083_1945103_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001295394.1|1945114_1946329_-	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000598292.1|1946534_1946861_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_000705211.1|1946995_1947337_+	DUF1283 family protein	NA	NA	NA	NA	NA
WP_001138581.1|1947371_1947932_+	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_001321287.1|1947934_1948645_-	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001300836.1|1948752_1949058_+	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_000041675.1|1949256_1951683_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.2	7.7e-214
WP_001340362.1|1951743_1954167_+	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	48.6	1.7e-208
WP_000213028.1|1954177_1954795_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	59.6	9.5e-76
WP_000526503.1|1954796_1955651_+	dimethyl sulfoxide reductase anchor subunit	NA	NA	NA	NA	NA
WP_000148710.1|1955693_1956308_+	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	36.3	8.7e-29
>prophage 156
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1974069	1975371	4726108		Bacillus_phage(100.0%)	1	NA	NA
WP_000732512.1|1974069_1975371_+	two-component system sensor histidine kinase RstB	NA	W8CYF6	Bacillus_phage	24.2	3.2e-17
>prophage 157
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	1985447	1987259	4726108		Vaccinia_virus(100.0%)	1	NA	NA
WP_000945878.1|1985447_1987259_-	beta-glucuronidase	NA	B9U1V4	Vaccinia_virus	100.0	0.0e+00
>prophage 158
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2007135	2008410	4726108	tRNA	Cronobacter_phage(100.0%)	1	NA	NA
WP_001295400.1|2007135_2008410_-|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	41.4	8.8e-84
>prophage 159
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2015321	2016820	4726108		Salmonella_phage(50.0%)	2	NA	NA
WP_001296937.1|2015321_2015843_-	superoxide dismutase [Cu-Zn] SodC2	NA	Q9MC02	Salmonella_phage	55.7	7.8e-47
WP_000250656.1|2015923_2016820_-	aldo/keto reductase family oxidoreductase	NA	A0A1V0SDE7	Indivirus	30.8	4.7e-07
>prophage 160
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2025622	2034503	4726108		Streptomyces_phage(20.0%)	9	NA	NA
WP_000101193.1|2025622_2026438_+	peptidoglycan DD-endopeptidase MepH	NA	A0A2H5BM69	Streptomyces_phage	42.7	1.7e-19
WP_000007283.1|2026565_2027147_+	superoxide dismutase [Fe]	NA	Q56AR7	Bacillus_thuringiensis_phage	46.0	2.6e-43
WP_000701040.1|2027381_2028551_-	MFS transporter	NA	NA	NA	NA	NA
WP_000102278.1|2028716_2028806_-	stress response protein YnhF	NA	NA	NA	NA	NA
WP_000190982.1|2029104_2030130_+	HTH-type transcriptional repressor PurR	NA	C6ZCU4	Enterobacteria_phage	31.6	3.7e-32
WP_000269501.1|2030126_2031059_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001182363.1|2031171_2032383_+	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_000098896.1|2032673_2033822_+	cyclopropane fatty acyl phospholipid synthase	NA	A0A2K9L4K8	Tupanvirus	45.4	9.3e-85
WP_000493947.1|2033861_2034503_-	riboflavin synthase	NA	A0A2I2L4R9	Orpheovirus	35.2	7.4e-23
>prophage 161
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2040007	2042274	4726108		Edwardsiella_phage(50.0%)	3	NA	NA
WP_000587525.1|2040007_2040820_-	hypothetical protein	NA	A0A077K9W7	Edwardsiella_phage	35.9	5.0e-08
WP_064669391.1|2040823_2041609_-	thiosulfate reductase cytochrome B subunit	NA	NA	NA	NA	NA
WP_001310861.1|2041605_2042274_-	4Fe-4S dicluster domain-containing protein	NA	A0A077SL61	Escherichia_phage	37.2	1.0e-22
>prophage 162
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2050563	2055647	4726108		environmental_halophage(33.33%)	5	NA	NA
WP_000577988.1|2050563_2051784_-	cysteine desulfurase SufS	NA	Q2XUY6	environmental_halophage	41.4	4.4e-93
WP_000907979.1|2051780_2053052_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000948863.1|2053026_2053773_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	24.0	3.9e-07
WP_000089364.1|2053782_2055270_-	Fe-S cluster assembly protein SufB	NA	NA	NA	NA	NA
WP_000367160.1|2055278_2055647_-	Fe-S cluster assembly scaffold SufA	NA	A0A2H4N7N5	Lake_Baikal_phage	39.4	4.3e-15
>prophage 163
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2074291	2093831	4726108	tRNA	Tupanvirus(22.22%)	19	NA	NA
WP_089537623.1|2074291_2075938_+	medium-chain fatty-acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.1	8.5e-31
WP_000069375.1|2075994_2078373_-	phosphoenolpyruvate synthase	NA	A0A1V0SGR7	Hokovirus	36.7	9.4e-172
WP_000368046.1|2078705_2079539_+	posphoenolpyruvate synthetase regulatory kinase/phosphorylase PpsR	NA	NA	NA	NA	NA
WP_001082229.1|2079695_2080742_+	3-deoxy-7-phosphoheptulonate synthase AroH	NA	S4W5F1	Pandoravirus	47.7	3.2e-84
WP_001270809.1|2080873_2081065_+	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_000175703.1|2081068_2082505_-	YdiU family protein	NA	NA	NA	NA	NA
WP_172614272.1|2082567_2083281_-	anti-FlhDC factor	NA	NA	NA	NA	NA
WP_001209795.1|2083527_2083992_-	endopeptidase	NA	S5MM68	Bacillus_phage	36.9	2.1e-11
WP_096943808.1|2084069_2084819_-	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.6	2.7e-08
WP_001154168.1|2084818_2085370_-	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000956528.1|2085432_2086413_-	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_001229265.1|2086513_2086813_-	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_000672380.1|2086817_2089205_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_000018596.1|2089219_2090203_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.4e-33
WP_001386830.1|2090486_2090531_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2090653_2091010_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2091062_2091260_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2091356_2091899_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|2091902_2093831_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
>prophage 164
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2105127	2107389	4726108		Tupanvirus(100.0%)	1	NA	NA
WP_000077873.1|2105127_2107389_+	catalase HPII	NA	A0A2K9L572	Tupanvirus	48.5	1.3e-143
>prophage 165
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2113718	2114546	4726108		Bacillus_virus(100.0%)	1	NA	NA
WP_000175026.1|2113718_2114546_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	54.9	1.7e-72
>prophage 166
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2122022	2123243	4726108		Klosneuvirus(100.0%)	1	NA	NA
WP_000081983.1|2122022_2123243_-	succinylornithine/acetylornithine transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.1	5.5e-27
>prophage 167
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2130007	2130661	4726108		Bacillus_phage(100.0%)	1	NA	NA
WP_172614275.1|2130007_2130661_+	ATP-binding cassette domain-containing protein	NA	W8CYL7	Bacillus_phage	31.0	5.1e-11
>prophage 168
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2136259	2138221	4726108		Streptococcus_phage(100.0%)	1	NA	NA
WP_001235800.1|2136259_2138221_-	DNA topoisomerase III	NA	A0A1X9I6W8	Streptococcus_phage	29.2	3.2e-40
>prophage 169
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2143147	2147232	4726108		Tupanvirus(50.0%)	4	NA	NA
WP_001135066.1|2143147_2143789_+	bifunctional pyrazinamidase/nicotinamidase	NA	A0A2K9L2K0	Tupanvirus	34.9	2.2e-19
WP_172614276.1|2143881_2145240_-	MFS transporter	NA	NA	NA	NA	NA
WP_000719096.1|2145356_2146115_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000723710.1|2146251_2147232_-	NADH-dependent methylglyoxal reductase	NA	A0A2H4PQR8	Staphylococcus_phage	21.5	2.3e-07
>prophage 170
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2160215	2164792	4726108		Bacillus_phage(100.0%)	3	NA	NA
WP_000219687.1|2160215_2161499_+	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	36.3	7.6e-11
WP_000616433.1|2161645_2163121_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_000766132.1|2163301_2164792_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	30.6	6.4e-09
>prophage 171
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2179320	2187426	4726108	tRNA	Staphylococcus_phage(33.33%)	8	NA	NA
WP_000758422.1|2179320_2181006_-	long-chain-fatty-acid--CoA ligase FadD	NA	A0A2H4PQM9	Staphylococcus_phage	26.0	1.5e-35
WP_000290563.1|2181210_2181792_-	Slp family lipoprotein YeaY	NA	NA	NA	NA	NA
WP_001220966.1|2181831_2182527_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_000128847.1|2182584_2184495_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	31.9	4.5e-92
WP_001295493.1|2184626_2184971_+	RidA family protein	NA	NA	NA	NA	NA
WP_001307845.1|2185332_2185692_+	DUF1889 family protein	NA	NA	NA	NA	NA
WP_000457334.1|2185811_2185991_-	YoaH family protein	NA	NA	NA	NA	NA
WP_000855022.1|2186064_2187426_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.4	2.0e-41
>prophage 172
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2191288	2192845	4726108		Moraxella_phage(100.0%)	1	NA	NA
WP_000394983.1|2191288_2192845_-	CNNM family cation transport protein YoaE	NA	A0A0R6PEZ3	Moraxella_phage	45.4	1.7e-41
>prophage 173
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2198485	2198695	4726108		Morganella_phage(100.0%)	1	NA	NA
WP_001062678.1|2198485_2198695_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	78.1	1.6e-22
>prophage 174
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2204027	2206076	4726108		Moraxella_phage(100.0%)	1	NA	NA
WP_001055791.1|2204027_2206076_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
>prophage 175
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2213572	2218042	4726108		Escherichia_phage(33.33%)	7	NA	NA
WP_000812724.1|2213572_2214229_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	50.2	3.1e-56
WP_000976476.1|2214624_2214966_-	YebY family protein	NA	NA	NA	NA	NA
WP_000879289.1|2214978_2215851_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|2215854_2216229_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|2216367_2216598_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_000011658.1|2216699_2217356_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|2217379_2218042_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
>prophage 176
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2226098	2227574	4726108		Cyanophage(100.0%)	1	NA	NA
WP_000301727.1|2226098_2227574_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
>prophage 177
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2231572	2238636	4726108		Bacillus_virus(50.0%)	9	NA	NA
WP_001184045.1|2231572_2232895_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_001300644.1|2232910_2233843_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|2233921_2234677_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571480.1|2234673_2235459_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568519.1|2235605_2236616_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|2236624_2237236_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010723105.1|2237374_2237440_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024932.1|2237510_2238113_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001295503.1|2238114_2238636_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
>prophage 178
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2242654	2244705	4726108		Escherichia_coli_phage(50.0%)	3	NA	NA
WP_000639274.1|2242654_2243473_+	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	99.2	6.5e-72
WP_000252980.1|2243525_2243921_+	MAPEG family protein	NA	NA	NA	NA	NA
WP_000019590.1|2243961_2244705_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	3.5e-24
>prophage 179
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2251321	2253055	4726108	tRNA	Tupanvirus(100.0%)	1	NA	NA
WP_001025322.1|2251321_2253055_+|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	3.4e-86
>prophage 180
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2258307	2263951	4726108		uncultured_Caudovirales_phage(50.0%)	5	NA	NA
WP_000763867.1|2258307_2258697_-	chemotaxis protein CheY	NA	A0A2K9L4R0	Tupanvirus	32.0	1.3e-06
WP_000036371.1|2258711_2259761_-	protein-glutamate methylesterase/protein glutamine deamidase	NA	Q56AR1	Bacillus_thuringiensis_phage	32.8	1.0e-05
WP_000204342.1|2259763_2260624_-	protein-glutamate O-methyltransferase CheR	NA	NA	NA	NA	NA
WP_172614279.1|2260642_2262244_-	methyl-accepting chemotaxis protein IV	NA	A0A2H4J162	uncultured_Caudovirales_phage	29.7	8.3e-15
WP_001297437.1|2262289_2263951_-	methyl-accepting chemotaxis protein II	NA	A0A2H4J162	uncultured_Caudovirales_phage	40.3	1.7e-10
>prophage 181
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2274033	2275548	4726108		Cedratvirus(100.0%)	1	NA	NA
WP_001187819.1|2274033_2275548_-	arabinose ABC transporter ATP binding protein AraG	NA	A0A285PWH2	Cedratvirus	29.7	1.3e-12
>prophage 182
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2293680	2296965	4726108		Liberibacter_phage(100.0%)	1	NA	NA
WP_172614283.1|2293680_2296965_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	27.2	1.2e-65
>prophage 183
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2310483	2311236	4726108		Bacillus_virus(100.0%)	1	NA	NA
WP_001272994.1|2310483_2311236_-	L-cystine ABC transporter ATP-binding protein YecC	NA	G3M9Y6	Bacillus_virus	34.9	3.8e-26
>prophage 184
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2323455	2324127	4726108		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001543845.1|2323455_2324127_+	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	61.3	1.6e-81
>prophage 185
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2339311	2351745	4726108		Bacillus_phage(33.33%)	12	NA	NA
WP_001515472.1|2339311_2341006_-	cellulose biosynthesis regulator YedQ	NA	A0A127AWB9	Bacillus_phage	35.6	1.3e-18
WP_000009306.1|2341243_2341426_-	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_000922683.1|2341504_2342422_-	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_001212226.1|2342594_2343515_+	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_172614286.1|2343503_2343974_-	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	47.6	4.4e-33
WP_001543850.1|2343954_2345373_-	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	54.8	3.0e-101
WP_001543851.1|2345439_2346135_-	phosphohydrolase	NA	A0A1D6Y7U0	Golden_Marseillevirus	28.0	2.8e-07
WP_001313057.1|2346174_2346540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000824370.1|2347106_2348165_+	porin	NA	Q1MVN1	Enterobacteria_phage	49.3	1.1e-92
WP_001543852.1|2348756_2349608_+	protein deglycase HchA	NA	NA	NA	NA	NA
WP_001543853.1|2349715_2351074_-	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_001339045.1|2351073_2351745_-	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
>prophage 186
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2356067	2393505	4726108	integrase,transposase	Pseudomonas_phage(37.5%)	20	2386682:2386741	2394468:2395236
WP_016242218.1|2356067_2356598_+	cytochrome b	NA	A0A0U2QLA7	Escherichia_phage	100.0	1.9e-56
WP_064669684.1|2357350_2358148_+	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000055683.1|2358485_2359016_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.7	1.4e-30
WP_001292569.1|2359109_2359748_+|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	42.3	1.1e-29
WP_087897290.1|2361055_2361940_-|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_152921844.1|2362163_2362313_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172614287.1|2363817_2368008_+	RHS repeat protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	42.5	8.3e-22
WP_000036081.1|2367995_2368388_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139371347.1|2368606_2369820_-|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.7	4.9e-169
WP_001352025.1|2374170_2375679_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.7	8.1e-44
WP_077252679.1|2379483_2380983_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_097308484.1|2381244_2382297_-	glycosyltransferase family 9 protein	NA	NA	NA	NA	NA
WP_004016396.1|2382611_2383928_+	shikimate transporter	NA	NA	NA	NA	NA
WP_001060244.1|2384029_2385484_+	AMP nucleosidase	NA	NA	NA	NA	NA
WP_000532912.1|2385826_2386543_+	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
2386682:2386741	attL	GGGTAATGACTCCAACTTATTGATAGTGTTTTATGTTCAGATAATGCCCGATGACTTTGT	NA	NA	NA	NA
WP_123002232.1|2387948_2389592_-	toxic metabolite efflux MATE transporter YeeO	NA	NA	NA	NA	NA
WP_001011041.1|2389709_2390660_-	HTH-type transcriptional regulator Cbl	NA	NA	NA	NA	NA
WP_001011466.1|2390761_2391679_-	nitrogen assimilation transcriptional regulator	NA	NA	NA	NA	NA
WP_000055683.1|2392242_2392773_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	42.7	1.4e-30
WP_001292569.1|2392866_2393505_+|integrase	site-specific integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	42.3	1.1e-29
2394468:2395236	attR	ACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACCCGGAATGCTTACACAGACCGACAAACCAGACGTTTTGAATGTCAAAATCCGTTACGGTTGATATTCACAGGCATTCCCGATCGACGTTGCAACGCAGCATTTGCGCGATTCACATCAACTTCTTGCCCGTTGATAAACGCCCGCAAAGATGGGGTTACCGGCAATGGCACTTTTCGGTCAGACTCATATTCTGCACGATTGCGCGACAACGGCTCATGAACTTCCAGCCAGTTCGAGCCATCTGGTTCAGTGGTGTATTTTACTGGCTGGTCGATAATTTGCACACGCGTCCCAACAGGAACATTATCAAACAGATATTTGATATCGTCATTGCGCAGACGAATACAGCCCTGACTTACCCGAAGTCCAATACCAAAATTGGCATTGGTACCGTGGATGGCATACAACCTGCCAATATAAATCGCGTACAGCCCCATGGGATTATCGGGCCCCGCAGGAACAAATGCGGGCAAACTCTCCCCTCGTTTCGCATATTCGCGCCGAGTGTTCGGCGTTGGCGTCCAGGTTGGAGCTTCTTGTTTACGTTCAACGGTAGTCACCCAGTTACGCGGGGTTTCTCGCCCAGCCTGGCCGATACCAATAGGAAAGACTTCCACAGTATTACTGTCTGGTGGATAGTAATAAAGACGCATCTCAGCGACGTTAACCACAATCCCTTTACGAACAGTGGCGGGCAAAATCAGTTGCTG	NA	NA	NA	NA
>prophage 187
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2400101	2400911	4726108		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_063085160.1|2400101_2400911_-	propanediol diffusion facilitator PduF	NA	A0A1J0F964	Only_Syngen_Nebraska_virus	26.7	4.1e-10
>prophage 188
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2418404	2419571	4726108		Stx2-converting_phage(100.0%)	1	NA	NA
WP_000830155.1|2418404_2419571_-	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	99.0	6.5e-227
>prophage 189
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2427215	2428115	4726108		Cellulophaga_phage(100.0%)	1	NA	NA
WP_000131782.1|2427215_2428115_+	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	94.7	1.8e-11
>prophage 190
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2435468	2440632	4726108		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000704860.1|2435468_2436635_-	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	52.2	1.7e-110
WP_000043433.1|2436882_2438289_-	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
WP_071790938.1|2438631_2438940_-	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_001400313.1|2439245_2439569_-	family 1 glycosylhydrolase	NA	NA	NA	NA	NA
WP_000676072.1|2439759_2440632_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	68.1	1.1e-112
>prophage 191
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2446397	2455437	4726108		Enterobacteria_phage(33.33%)	8	NA	NA
WP_001100944.1|2446397_2446937_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.5	8.3e-52
WP_001435027.1|2447017_2448904_-	polysaccharide biosynthesis protein	NA	L7Y3T9	Megavirus	26.6	1.4e-21
WP_000342233.1|2448942_2449503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000966114.1|2449503_2450538_-	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_000866950.1|2450537_2451482_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1D7XFE8	Escherichia_phage	29.1	3.2e-06
WP_000699395.1|2451535_2452618_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	9.7e-100
WP_000183068.1|2452971_2453868_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_001116058.1|2454042_2455437_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.3	5.7e-20
>prophage 192
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2461026	2467820	4726108		Bacillus_phage(25.0%)	6	NA	NA
WP_172614292.1|2461026_2462397_-	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.7	2.2e-32
WP_000079285.1|2462589_2464026_-	mannose-1-phosphate guanyltransferase	NA	A0A1V0SH58	Hokovirus	29.2	1.3e-46
WP_000699721.1|2464028_2465252_-	colanic acid biosynthesis fucosyltransferase WcaI	NA	NA	NA	NA	NA
WP_000479838.1|2465248_2465728_-	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_172614293.1|2465730_2466696_-	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	7.6e-88
WP_000048190.1|2466698_2467820_-	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	64.9	1.5e-132
>prophage 193
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2472064	2482455	4726108		uncultured_marine_virus(20.0%)	9	NA	NA
WP_000654503.1|2472064_2472904_-	colanic acid biosynthesis glycosyltransferase WcaA	NA	A0A0F7L2F7	uncultured_marine_virus	34.8	9.7e-07
WP_000137111.1|2472996_2475159_-	tyrosine-protein kinase Wzc	NA	A0A1X9I5D6	Streptococcus_phage	30.3	2.4e-17
WP_000482901.1|2475161_2475605_-	low molecular weight protein-tyrosine-phosphatase Wzb	NA	NA	NA	NA	NA
WP_000978094.1|2475610_2476750_-	polysaccharide export protein Wza	NA	NA	NA	NA	NA
WP_162829205.1|2477058_2477208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001300971.1|2477408_2478992_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	42.6	7.2e-35
WP_001570053.1|2479265_2481119_-	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_001234767.1|2481140_2481722_-	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	42.1	1.3e-31
WP_001295424.1|2481813_2482455_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	36.9	3.2e-34
>prophage 194
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2487119	2488472	4726108		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_000469735.1|2487119_2488472_+	molecular chaperone	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	20.6	4.6e-06
>prophage 195
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2502320	2509185	4726108	tRNA	Bacillus_phage(50.0%)	8	NA	NA
WP_000675150.1|2502320_2503724_+	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	29.0	3.0e-32
WP_000137874.1|2503720_2504443_+	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	32.7	1.2e-29
WP_000929408.1|2504633_2504966_+	YegP family protein	NA	NA	NA	NA	NA
WP_001307279.1|2505174_2505471_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_001220181.1|2505472_2505769_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000476011.1|2505871_2507233_+|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	100.0	1.1e-217
WP_001295425.1|2507562_2507880_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172614295.1|2508285_2509185_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	28.6	8.3e-12
>prophage 196
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2518404	2521961	4726108		Serratia_phage(50.0%)	4	NA	NA
WP_000846217.1|2518404_2519409_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000011976.1|2519405_2520371_+	sugar kinase	NA	NA	NA	NA	NA
WP_000434038.1|2520344_2521091_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001372396.1|2521142_2521961_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.9	1.0e-24
>prophage 197
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2532647	2534681	4726108	tRNA	Indivirus(100.0%)	1	NA	NA
WP_001340530.1|2532647_2534681_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
>prophage 198
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2550244	2559688	4726108		Enterobacteria_phage(85.71%)	10	NA	NA
WP_172614297.1|2550244_2551381_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	1.6e-161
WP_001326543.1|2551377_2553381_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	97.2	0.0e+00
WP_001295429.1|2553505_2553967_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2554007_2554478_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2554524_2555244_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295431.1|2555240_2556926_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_106422465.1|2557147_2557927_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	87.0	3.0e-87
WP_001216963.1|2557937_2558045_+	protein YohO	NA	NA	NA	NA	NA
WP_000783120.1|2558025_2558757_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569318.1|2558761_2559688_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.8e-23
>prophage 199
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2580109	2581630	4726108		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000255039.1|2580109_2581630_-	galactose/methyl galactoside ABC transporter ATP-binding protein MglA	NA	F2Y2R6	Organic_Lake_phycodnavirus	33.0	2.6e-10
>prophage 200
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2585324	2589110	4726108		Cellulophaga_phage(50.0%)	3	NA	NA
WP_001139613.1|2585324_2585993_-	GTP cyclohydrolase I FolE	NA	M1Q6X8	Cellulophaga_phage	56.3	9.0e-56
WP_000425438.1|2586250_2587087_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_054627101.1|2587118_2589110_-	catecholate siderophore receptor CirA	NA	A0A0P0I887	Acinetobacter_phage	36.6	2.0e-13
>prophage 201
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2593180	2594038	4726108		Catovirus(100.0%)	1	NA	NA
WP_172614298.1|2593180_2594038_+	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	34.0	1.4e-24
>prophage 202
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2608566	2612867	4726108		Ostreococcus_tauri_virus(50.0%)	4	NA	NA
WP_135961342.1|2608566_2610033_+	mannitol dehydrogenase family protein	NA	H8ZJP8	Ostreococcus_tauri_virus	29.2	3.0e-43
WP_094322321.1|2610150_2611137_+	zinc-binding GTPase YeiR	NA	NA	NA	NA	NA
WP_000594599.1|2611175_2611889_+	Kdo(2)-lipid A phosphotransferase	NA	NA	NA	NA	NA
WP_172614300.1|2612300_2612867_+	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A1V0DZX6	Clostridioides_phage	40.7	4.2e-14
>prophage 203
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2618621	2626269	4726108		Vibrio_phage(50.0%)	7	NA	NA
WP_000194927.1|2618621_2620211_+	microcin C ABC transporter ATP-binding protein YejF	NA	G9BWD6	Planktothrix_phage	34.0	1.1e-19
WP_094338183.1|2620214_2620559_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000213361.1|2620891_2622082_-	multidrug efflux MFS transporter Bcr	NA	S4TR35	Salmonella_phage	23.7	2.2e-20
WP_001234850.1|2622109_2622805_-	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_000578079.1|2622953_2624714_+	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.8	3.2e-100
WP_000494183.1|2624838_2625123_+	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_000050793.1|2625261_2626269_-	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	48.6	4.1e-84
>prophage 204
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2638143	2638761	4726108		Bacillus_virus(100.0%)	1	NA	NA
WP_000888560.1|2638143_2638761_-	cytochrome c biogenesis heme-transporting ATPase CcmA	NA	G3M9Y6	Bacillus_virus	25.5	1.9e-12
>prophage 205
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2647868	2653646	4726108		Bacillus_phage(25.0%)	5	NA	NA
WP_172614301.1|2647868_2649512_-	microcin J25 efflux ABC transporter YojI	NA	W8CYL7	Bacillus_phage	24.0	2.1e-13
WP_000884971.1|2649587_2650238_-	DNA oxidative demethylase AlkB	NA	A0A2K9L3R7	Tupanvirus	33.0	8.3e-06
WP_172614302.1|2650237_2651302_-	bifunctional DNA-binding transcriptional regulator/O6-methylguanine-DNA methyltransferase Ada	NA	A0A0G2Y1B6	Acanthamoeba_polyphaga_mimivirus	49.5	1.2e-17
WP_000406064.1|2651375_2652431_-	FAD:protein FMN transferase ApbE	NA	NA	NA	NA	NA
WP_000865568.1|2652542_2653646_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	59.3	5.2e-117
>prophage 206
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2657923	2662766	4726108		Hokovirus(50.0%)	2	NA	NA
WP_000876011.1|2657923_2660773_-	two-component system sensor histidine kinase RcsC	NA	A0A1V0SGX0	Hokovirus	27.2	1.4e-41
WP_000559125.1|2660939_2662766_+	two-component system sensor histidine kinase AtoS	NA	W8CYF6	Bacillus_phage	27.3	1.5e-20
>prophage 207
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2682967	2685595	4726108		Bacillus_virus(100.0%)	1	NA	NA
WP_001281242.1|2682967_2685595_-	DNA topoisomerase (ATP-hydrolyzing) subunit A	NA	G3M9Z5	Bacillus_virus	30.4	8.1e-92
>prophage 208
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2691039	2697186	4726108		Pseudomonas_phage(50.0%)	5	NA	NA
WP_001075164.1|2691039_2693325_+	ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2D1GNB1	Pseudoalteromonas_phage	63.6	2.5e-283
WP_000332037.1|2693558_2694689_+	ribonucleotide-diphosphate reductase subunit beta	NA	G9IAA3	Pseudomonas_phage	79.1	1.5e-175
WP_000135040.1|2694688_2694943_+	ferredoxin-like diferric-tyrosyl radical cofactor maintenance protein YfaE	NA	G9IAA2	Pseudomonas_phage	73.1	2.6e-24
WP_000301050.1|2694996_2695647_-	lipopolysaccharide kinase InaA	NA	NA	NA	NA	NA
WP_000779105.1|2696109_2697186_-	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	46.0	3.0e-08
>prophage 209
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2703078	2707589	4726108	transposase	Sodalis_phage(50.0%)	5	NA	NA
WP_000140569.1|2703078_2703978_+|transposase	ISNCY family transposase	transposase	Q2A0A7	Sodalis_phage	54.8	2.5e-69
WP_000150333.1|2703990_2704176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000992954.1|2704216_2705020_-	2-keto-3-deoxy-L-rhamnonate aldolase	NA	NA	NA	NA	NA
WP_001295288.1|2705037_2706327_-	MFS transporter	NA	NA	NA	NA	NA
WP_001319848.1|2706383_2707589_-	L-rhamnonate dehydratase	NA	Q6A202	Oenococcus_phage	28.3	1.2e-26
>prophage 210
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2711192	2716196	4726108		Tupanvirus(50.0%)	4	NA	NA
WP_000879112.1|2711192_2711795_-	histidine phosphatase family protein	NA	A0A2L1IV13	Escherichia_phage	42.9	4.4e-09
WP_001295286.1|2712102_2713242_+	UDP-4-amino-4-deoxy-L-arabinose aminotransferase	NA	A0A2K9L470	Tupanvirus	29.8	1.5e-29
WP_000461657.1|2713245_2714214_+	undecaprenyl-phosphate 4-deoxy-4-formamido-L-arabinose transferase	NA	F1C5B0	Cronobacter_phage	31.5	8.8e-36
WP_000860273.1|2714213_2716196_+	bifunctional UDP-4-amino-4-deoxy-L-arabinose formyltransferase/UDP-glucuronic acid oxidase ArnA	NA	A0A2K9KZK0	Tupanvirus	25.8	1.8e-19
>prophage 211
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2755035	2758263	4726108		Salmonella_phage(50.0%)	3	NA	NA
WP_000813859.1|2755035_2755635_+	5'-deoxynucleotidase	NA	A0A2L0V156	Salmonella_phage	38.6	7.0e-07
WP_064669488.1|2755693_2757526_-	SLC13 family permease	NA	NA	NA	NA	NA
WP_001203392.1|2757612_2758263_-	hexitol phosphatase HpxA	NA	M1IMD4	Acanthocystis_turfacea_Chlorella_virus	35.4	3.1e-08
>prophage 212
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2768822	2770683	4726108		Sodalis_phage(50.0%)	2	NA	NA
WP_000156149.1|2768822_2769713_-	recombination-promoting nuclease RpnB	NA	Q2A0A7	Sodalis_phage	43.9	8.9e-67
WP_001293613.1|2769909_2770683_-	histidine ABC transporter ATP-binding protein HisP	NA	M1I0T9	Acanthocystis_turfacea_Chlorella_virus	28.2	2.1e-08
>prophage 213
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2774894	2776412	4726108		Mollivirus(100.0%)	1	NA	NA
WP_000334220.1|2774894_2776412_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	44.0	5.9e-87
>prophage 214
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2782888	2784025	4726108		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000699145.1|2782888_2784025_-	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	28.8	5.9e-23
>prophage 215
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2792561	2793647	4726108		Pandoravirus(100.0%)	1	NA	NA
WP_001333535.1|2792561_2793647_-	chorismate synthase	NA	A0A291AU41	Pandoravirus	47.8	9.1e-90
>prophage 216
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2812809	2813742	4726108		Enterobacteria_phage(100.0%)	1	NA	NA
WP_000368140.1|2812809_2813742_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	99.0	2.5e-165
>prophage 217
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2821667	2829244	4726108		Bacillus_phage(50.0%)	4	NA	NA
WP_172614309.1|2821667_2825261_+	acid-sensing system histidine kinase EvgS	NA	W8CYM9	Bacillus_phage	40.0	1.1e-09
WP_001296867.1|2825316_2826462_-	CoA:oxalate CoA-transferase	NA	NA	NA	NA	NA
WP_000955028.1|2826535_2827480_-	transporter YfdV	NA	NA	NA	NA	NA
WP_001283490.1|2827549_2829244_-	oxalyl-CoA decarboxylase	NA	E5ERI2	Ostreococcus_lucimarinus_virus	23.6	1.4e-23
>prophage 218
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2832938	2833859	4726108		Morganella_phage(100.0%)	1	NA	NA
WP_000484404.1|2832938_2833859_+	kdo(2)-lipid IV(A) palmitoleoyltransferase	NA	A0A1W6JP29	Morganella_phage	54.8	4.9e-76
>prophage 219
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2837676	2838411	4726108		Clostridioides_phage(100.0%)	1	NA	NA
WP_001295458.1|2837676_2838411_+	two-component system response regulator YpdB	NA	A0A2R2ZGH8	Clostridioides_phage	25.4	3.6e-13
>prophage 220
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2865298	2877952	4726108		Streptococcus_phage(40.0%)	12	NA	NA
WP_000443661.1|2865298_2867314_-	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	43.5	1.7e-150
WP_001300494.1|2867384_2868371_-	cell division protein ZipA	NA	NA	NA	NA	NA
WP_000254839.1|2868600_2869362_+	sulfate transporter CysZ	NA	NA	NA	NA	NA
WP_000034402.1|2869546_2870518_+	cysteine synthase A	NA	A0A1X9I5F1	Streptococcus_phage	51.0	2.8e-74
WP_000487600.1|2870901_2871159_+	phosphocarrier protein Hpr	NA	NA	NA	NA	NA
WP_000623140.1|2871203_2872931_+	phosphoenolpyruvate-protein phosphotransferase PtsI	NA	A0A1V0SGR7	Hokovirus	31.1	1.3e-16
WP_000522247.1|2872971_2873481_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000096674.1|2873523_2874375_-	pyridoxine/pyridoxal/pyridoxamine kinase	NA	NA	NA	NA	NA
WP_000719962.1|2874479_2874854_+	YfeK family protein	NA	NA	NA	NA	NA
WP_000745534.1|2874886_2875621_+	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001336044.1|2875809_2876721_-	cysteine synthase B	NA	A0A1X9I5F1	Streptococcus_phage	41.3	3.8e-57
WP_000021036.1|2876854_2877952_-	sulfate/thiosulfate ABC transporter ATP-binding protein CysA	NA	G3M9Y6	Bacillus_virus	34.1	4.2e-26
>prophage 221
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2880969	2881761	4726108		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000517431.1|2880969_2881761_-	SDR family oxidoreductase UcpA	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.0	8.9e-18
>prophage 222
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2885239	2890359	4726108		Mycobacterium_phage(33.33%)	5	NA	NA
WP_001327042.1|2885239_2886544_+	penicillin binding protein PBP4B	NA	A0A0B5A438	Mycobacterium_phage	26.2	1.6e-08
WP_000084590.1|2886783_2887683_-	porphyrinogen peroxidase	NA	S4VVJ7	Pandoravirus	32.6	4.5e-26
WP_000838944.1|2887778_2888354_-	RpoE-regulated lipoprotein	NA	NA	NA	NA	NA
WP_000405996.1|2888850_2889276_-	GNAT family acetyltransferase	NA	NA	NA	NA	NA
WP_000102886.1|2889489_2890359_+	N-acetylmuramoyl-L-alanine amidase AmiA	NA	E5DV68	Deep-sea_thermophilic_phage	27.4	4.2e-13
>prophage 223
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2909013	2909964	4726108		Cyanophage(100.0%)	1	NA	NA
WP_001003709.1|2909013_2909964_+	transaldolase	NA	A0A127KNC6	Cyanophage	31.3	5.7e-11
>prophage 224
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2927252	2927966	4726108		Synechococcus_phage(100.0%)	1	NA	NA
WP_001295467.1|2927252_2927966_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A0E3FGF0	Synechococcus_phage	36.1	6.9e-38
>prophage 225
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2950567	2954569	4726108		Enterobacteria_phage(33.33%)	4	NA	NA
WP_000198328.1|2950567_2951857_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	37.4	5.1e-63
WP_001295473.1|2951942_2952569_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_001336050.1|2952893_2953931_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	43.3	1.4e-71
WP_001028612.1|2953930_2954569_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.9	1.8e-29
>prophage 226
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	2960816	3007896	4726108	tail,integrase,holin,terminase	Escherichia_phage(50.91%)	58	2962653:2962669	3003250:3003266
WP_000017552.1|2960816_2960969_-	hypothetical protein	NA	G9L6F3	Escherichia_phage	96.0	1.7e-18
WP_000076001.1|2960986_2961178_+	DUF2633 family protein	NA	G9L6F2	Escherichia_phage	100.0	7.3e-27
WP_001295476.1|2961488_2962007_+	glycine zipper 2TM domain-containing protein	NA	G9L6F1	Escherichia_phage	100.0	1.3e-62
WP_000755173.1|2962022_2962562_+	DUF5384 family protein	NA	G9L6F0	Escherichia_phage	100.0	3.4e-45
2962653:2962669	attL	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_063075269.1|2962756_2963245_-	DUF2514 family protein	NA	A0A193GYU6	Enterobacter_phage	66.0	5.1e-48
WP_047090012.1|2963241_2963871_-	glycoside hydrolase family 19 protein	NA	Q858F0	Salmonella_phage	88.5	2.4e-103
WP_063075270.1|2963860_2964154_-|holin	phage holin family protein	holin	A0A193GYK3	Enterobacter_phage	68.8	1.2e-28
WP_047052274.1|2964140_2964545_-	membrane protein	NA	A0A0F6R7N0	Escherichia_coli_O157_typing_phage	76.9	3.8e-49
WP_063075271.1|2964698_2965061_+	GtrA family protein	NA	U5P0S6	Shigella_phage	80.8	3.2e-47
WP_063075272.1|2965057_2965981_+	glycosyltransferase family 2 protein	NA	U5P087	Shigella_phage	91.4	6.0e-159
WP_151333134.1|2965977_2967612_+	hypothetical protein	NA	B9UDL6	Salmonella_phage	32.6	9.6e-75
WP_001188258.1|2970035_2970293_+	hypothetical protein	NA	A0A0F6R8M4	Escherichia_coli_O157_typing_phage	97.6	4.9e-42
WP_000127501.1|2970608_2971304_+	hypothetical protein	NA	G9L6E2	Escherichia_phage	97.8	8.6e-126
WP_000125783.1|2971397_2971565_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000671196.1|2971585_2972029_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000708858.1|2972122_2972284_+	hypothetical protein	NA	G9L6D9	Escherichia_phage	100.0	2.5e-20
WP_001147904.1|2972315_2972612_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	100.0	2.5e-50
WP_080030024.1|2972808_2975283_-	hypothetical protein	NA	A0A0F6TK45	Escherichia_coli_O157_typing_phage	99.4	0.0e+00
WP_080030022.1|2977086_2979600_-	hypothetical protein	NA	A0A0F6R8M6	Escherichia_coli_O157_typing_phage	99.9	0.0e+00
WP_000332878.1|2979599_2980145_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	100.0	9.8e-93
WP_000568023.1|2980144_2980609_-	hypothetical protein	NA	G9L6D1	Escherichia_phage	100.0	8.4e-85
WP_064559430.1|2980608_2983080_-	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	99.4	0.0e+00
WP_063075278.1|2983079_2983685_-	hypothetical protein	NA	G9L6C9	Escherichia_phage	99.0	3.1e-111
WP_000424495.1|2983684_2984008_-	hypothetical protein	NA	A0A0F6R8M8	Escherichia_coli_O157_typing_phage	98.1	2.6e-53
WP_001546708.1|2984058_2984394_-	hypothetical protein	NA	G9L6C7	Escherichia_phage	99.1	1.3e-55
WP_063075279.1|2984404_2984842_-	hypothetical protein	NA	A0A0F6R7N9	Escherichia_coli_O157_typing_phage	95.2	8.5e-71
WP_042634204.1|2984893_2985880_-	phage protein	NA	G9L6C5	Escherichia_phage	99.7	4.3e-187
WP_064559426.1|2985894_2986590_-	peptidase	NA	G9L6C4	Escherichia_phage	99.1	1.8e-94
WP_000133160.1|2986592_2986889_-	hypothetical protein	NA	G9L6C3	Escherichia_phage	100.0	1.3e-46
WP_063075281.1|2986885_2988565_-|tail	phage tail protein	tail	G9L6C2	Escherichia_phage	99.3	5.2e-302
WP_000335899.1|2988579_2988786_-	hypothetical protein	NA	G9L6C1	Escherichia_phage	100.0	6.0e-11
WP_000999679.1|2989488_2989860_+	hypothetical protein	NA	A0A0F6TJP2	Escherichia_coli_O157_typing_phage	90.2	2.0e-57
WP_000132524.1|2989950_2991426_-	hypothetical protein	NA	G9L6B8	Escherichia_phage	99.2	1.3e-296
WP_024946519.1|2991422_2992097_-|terminase	terminase small subunit	terminase	Q287B7	Escherichia_phage	99.6	3.4e-119
WP_001124396.1|2992093_2992306_-	hypothetical protein	NA	Q7Y4V0	Enterobacteria_phage	52.2	2.1e-14
WP_063075282.1|2992323_2992662_-	hypothetical protein	NA	A0A0F6TJR3	Escherichia_coli_O157_typing_phage	97.3	3.2e-57
WP_063075283.1|2992654_2992936_-	ASCH domain-containing protein	NA	A0A0F6R7P5	Escherichia_coli_O157_typing_phage	94.6	2.5e-47
WP_063075284.1|2992928_2993564_-	DUF551 domain-containing protein	NA	A0A088CPS0	Enterobacteria_phage	89.0	2.0e-49
WP_001018057.1|2993560_2993851_-	DUF4752 family protein	NA	A0A2I6TCB0	Escherichia_phage	82.3	1.2e-36
WP_063075285.1|2993847_2994501_-	hypothetical protein	NA	A0A0U2QW67	Escherichia_phage	67.8	8.8e-64
WP_001231254.1|2994562_2994907_-	DUF1064 domain-containing protein	NA	A0A0F6R8N5	Escherichia_coli_O157_typing_phage	97.4	1.4e-60
WP_063075289.1|2995024_2995810_-	replication protein	NA	A0A0F6TJ71	Escherichia_coli_O157_typing_phage	99.6	1.0e-151
WP_077487329.1|2995806_2996622_-	helix-turn-helix domain-containing protein	NA	Q286X4	Escherichia_phage	96.0	4.5e-118
WP_000402893.1|2996637_2996838_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	98.5	6.0e-32
WP_001282459.1|2996988_2997219_-	hypothetical protein	NA	G9L6A7	Escherichia_phage	100.0	2.6e-39
WP_000836290.1|2997373_2997958_+	helix-turn-helix transcriptional regulator	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	100.0	7.0e-105
WP_165389082.1|2998111_2998264_+	hypothetical protein	NA	G9L6A5	Escherichia_phage	98.0	2.1e-24
WP_001102257.1|2998266_2998566_+	hypothetical protein	NA	A0A0F6R7M4	Escherichia_coli_O157_typing_phage	100.0	3.4e-47
WP_063075287.1|2998562_2999384_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	G9L6A3	Escherichia_phage	98.9	8.0e-163
WP_042634212.1|2999380_3000262_+	recombinase RecT	NA	G9L6A2	Escherichia_phage	98.6	3.4e-159
WP_000675390.1|3000311_3000560_+	AlpA family phage regulatory protein	NA	A0A0F6TJ45	Escherichia_coli_O157_typing_phage	100.0	3.6e-42
WP_001335975.1|3000717_3000969_+	PerC family transcriptional regulator	NA	G9L6A0	Escherichia_phage	100.0	3.1e-41
WP_001550171.1|3000961_3001612_+	hypothetical protein	NA	G9L699	Escherichia_phage	98.6	2.8e-126
WP_001077941.1|3001608_3001803_+	DUF1382 family protein	NA	G9L698	Escherichia_phage	100.0	1.9e-27
WP_021558029.1|3001806_3003057_-|integrase	site-specific integrase	integrase	G9L697	Escherichia_phage	99.8	1.0e-238
WP_000138270.1|3003251_3004829_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
3003250:3003266	attR	AATCATTCCCACTCAAT	NA	NA	NA	NA
WP_001299507.1|3004897_3006364_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	39.1	2.3e-88
WP_000937912.1|3006525_3007896_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	35.3	2.4e-42
>prophage 227
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3016726	3017158	4726108		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000963837.1|3016726_3017158_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	37.9	3.7e-18
>prophage 228
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3027368	3033825	4726108		Mycoplasma_phage(20.0%)	8	NA	NA
WP_000133592.1|3027368_3028652_-	aminopeptidase PepB	NA	Q6GYZ8	Mycoplasma_phage	37.8	3.8e-34
WP_000523616.1|3028829_3029030_-	Fe-S cluster assembly protein IscX	NA	NA	NA	NA	NA
WP_001124469.1|3029041_3029377_-	ISC system 2Fe-2S type ferredoxin	NA	NA	NA	NA	NA
WP_001196613.1|3029378_3031229_-	Fe-S protein assembly chaperone HscA	NA	A0A0N9QXN8	Chrysochromulina_ericina_virus	41.6	5.5e-103
WP_000384413.1|3031245_3031761_-	co-chaperone HscB	NA	NA	NA	NA	NA
WP_000028953.1|3031856_3032180_-	iron-sulfur cluster assembly protein IscA	NA	A0A2H4N7N5	Lake_Baikal_phage	48.6	5.4e-22
WP_000331707.1|3032196_3032583_-	Fe-S cluster assembly scaffold IscU	NA	A0A218MKD1	uncultured_virus	78.9	1.4e-53
WP_001295373.1|3032610_3033825_-	cysteine desulfurase	NA	A0A1X7C038	Faustovirus	31.8	8.8e-33
>prophage 229
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3049052	3050564	4726108		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000493470.1|3049052_3050564_-	sugar ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	28.9	2.5e-08
>prophage 230
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3056456	3067746	4726108		Bacillus_phage(50.0%)	7	NA	NA
WP_000919159.1|3056456_3057710_-	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	52.7	7.8e-101
WP_172614314.1|3058037_3059228_+	NO-inducible flavohemoprotein	NA	NA	NA	NA	NA
WP_000717694.1|3059272_3059611_-	nitrogen regulatory protein P-II	NA	NA	NA	NA	NA
WP_172614315.1|3059671_3061006_-	two-component system response regulator GlrR	NA	W8CYM9	Bacillus_phage	37.3	3.9e-10
WP_001215861.1|3060995_3061709_-	two-component system QseEF-associated lipoprotein QseG	NA	NA	NA	NA	NA
WP_001311037.1|3061873_3063301_-	two component system sensor histidine kinase QseE/GlrK	NA	W8CYF6	Bacillus_phage	24.9	3.0e-16
WP_000970102.1|3063858_3067746_-	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	58.9	1.3e-130
>prophage 231
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3071865	3072126	4726108		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_001196283.1|3071865_3072126_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	1.1e-17
>prophage 232
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3075585	3079327	4726108		Tetraselmis_virus(50.0%)	3	NA	NA
WP_001068343.1|3075585_3076266_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_064669594.1|3076537_3077512_-	signal peptidase I	NA	NA	NA	NA	NA
WP_000790168.1|3077527_3079327_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
>prophage 233
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3085098	3091357	4726108	tRNA	Cafeteria_roenbergensis_virus(25.0%)	7	NA	NA
WP_000219193.1|3085098_3086433_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001300638.1|3086641_3087523_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000189207.1|3087625_3088213_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627807.1|3088268_3088652_-	autonomous glycyl radical cofactor GrcA	NA	Q7Y524	Enterobacteria_phage	72.0	1.4e-32
WP_001262716.1|3088956_3089646_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	7.1e-56
WP_000997403.1|3089693_3090731_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|3090937_3091357_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
>prophage 234
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3096650	3097949	4726108		Burkholderia_virus(100.0%)	1	NA	NA
WP_000841103.1|3096650_3097949_-	alpha-ketoglutarate permease	NA	Q6JIH2	Burkholderia_virus	32.2	1.3e-45
>prophage 235
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3103803	3106377	4726108		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001235102.1|3103803_3106377_-	ATP-dependent chaperone ClpB	NA	H6X3M6	Enterobacteria_phage	35.3	2.6e-127
>prophage 236
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3112283	3113354	4726108		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001168037.1|3112283_3113354_-	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
>prophage 237
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3127099	3140065	4726108	transposase	Shigella_phage(53.33%)	15	NA	NA
WP_000162574.1|3127099_3127582_+	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
WP_172614317.1|3128387_3129602_+	restriction endonuclease	NA	E5E3X4	Burkholderia_phage	38.6	7.9e-34
WP_072095179.1|3129636_3131040_-	DNA cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	50.1	4.0e-106
WP_000104967.1|3132745_3133687_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	100.0	1.3e-153
WP_001250269.1|3133676_3133856_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_033559312.1|3134031_3134589_-	protein YmfL	NA	U5P4K1	Shigella_phage	96.2	8.8e-97
WP_000649477.1|3134632_3134833_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000848748.1|3134923_3135598_+	LexA family transcriptional repressor	NA	U5P0T5	Shigella_phage	100.0	1.2e-132
WP_001083098.1|3135769_3135973_+	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	75.5	2.0e-14
WP_072037893.1|3135981_3136257_+	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	5.4e-47
WP_000135682.1|3136857_3137220_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_000081287.1|3137285_3138110_+	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000008200.1|3138237_3138774_+	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_172614318.1|3138764_3139079_+	hypothetical protein	NA	K7PH61	Enterobacteria_phage	98.0	1.5e-53
WP_074194686.1|3139096_3140065_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	91.9	3.4e-173
>prophage 238
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3145107	3149159	4726108		Klosneuvirus(50.0%)	4	NA	NA
WP_172614319.1|3145107_3146388_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	30.1	1.9e-33
WP_096129315.1|3146625_3148026_+	GABA permease	NA	NA	NA	NA	NA
WP_000156811.1|3148046_3148709_+	DNA-binding transcriptional regulator CsiR	NA	NA	NA	NA	NA
WP_000522415.1|3148709_3149159_-	potassium binding protein Kbp	NA	A0A090DBR9	Clostridium_phage	39.5	2.0e-06
>prophage 239
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3153095	3158390	4726108		Oenococcus_phage(20.0%)	5	NA	NA
WP_001223227.1|3153095_3153341_+	glutaredoxin-like protein NrdH	NA	Q5K5J3	Oenococcus_phage	35.3	1.8e-06
WP_000080947.1|3153337_3153748_+	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A142F1R4	Bacillus_phage	44.4	4.6e-18
WP_000246527.1|3153720_3155865_+	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A8E2R1	Enterococcus_phage	48.5	1.7e-196
WP_000777969.1|3155874_3156834_+	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.8	3.5e-133
WP_000985494.1|3157187_3158390_+	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	39.4	4.9e-28
>prophage 240
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3171340	3176726	4726108	tRNA	Vibrio_phage(25.0%)	5	NA	NA
WP_000906486.1|3171340_3171526_-	carbon storage regulator CsrA	NA	A0A2I7RT00	Vibrio_phage	66.7	4.9e-12
WP_000047184.1|3171760_3174391_-|tRNA	alanine--tRNA ligase	tRNA	A0A2K9L1X7	Tupanvirus	38.6	5.5e-80
WP_000140508.1|3174518_3175019_-	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000963143.1|3175087_3176149_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	63.4	1.2e-113
WP_000132231.1|3176228_3176726_-	nicotinamide-nucleotide amidase	NA	B5TK85	Pseudomonas_phage	49.7	4.4e-31
>prophage 241
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3182192	3183158	4726108		Tetraselmis_virus(100.0%)	1	NA	NA
WP_001287420.1|3182192_3183158_+	arabinose-5-phosphate isomerase GutQ	NA	A0A2P0VNK5	Tetraselmis_virus	33.9	2.3e-36
>prophage 242
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3190633	3191644	4726108		Enterobacteria_phage(100.0%)	1	NA	NA
WP_001394680.1|3190633_3191644_-	DNA-binding transcriptional regulator AscG	NA	C6ZCU4	Enterobacteria_phage	28.4	7.1e-28
>prophage 243
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3209766	3220594	4726108		uncultured_Mediterranean_phage(33.33%)	5	NA	NA
WP_061069676.1|3209766_3212652_+	hypothetical protein	NA	A0A1B1IUG5	uncultured_Mediterranean_phage	23.9	1.6e-08
WP_048213044.1|3213114_3213474_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000101605.1|3214636_3216184_+	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	28.0	2.2e-49
WP_172614322.1|3216180_3217296_+	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_159140931.1|3217354_3220594_+	HsdR family type I site-specific deoxyribonuclease	NA	A0A220A398	Liberibacter_phage	28.4	1.0e-64
>prophage 244
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3229201	3245247	4726108		Escherichia_phage(41.67%)	15	NA	NA
WP_172614324.1|3229201_3229768_+	helix-turn-helix domain-containing protein	NA	M1PL54	Cellulophaga_phage	44.9	5.5e-38
WP_004114867.1|3229857_3230433_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001530776.1|3230444_3231899_-	hypothetical protein	NA	A0A0R6PHE0	Moraxella_phage	28.3	5.8e-23
WP_001530778.1|3232058_3234626_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
WP_001141322.1|3234731_3235388_+	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	6.2e-49
WP_001300386.1|3235438_3236206_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.3	7.4e-70
WP_000847979.1|3236401_3237310_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	3.0e-118
WP_172614325.1|3237306_3238569_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.2	2.8e-135
WP_001278994.1|3238565_3239204_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_001136925.1|3239208_3239985_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_000104459.1|3240073_3241438_+	GntP family transporter	NA	NA	NA	NA	NA
WP_000081550.1|3241531_3242524_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_001272590.1|3242586_3243726_-	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000254708.1|3243865_3244492_-	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001295182.1|3244485_3245247_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	3.4e-59
>prophage 245
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3248359	3250392	4726108		Tupanvirus(50.0%)	2	NA	NA
WP_001173676.1|3248359_3248965_-	adenylyl-sulfate kinase	NA	A0A2K9L4R9	Tupanvirus	38.1	3.2e-28
WP_001090386.1|3248964_3250392_-	sulfate adenylyltransferase subunit CysN	NA	A0A1V0SGC3	Hokovirus	31.1	1.1e-29
>prophage 246
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3266715	3267501	4726108		Trichoplusia_ni_ascovirus(100.0%)	1	NA	NA
WP_000021321.1|3266715_3267501_-	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.1	6.5e-21
>prophage 247
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3271852	3276772	4726108		Vibrio_phage(33.33%)	5	NA	NA
WP_001199973.1|3271852_3272524_-	7-carboxy-7-deazaguanine synthase QueE	NA	A0A2I7S8X1	Vibrio_phage	25.0	1.7e-14
WP_001288228.1|3272662_3272803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001268460.1|3272816_3273689_+	YgcG family protein	NA	NA	NA	NA	NA
WP_000036723.1|3273748_3275047_-	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	58.8	2.0e-131
WP_000210878.1|3275134_3276772_-	CTP synthase (glutamine hydrolyzing)	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	50.4	1.8e-153
>prophage 248
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3280804	3284919	4726108		Erysipelothrix_phage(50.0%)	2	NA	NA
WP_064669401.1|3280804_3282106_-	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A2K5B251	Erysipelothrix_phage	27.9	6.7e-39
WP_000186450.1|3282162_3284919_+	two-component sensor histidine kinase BarA	NA	A0A1V0SGX0	Hokovirus	30.6	6.4e-55
>prophage 249
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3292453	3293302	4726108		Vibrio_phage(100.0%)	1	NA	NA
WP_000100421.1|3292453_3293302_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	A0A2I7SAX1	Vibrio_phage	37.1	1.0e-40
>prophage 250
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3298160	3298916	4726108		Bacillus_phage(100.0%)	1	NA	NA
WP_000268232.1|3298160_3298916_+	flap endonuclease Xni	NA	F8WQ40	Bacillus_phage	33.5	5.0e-10
>prophage 251
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3310442	3325990	4726108	tRNA	Bacillus_phage(33.33%)	9	NA	NA
WP_001300698.1|3310442_3311648_+	cysteine desulfurase CsdA	NA	Q2XUY6	environmental_halophage	36.8	3.0e-73
WP_000184261.1|3311647_3312091_+	cysteine desulfurase sulfur acceptor subunit CsdE	NA	NA	NA	NA	NA
WP_000117728.1|3312141_3312948_-|tRNA	tRNA cyclic N6-threonylcarbamoyladenosine(37) synthase TcdA	tRNA	S4VW33	Pandoravirus	33.3	2.2e-16
WP_000678646.1|3313186_3314284_-	murein transglycosylase A	NA	NA	NA	NA	NA
WP_000016907.1|3314862_3316116_-	N-acetylmuramoyl-L-alanine amidase AmiC	NA	Q5YA51	Bacillus_phage	28.6	2.2e-15
WP_000237947.1|3316347_3317679_+	amino-acid N-acetyltransferase	NA	NA	NA	NA	NA
WP_000775955.1|3317740_3319567_-	exodeoxyribonuclease V subunit alpha	NA	A0A1P8DII4	Virus_Rctr197k	26.7	3.5e-25
WP_172614327.1|3319566_3323109_-	exodeoxyribonuclease V subunit beta	NA	A7KV33	Bacillus_phage	20.9	1.5e-08
WP_001138201.1|3323101_3325990_-	pitrilysin	NA	A0A1V0SJA4	Klosneuvirus	25.7	5.3e-68
>prophage 252
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3331466	3338239	4726108		Geobacillus_virus(33.33%)	6	NA	NA
WP_000816232.1|3331466_3332261_-	thymidylate synthase	NA	A6M9A2	Geobacillus_virus	70.8	7.6e-118
WP_000204658.1|3332267_3333143_-	prolipoprotein diacylglyceryl transferase	NA	NA	NA	NA	NA
WP_000957910.1|3333293_3335540_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.2	2.7e-11
WP_000564489.1|3335552_3336083_-	RNA pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000082201.1|3336767_3337457_+	DNA mismatch repair endonuclease MutH	NA	NA	NA	NA	NA
WP_000895624.1|3337525_3338239_+	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	47.3	2.6e-45
>prophage 253
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3347869	3350364	4726108		Aichi_virus(50.0%)	2	NA	NA
WP_000256438.1|3347869_3349288_-	arabinose-proton symporter AraE	NA	O13311	Aichi_virus	26.9	1.8e-24
WP_000603502.1|3349602_3350364_-	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	31.7	7.7e-19
>prophage 254
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3373114	3373870	4726108		Clostridium_phage(100.0%)	1	NA	NA
WP_001301085.1|3373114_3373870_-	peptidoglycan DD-metalloendopeptidase family protein	NA	I2E8W3	Clostridium_phage	36.8	1.1e-12
>prophage 255
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3378789	3379487	4726108	transposase	Escherichia_phage(100.0%)	1	NA	NA
WP_111947175.1|3378789_3379487_-|transposase	IS1 family transposase	transposase	A0A077SLN4	Escherichia_phage	99.1	3.6e-132
>prophage 256
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3387398	3406374	4726108	tRNA	Pseudomonas_phage(25.0%)	14	NA	NA
WP_001280192.1|3387398_3388799_+	xanthine/proton symporter XanQ	NA	H9YQ34	environmental_Halophage	46.1	1.7e-19
WP_001336279.1|3388816_3390133_+	guanine deaminase	NA	NA	NA	NA	NA
WP_000012163.1|3390168_3391536_+	guanine/hypoxanthine transporter GhxQ	NA	A0A0R6PHV4	Moraxella_phage	73.1	2.1e-160
WP_000838428.1|3391571_3392060_-	4Fe-4S dicluster domain-containing protein	NA	NA	NA	NA	NA
WP_001350545.1|3392059_3393979_-	formate-dependent uric acid utilization protein YgfT	NA	NA	NA	NA	NA
WP_001295374.1|3394414_3395863_+	urate/proton symporter UacT	NA	Q9KX94	Enterobacteria_phage	26.8	7.3e-26
WP_001010156.1|3395864_3395990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_120795390.1|3395986_3396058_-	protein YqfH	NA	NA	NA	NA	NA
WP_001352025.1|3396801_3398310_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.7	8.1e-44
WP_000003071.1|3400287_3401805_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	36.7	5.9e-87
WP_001701073.1|3401814_3402913_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	39.0	1.8e-05
WP_000813200.1|3403003_3404737_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	28.7	1.9e-60
WP_000715214.1|3404742_3405453_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_000806638.1|3405477_3406374_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	28.6	6.7e-30
>prophage 257
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3410298	3415672	4726108		Pandoravirus(50.0%)	3	NA	NA
WP_001336277.1|3410298_3411732_+	6-phospho-beta-glucosidase BglA	NA	A0A0B5JD41	Pandoravirus	26.3	2.0e-31
WP_000951964.1|3411788_3412532_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_172614329.1|3412798_3415672_-	aminomethyl-transferring glycine dehydrogenase	NA	E3SN07	Prochlorococcus_phage	52.1	1.6e-263
>prophage 258
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3423808	3425041	4726108		Catovirus(100.0%)	1	NA	NA
WP_001151604.1|3423808_3425041_-	phosphoglycerate dehydrogenase	NA	A0A1V0SBV6	Catovirus	48.4	1.9e-104
>prophage 259
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3454112	3455267	4726108		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001062128.1|3454112_3455267_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
>prophage 260
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3501771	3502944	4726108		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000524970.1|3501771_3502944_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	D2TEZ5	Emiliania_huxleyi_virus	30.7	5.5e-40
>prophage 261
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3525154	3526039	4726108		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000018760.1|3525154_3526039_+	NADP(+)-dependent aldehyde reductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	47.1	1.7e-65
>prophage 262
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3532115	3541466	4726108		Staphylococcus_phage(33.33%)	7	NA	NA
WP_000013149.1|3532115_3532943_+	2,5-didehydrogluconate reductase DkgA	NA	A0A2H4PQR8	Staphylococcus_phage	45.2	7.2e-63
WP_000691619.1|3533142_3534069_+	YbjP/YqhG family protein	NA	NA	NA	NA	NA
WP_000848528.1|3534119_3534377_+	lipoprotein YqhH	NA	NA	NA	NA	NA
WP_000095187.1|3534419_3536639_-	YgiQ family radical SAM protein	NA	M1QSD9	Pseudomonas_phage	70.4	7.8e-104
WP_000059388.1|3536749_3538162_-	cell division protein FtsP	NA	NA	NA	NA	NA
WP_000965722.1|3538236_3538974_-	1-acylglycerol-3-phosphate O-acyltransferase	NA	NA	NA	NA	NA
WP_001281881.1|3539207_3541466_-	DNA topoisomerase IV subunit A	NA	G3M9Z5	Bacillus_virus	35.1	1.4e-84
>prophage 263
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3544776	3545169	4726108		Stx_converting_phage(100.0%)	1	NA	NA
WP_000712658.1|3544776_3545169_-	OB fold stress tolerance protein YgiW	NA	A0A1I9LJU6	Stx_converting_phage	49.1	9.4e-21
>prophage 264
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3548996	3559959	4726108		Bacillus_virus(20.0%)	12	NA	NA
WP_000195296.1|3548996_3550889_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	35.1	3.4e-92
WP_000105733.1|3550917_3551499_-	esterase YqiA	NA	NA	NA	NA	NA
WP_000444747.1|3551498_3552326_-	3',5'-cyclic-AMP phosphodiesterase	NA	NA	NA	NA	NA
WP_000833393.1|3552350_3552773_-	DUF1249 family protein	NA	NA	NA	NA	NA
WP_000917117.1|3552773_3553403_-	ADP-ribose diphosphatase	NA	A0A1S6L1P8	Vibrio_phage	32.5	9.2e-18
WP_000735278.1|3553607_3555089_+	outer membrane channel protein TolC	NA	NA	NA	NA	NA
WP_000831543.1|3555236_3555908_+	DUF1190 family protein	NA	A0A173GEW8	Erwinia_phage	44.3	4.8e-33
WP_000442860.1|3555913_3557074_+	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.1	3.5e-87
WP_001320780.1|3557111_3557900_-	4,5-DOPA dioxygenase extradiol	NA	NA	NA	NA	NA
WP_001295627.1|3558042_3558816_+	zinc transporter ZupT	NA	NA	NA	NA	NA
WP_000469266.1|3558873_3559044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001076997.1|3559305_3559959_-	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	44.3	4.9e-46
>prophage 265
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3565470	3633137	4726108	tRNA,transposase	Staphylococcus_phage(12.5%)	58	NA	NA
WP_097308405.1|3565470_3566451_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	8.9e-185
WP_021570317.1|3566561_3567053_+	fimbrial protein	NA	NA	NA	NA	NA
WP_000350095.1|3567095_3567296_-	cell surface composition regulator GlgS	NA	NA	NA	NA	NA
WP_000599926.1|3567564_3568194_+	DUF1449 family protein	NA	NA	NA	NA	NA
WP_001311137.1|3568220_3569882_+	flotillin family protein	NA	NA	NA	NA	NA
WP_001387081.1|3570122_3570182_+	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_010723221.1|3570497_3570557_+	type I toxin-antitoxin system toxin IbsE	NA	NA	NA	NA	NA
WP_000869178.1|3570676_3572110_-	bifunctional D-glycero-beta-D-manno-heptose-7-phosphate kinase/D-glycero-beta-D-manno-heptose 1-phosphate adenylyltransferase HldE	NA	A0A1B1IUK5	uncultured_Mediterranean_phage	29.4	3.0e-40
WP_001301081.1|3572157_3574998_-	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_097308404.1|3575020_3576322_-	inorganic triphosphatase	NA	NA	NA	NA	NA
WP_001125331.1|3576563_3577184_+	SH3 domain-containing protein	NA	NA	NA	NA	NA
WP_000708487.1|3577247_3578486_+|tRNA	fused tRNA nucleotidyltransferase/2',3'-cyclic phosphodiesterase/2' nucleotidase/phosphatase Cca	tRNA	A0A0F6YPT7	Sinorhizobium_phage	51.9	3.5e-93
WP_001281927.1|3578666_3579488_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_001295541.1|3579577_3579946_-	bifunctional dihydroneopterin aldolase/7,8-dihydroneopterin epimerase	NA	NA	NA	NA	NA
WP_001272796.1|3580050_3580668_+	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_000935206.1|3580680_3581613_-	DNA-binding transcriptional activator TtdR	NA	NA	NA	NA	NA
WP_000986797.1|3581819_3582731_+	L(+)-tartrate dehydratase subunit alpha	NA	NA	NA	NA	NA
WP_000722957.1|3582727_3583333_+	L(+)-tartrate dehydratase subunit beta	NA	NA	NA	NA	NA
WP_000804973.1|3583380_3584844_+	L-tartrate/succinate antiporter	NA	NA	NA	NA	NA
WP_001264352.1|3584886_3585900_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	59.2	6.3e-109
WP_001144069.1|3586137_3586353_+	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_000918827.1|3586463_3588209_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.1e-76
WP_000437375.1|3588403_3590245_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.7	8.3e-35
WP_000228937.1|3590323_3590830_-	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_001280435.1|3591128_3591974_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_000839263.1|3592070_3592268_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_001177592.1|3592279_3592768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854822.1|3592758_3593142_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_001285610.1|3593231_3593600_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692350.1|3593679_3593901_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_072661507.1|3593969_3594446_-	RadC family protein	NA	NA	NA	NA	NA
WP_072794436.1|3594461_3594947_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	34.4	1.2e-12
WP_001234702.1|3595037_3595856_-	DUF945 domain-containing protein	NA	K4F5L3	Cronobacter_phage	40.3	8.0e-46
WP_072775638.1|3596182_3599029_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_024195975.1|3599401_3600274_-	GTPase family protein	NA	NA	NA	NA	NA
WP_170386723.1|3600617_3601589_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_112923073.1|3601681_3602107_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_000957857.1|3602231_3602420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000948429.1|3602429_3603629_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_072661597.1|3603792_3604092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049589868.1|3604163_3605789_-	phosphoethanolamine--lipid A transferase MCR-1.1	NA	NA	NA	NA	NA
WP_170386723.1|3605984_3606956_-|transposase	IS30-like element ISApl1 family transposase	transposase	W5R8L2	Staphylococcus_phage	39.1	2.3e-52
WP_072661607.1|3607031_3607226_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016240669.1|3608700_3609051_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	4.0e-39
WP_064055656.1|3609263_3612281_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	25.2	2.3e-21
WP_063085660.1|3612295_3613459_-	DUF4268 domain-containing protein	NA	NA	NA	NA	NA
WP_112923079.1|3613468_3614782_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_001407279.1|3614788_3617212_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U4	Liberibacter_phage	28.1	6.0e-25
WP_000716410.1|3622022_3623519_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_000108760.1|3623618_3624545_-	aminoimidazole riboside kinase	NA	NA	NA	NA	NA
WP_001313183.1|3624574_3624886_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_001313182.1|3624947_3625151_-	DUF2913 family protein	NA	NA	NA	NA	NA
WP_000523728.1|3625156_3625672_-	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000813683.1|3625735_3627166_-	glycoside hydrolase family 32 protein	NA	NA	NA	NA	NA
WP_001099190.1|3627162_3628440_-	MFS transporter	NA	NA	NA	NA	NA
WP_000433621.1|3628494_3630621_-	alpha-galactosidase	NA	NA	NA	NA	NA
WP_000053329.1|3630714_3631725_-	substrate-binding domain-containing protein	NA	C6ZCU4	Enterobacteria_phage	28.3	5.1e-18
WP_001354443.1|3632150_3633137_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.9	1.4e-166
>prophage 266
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3639218	3651555	4726108	integrase,tRNA	Salmonella_phage(40.0%)	9	3628087:3628102	3652771:3652786
3628087:3628102	attL	GCCGATAAAAATCCCG	NA	NA	NA	NA
WP_000268404.1|3639218_3639815_-	hypothetical protein	NA	A0A1B0VBK8	Salmonella_phage	87.4	9.4e-97
WP_001696226.1|3639944_3641261_-|integrase	site-specific integrase	integrase	A0A248SL35	Klebsiella_phage	29.1	9.2e-36
WP_001066494.1|3641557_3642322_-	NADPH-dependent ferric chelate reductase	NA	NA	NA	NA	NA
WP_000018003.1|3642609_3643233_+	DNA-binding transcriptional regulator NfeR	NA	NA	NA	NA	NA
WP_000094721.1|3643385_3644906_-	aerotaxis sensor receptor Aer	NA	A0A1B0V854	Salmonella_phage	51.5	3.1e-35
WP_001301395.1|3645323_3646703_+	putrescine aminotransferase	NA	A0A1V0SKB7	Klosneuvirus	28.6	2.0e-33
WP_000450594.1|3646744_3647077_-|tRNA	tRNA-binding protein	tRNA	NA	NA	NA	NA
WP_000212475.1|3647295_3648279_+	transcriptional regulator EbgR	NA	NA	NA	NA	NA
WP_001082857.1|3648462_3651555_+	beta-galactosidase subunit alpha	NA	L0N6M2	Herpes_simplex_virus	34.0	2.5e-156
3652771:3652786	attR	CGGGATTTTTATCGGC	NA	NA	NA	NA
>prophage 267
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3664409	3665375	4726108		Escherichia_phage(100.0%)	1	NA	NA
WP_001098806.1|3664409_3665375_+	TerC family membrane protein Alx	NA	A0A291LBC5	Escherichia_phage	33.8	5.2e-36
>prophage 268
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3685953	3688248	4726108		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000861734.1|3685953_3688248_-	2-ketobutyrate formate-lyase/pyruvate formate-lyase	NA	A0A2P0VNR5	Tetraselmis_virus	41.0	7.4e-158
>prophage 269
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3696454	3697600	4726108		Streptococcus_phage(100.0%)	1	NA	NA
WP_001300387.1|3696454_3697600_-	glycerate 2-kinase	NA	W6LM47	Streptococcus_phage	41.3	1.7e-49
>prophage 270
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3720609	3728403	4726108		Streptococcus_phage(25.0%)	10	NA	NA
WP_000809262.1|3720609_3721470_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	43.6	9.5e-50
WP_000249104.1|3721534_3723571_+	penicillin-binding protein activator LpoA	NA	NA	NA	NA	NA
WP_000246830.1|3723528_3723924_+	YraN family protein	NA	NA	NA	NA	NA
WP_001158034.1|3723943_3724534_+	DnaA initiator-associating protein DiaA	NA	A0A067XQR2	Caulobacter_phage	31.1	5.4e-12
WP_000646033.1|3724543_3725119_+	divisome-associated lipoprotein YraP	NA	NA	NA	NA	NA
WP_000147574.1|3725232_3726273_-	permease	NA	NA	NA	NA	NA
WP_001340767.1|3726345_3726981_-	NAD(P)H-binding protein	NA	NA	NA	NA	NA
WP_000037608.1|3727108_3727627_+	protein/nucleic acid deglycase	NA	A0A0N7KVR4	Yellowstone_lake_phycodnavirus	27.0	4.4e-10
WP_000449030.1|3727606_3728050_-	YhbP family protein	NA	NA	NA	NA	NA
WP_000189333.1|3728100_3728403_+	DNA damage response exodeoxyribonuclease YhbQ	NA	F2NZ06	Diadromus_pulchellus_ascovirus	53.8	7.8e-15
>prophage 271
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3734105	3735995	4726108		Chrysochromulina_ericina_virus(100.0%)	1	NA	NA
WP_097308399.1|3734105_3735995_-	ATP-dependent RNA helicase DeaD	NA	A0A0N9Q9J4	Chrysochromulina_ericina_virus	30.8	2.0e-52
>prophage 272
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3741476	3748115	4726108		Cafeteria_roenbergensis_virus(50.0%)	4	NA	NA
WP_000133044.1|3741476_3744149_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	26.3	2.5e-24
WP_001031057.1|3744173_3745661_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_001300397.1|3745688_3746141_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_000207680.1|3746771_3748115_+	argininosuccinate synthase	NA	A0A140XAJ5	Dickeya_phage	92.9	1.1e-63
>prophage 273
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3752197	3755070	4726108	protease	Pandoravirus(50.0%)	2	NA	NA
WP_000764731.1|3752197_3753046_-	dihydropteroate synthase	NA	S4W084	Pandoravirus	29.9	3.4e-23
WP_001107467.1|3753135_3755070_-|protease	ATP-dependent zinc metalloprotease FtsH	protease	G8DDJ2	Micromonas_pusilla_virus	43.6	6.3e-118
>prophage 274
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3761844	3763322	4726108		Indivirus(50.0%)	2	NA	NA
WP_089568339.1|3761844_3762816_+	octaprenyl diphosphate synthase	NA	A0A1V0SE37	Indivirus	25.8	6.0e-08
WP_000445413.1|3763043_3763322_+	DNA-binding transcriptional regulator SfsB	NA	A0A2I7S995	Vibrio_phage	71.4	2.6e-17
>prophage 275
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3767390	3782185	4726108		Staphylococcus_phage(25.0%)	17	NA	NA
WP_000438245.1|3767390_3768200_-	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	29.3	2.2e-19
WP_000922901.1|3768409_3769387_+	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_001295557.1|3769400_3770387_+	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.5	1.9e-38
WP_000030005.1|3770407_3770974_+	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	75.7	1.4e-54
WP_000030537.1|3770970_3771546_+	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_000669785.1|3771514_3772072_+	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_000224099.1|3772078_3772804_+	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_000809057.1|3772851_3774285_+	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_001176599.1|3774307_3774595_+	ribosome hibernation promoting factor	NA	A0A0M7QCF2	Escherichia_phage	44.3	2.5e-10
WP_000183676.1|3774712_3775204_+	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_000243741.1|3775249_3776104_+	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	28.4	1.1e-05
WP_000216791.1|3776100_3776373_+	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_000620405.1|3776586_3777219_+	PhoP regulatory network protein YrbL	NA	NA	NA	NA	NA
WP_000047091.1|3777215_3777944_-	monofunctional biosynthetic peptidoglycan transglycosylase	NA	NA	NA	NA	NA
WP_001300411.1|3777940_3778594_-	isoprenoid biosynthesis glyoxalase ElbB	NA	NA	NA	NA	NA
WP_000809774.1|3778823_3781160_-	aerobic respiration two-component sensor histidine kinase ArcB	NA	A0A1V0SGX0	Hokovirus	31.2	1.7e-40
WP_001299745.1|3781255_3782185_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	35.0	8.8e-17
>prophage 276
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3794762	3799510	4726108		Salmonella_phage(50.0%)	5	NA	NA
WP_000445116.1|3794762_3795890_+	DUF1016 family protein	NA	A0A0U2BZN7	Salmonella_phage	88.5	4.7e-73
WP_000979882.1|3795949_3796414_-	YhcH/YjgK/YiaL family protein	NA	NA	NA	NA	NA
WP_000209011.1|3796410_3797286_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_000054239.1|3797282_3797972_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_000108459.1|3798019_3799510_-	sialic acid transporter NanT	NA	Q6JIH2	Burkholderia_virus	23.6	4.9e-09
>prophage 277
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3803214	3803712	4726108	protease	Pseudomonas_phage(100.0%)	1	NA	NA
WP_000366129.1|3803214_3803712_-|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	42.9	3.3e-26
>prophage 278
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3807678	3810203	4726108	protease	uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_001295271.1|3807678_3809046_+|protease	serine endoprotease DegQ	protease	A0A1B1IT49	uncultured_Mediterranean_phage	25.6	2.3e-21
WP_000497723.1|3809135_3810203_+	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1S5Y2X3	uncultured_archaeal_virus	24.2	6.8e-05
>prophage 279
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3826979	3828023	4726108		Organic_Lake_phycodnavirus(100.0%)	1	NA	NA
WP_000913396.1|3826979_3828023_-	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	22.3	6.7e-05
>prophage 280
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3838588	3839473	4726108		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001258895.1|3838588_3839473_+	adenine-specific DNA-methyltransferase	NA	M4QNN5	Ostreococcus_lucimarinus_virus	30.2	1.9e-24
>prophage 281
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3845977	3850131	4726108		uncultured_Mediterranean_phage(50.0%)	4	NA	NA
WP_000738568.1|3845977_3847003_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.8	1.8e-71
WP_000019655.1|3847070_3848252_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_001300681.1|3848261_3849365_+	amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_000078349.1|3849372_3850131_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	30.8	9.1e-20
>prophage 282
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3860624	3862096	4726108	tRNA	Synechococcus_phage(50.0%)	2	NA	NA
WP_000114984.1|3860624_3861134_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	41.9	3.9e-19
WP_000004473.1|3861148_3862096_+|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	35.7	1.4e-06
>prophage 283
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3883311	3885264	4726108		Vibrio_phage(100.0%)	1	NA	NA
WP_001326512.1|3883311_3885264_+	type II secretion system secretin GspD	NA	R9TEZ5	Vibrio_phage	30.9	9.2e-32
>prophage 284
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3897079	3902653	4726108		uncultured_Caudovirales_phage(50.0%)	7	NA	NA
WP_000031783.1|3897079_3898264_-	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
WP_000124700.1|3898334_3900449_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	27.5	5.2e-57
WP_001138043.1|3900545_3901016_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_000246815.1|3901112_3901487_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000903373.1|3901612_3901900_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_000820714.1|3901907_3902267_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	31.0	1.4e-10
WP_001209680.1|3902266_3902653_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	39.8	3.3e-18
>prophage 285
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3908223	3917764	4726108		Tupanvirus(25.0%)	9	NA	NA
WP_000634798.1|3908223_3910137_+	ABC transporter ATP-binding protein	NA	A0A2K9L0W2	Tupanvirus	33.5	4.3e-74
WP_000057356.1|3910136_3911159_+	hydrolase	NA	NA	NA	NA	NA
WP_000907085.1|3911152_3911371_+	YheU family protein	NA	A0A2H4J8A7	uncultured_Caudovirales_phage	40.3	3.1e-05
WP_001274680.1|3911424_3912294_+	phosphoribulokinase	NA	NA	NA	NA	NA
WP_001148908.1|3912348_3912753_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000242755.1|3913054_3913687_+	cAMP-activated global transcriptional regulator CRP	NA	NA	NA	NA	NA
WP_001295162.1|3913737_3915828_+	FUSC family protein	NA	H9YQA8	environmental_Halophage	100.0	1.7e-76
WP_000963792.1|3915894_3917115_-	bifunctional acetylornithine/succinyldiaminopimelate transaminase	NA	NA	NA	NA	NA
WP_000601847.1|3917200_3917764_-	aminodeoxychorismate synthase component 2	NA	A0A0P0IKJ1	Acinetobacter_phage	55.8	1.2e-61
>prophage 286
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3942011	3942848	4726108		Vibrio_phage(100.0%)	1	NA	NA
WP_000742143.1|3942011_3942848_-	adenine-specific DNA-methyltransferase	NA	A0A1S6L1V5	Vibrio_phage	49.1	4.9e-67
>prophage 287
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3959752	3963519	4726108		Bacillus_phage(66.67%)	3	NA	NA
WP_001265681.1|3959752_3961375_+	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	52.5	5.3e-142
WP_001253696.1|3961450_3962803_-	two-component system sensor histidine kinase EnvZ	NA	W8CYF6	Bacillus_phage	23.8	3.6e-11
WP_001157751.1|3962799_3963519_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	34.7	3.5e-29
>prophage 288
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3970101	3970980	4726108		Sodalis_phage(100.0%)	1	NA	NA
WP_000039062.1|3970101_3970980_+	recombination-promoting nuclease RpnA	NA	Q2A0A7	Sodalis_phage	52.8	1.9e-69
>prophage 289
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3977014	3979408	4726108		Iris_mild_mosaic_virus(100.0%)	1	NA	NA
WP_000081909.1|3977014_3979408_-	maltodextrin phosphorylase	NA	Q8B3H5	Iris_mild_mosaic_virus	42.5	4.3e-15
>prophage 290
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3982767	3984546	4726108		Ralstonia_phage(100.0%)	1	NA	NA
WP_172614342.1|3982767_3984546_-	RNA 3'-terminal phosphate cyclase	NA	A0A1L7N133	Ralstonia_phage	59.3	7.1e-116
>prophage 291
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	3990601	3993049	4726108		Dickeya_phage(100.0%)	1	NA	NA
WP_172614343.1|3990601_3993049_-	glycogen phosphorylase	NA	A0A140XAG6	Dickeya_phage	81.0	2.1e-33
>prophage 292
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4013059	4014870	4726108		Enterococcus_phage(50.0%)	2	NA	NA
WP_000073613.1|4013059_4013803_-	glycerophosphodiester phosphodiesterase	NA	A0A0S2MYI4	Enterococcus_phage	25.3	5.8e-11
WP_000907792.1|4013799_4014870_-	sn-glycerol 3-phosphate ABC transporter ATP binding protein UgpC	NA	G9BWD6	Planktothrix_phage	33.7	1.7e-19
>prophage 293
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4018413	4019896	4726108		Planktothrix_phage(50.0%)	2	NA	NA
WP_172614345.1|4018413_4019127_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivF	NA	G9BWD6	Planktothrix_phage	31.1	5.4e-14
WP_000082101.1|4019128_4019896_-	high-affinity branched-chain amino acid ABC transporter ATP-binding protein LivG	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	4.9e-13
>prophage 294
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4025618	4028437	4726108		Salicola_phage(50.0%)	3	NA	NA
WP_000130217.1|4025618_4026473_-	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	41.9	3.5e-44
WP_001042003.1|4026717_4027776_-	cell division protein FtsX	NA	NA	NA	NA	NA
WP_000617723.1|4027768_4028437_-	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	25.1	5.0e-14
>prophage 295
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4031440	4035572	4726108		Dickeya_phage(50.0%)	4	NA	NA
WP_000964718.1|4031440_4032067_+	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	61.9	1.2e-30
WP_000106552.1|4032140_4034339_+	Zn(II)/Cd(II)/Pb(II) translocating P-type ATPase ZntA	NA	E4ZFI9	Streptococcus_phage	38.3	5.5e-118
WP_000130621.1|4034440_4034686_-	sulfurtransferase TusA	NA	A0A140XB86	Dickeya_phage	83.3	8.0e-10
WP_001100469.1|4034906_4035572_+	7-cyano-7-deazaguanine/7-aminomethyl-7- deazaguanine transporter	NA	A0A2I7SAW6	Vibrio_phage	53.1	2.8e-57
>prophage 296
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4043465	4049117	4726108		Bacillus_virus(50.0%)	3	NA	NA
WP_000173631.1|4043465_4044272_+	nickel import ATP-binding protein NikE	NA	G3M9Y6	Bacillus_virus	29.1	2.6e-17
WP_001190062.1|4044277_4044679_+	nickel-responsive transcriptional regulator NikR	NA	NA	NA	NA	NA
WP_000015301.1|4044881_4049117_+	rhs element protein RhsB	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	32.3	9.6e-26
>prophage 297
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4053269	4056005	4726108		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000149156.1|4053269_4056005_-	ribosome-associated ATPase/putative transporter RbbA	NA	A0A2H4PQG7	Staphylococcus_phage	30.6	5.4e-22
>prophage 298
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4069606	4071649	4726108		Indivirus(100.0%)	1	NA	NA
WP_172614347.1|4069606_4071649_-	oligopeptidase A	NA	A0A1V0SD92	Indivirus	23.3	2.0e-45
>prophage 299
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4074994	4077129	4726108		uncultured_Caudovirales_phage(100.0%)	3	NA	NA
WP_000008957.1|4074994_4075348_+	arsenical resistance operon transcriptional regulator ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	9.7e-25
WP_000922639.1|4075401_4076691_+	arsenite/antimonite:H(+) antiporter ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.5	4.6e-173
WP_000065769.1|4076703_4077129_+	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	70.7	1.5e-51
>prophage 300
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4080522	4081170	4726108		Bacillus_virus(100.0%)	1	NA	NA
WP_001296814.1|4080522_4081170_-	MgtC/SapB family protein	NA	G3MA03	Bacillus_virus	38.5	6.1e-17
>prophage 301
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4123014	4124999	4726108		Bacillus_virus(50.0%)	2	NA	NA
WP_000107012.1|4123014_4124019_-	dipeptide ABC transporter ATP binding subunit DppF	NA	G3M9Y6	Bacillus_virus	29.9	1.1e-17
WP_001196486.1|4124015_4124999_-	dipeptide ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	3.9e-15
>prophage 302
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4135064	4137398	4726108		Escherichia_phage(100.0%)	1	NA	NA
WP_000013950.1|4135064_4137398_-	biotin sulfoxide reductase	NA	A0A077SK27	Escherichia_phage	29.2	2.7e-70
>prophage 303
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4141052	4143052	4726108	transposase	Morganella_phage(50.0%)	3	NA	NA
WP_000014594.1|4141052_4141265_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	72.9	2.7e-22
WP_001135732.1|4141451_4141604_-	type I toxin-antitoxin system toxin HokA	NA	NA	NA	NA	NA
WP_085947770.1|4141683_4143052_+|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	100.0	1.3e-112
>prophage 304
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4146890	4147886	4726108		Escherichia_coli_O157_typing_phage(100.0%)	1	NA	NA
WP_001182650.1|4146890_4147886_+	O-acetyltransferase WecH	NA	A0A0F6TJ51	Escherichia_coli_O157_typing_phage	26.7	9.1e-12
>prophage 305
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4153204	4154746	4726108		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001146479.1|4153204_4154746_+	D-xylose ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.3	2.5e-16
>prophage 306
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4179020	4180865	4726108		Tupanvirus(100.0%)	1	NA	NA
WP_000582468.1|4179020_4180865_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.7	5.6e-15
>prophage 307
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4186178	4187117	4726108		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_001360212.1|4186178_4187117_+	RHS repeat protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	46.7	4.4e-24
>prophage 308
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4203142	4212697	4726108		Rhizobium_phage(16.67%)	9	NA	NA
WP_000024392.1|4203142_4203394_-	glutaredoxin 3	NA	V9QKN6	Rhizobium_phage	54.8	2.0e-16
WP_001156181.1|4203535_4203967_-	rhodanese-like domain-containing protein	NA	NA	NA	NA	NA
WP_000116565.1|4204211_4205756_+	2,3-bisphosphoglycerate-independent phosphoglycerate mutase	NA	NA	NA	NA	NA
WP_001214147.1|4205765_4207049_+	murein hydrolase activator EnvC	NA	G9BW84	Planktothrix_phage	34.3	1.0e-07
WP_000483856.1|4207052_4208012_+	divergent polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000982093.1|4207998_4209033_-	UDP-glucuronate:LPS(HepIII) glycosyltransferase	NA	A0A1V0SAH6	Catovirus	28.7	5.8e-09
WP_000645982.1|4209271_4210297_-	L-threonine 3-dehydrogenase	NA	R9TPW0	Vibrio_phage	84.6	2.1e-19
WP_001213802.1|4210306_4211503_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	29.1	1.1e-35
WP_000587766.1|4211716_4212697_+	ADP-glyceromanno-heptose 6-epimerase	NA	E3SL51	Synechococcus_phage	39.3	1.2e-35
>prophage 309
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4227862	4232425	4726108		uncultured_Mediterranean_phage(25.0%)	7	NA	NA
WP_001171873.1|4227862_4228342_+	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	42.6	6.3e-27
WP_001114529.1|4228380_4229190_-	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	F8WPX6	Bacillus_phage	32.2	2.6e-25
WP_001051798.1|4229287_4229455_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000091955.1|4229475_4229712_-	50S ribosomal protein L28	NA	NA	NA	NA	NA
WP_001298959.1|4229928_4230597_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_000050139.1|4230768_4231989_+	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	33.9	6.5e-44
WP_000976070.1|4231966_4232425_+	dUTP diphosphatase	NA	Q2NP83	Xanthomonas_phage	59.5	9.6e-49
>prophage 310
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4235753	4250861	4726108	integrase	Morganella_phage(25.0%)	17	4231641:4231654	4252036:4252049
4231641:4231654	attL	AAAGCAGGCCACGC	NA	NA	NA	NA
WP_072663512.1|4235753_4237010_+|integrase	site-specific integrase	integrase	A0A1W6JPG6	Morganella_phage	64.1	6.3e-159
WP_072663523.1|4237408_4237816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097485641.1|4237890_4238067_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_072663513.1|4238063_4238525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072663514.1|4238592_4239462_+	toprim domain-containing protein	NA	A0A088F8A2	Idiomarinaceae_phage	36.5	2.6e-34
WP_157921716.1|4239458_4241165_+	DUF927 domain-containing protein	NA	A0A1B0VP75	Pseudomonas_phage	34.4	3.3e-54
WP_126675387.1|4241465_4241906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_072021748.1|4241898_4242198_+	TM2 domain-containing protein	NA	M4ZS56	Bacillus_phage	46.9	2.6e-10
WP_058055393.1|4242715_4243123_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097485642.1|4243119_4243335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000935764.1|4243453_4243735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001336364.1|4244110_4244935_+	DNA damage-inducible protein D	NA	A0A1W6JPJ7	Morganella_phage	78.0	2.5e-95
WP_000924289.1|4245226_4245844_+	trimeric intracellular cation channel family protein	NA	NA	NA	NA	NA
WP_124064214.1|4245840_4247523_-	NAD-dependent DNA ligase LigB	NA	F8SJM3	Pseudomonas_phage	22.3	1.1e-22
WP_001295237.1|4247780_4248404_+	guanylate kinase	NA	K4JYM5	Abalone_herpesvirus	34.5	4.1e-18
WP_000135058.1|4248458_4248734_+	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000280488.1|4248752_4250861_+	bifunctional GTP diphosphokinase/guanosine-3',5'-bis pyrophosphate 3'-pyrophosphohydrolase	NA	A0A291L9W9	Bordetella_phage	34.5	4.8e-10
4252036:4252049	attR	AAAGCAGGCCACGC	NA	NA	NA	NA
>prophage 311
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4255294	4256686	4726108		environmental_Halophage(100.0%)	1	NA	NA
WP_001295238.1|4255294_4256686_+	xanthine/proton symporter XanP	NA	H9YQ34	environmental_Halophage	100.0	1.4e-71
>prophage 312
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4268804	4270139	4726108		Moraxella_phage(100.0%)	1	NA	NA
WP_001403836.1|4268804_4270139_-	adenine permease AdeQ	NA	A0A0R6PHV4	Moraxella_phage	37.2	1.1e-65
>prophage 313
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4277445	4286466	4726108		Micromonas_sp._RCC1109_virus(25.0%)	10	NA	NA
WP_000168475.1|4277445_4279134_-	acetolactate synthase large subunit	NA	E5EQ70	Micromonas_sp._RCC1109_virus	29.7	3.2e-57
WP_001300753.1|4279239_4279338_-	ilvB operon leader peptide IvbL	NA	NA	NA	NA	NA
WP_001054909.1|4279902_4279992_+	type I toxin-antitoxin system toxin TisB	NA	NA	NA	NA	NA
WP_000828746.1|4280271_4281456_+	multidrug efflux MFS transporter EmrD	NA	S4TR35	Salmonella_phage	23.5	8.9e-14
WP_000148061.1|4281463_4281961_-	radical SAM protein	NA	NA	NA	NA	NA
WP_001113432.1|4281957_4282320_-	DUF202 domain-containing protein	NA	NA	NA	NA	NA
WP_000703959.1|4282309_4282657_-	YidH family protein	NA	NA	NA	NA	NA
WP_000511289.1|4282764_4283214_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097308423.1|4283260_4284754_-	sulfatase-like hydrolase/transferase	NA	A0A2K9L1A5	Tupanvirus	25.8	7.7e-31
WP_064669473.1|4284750_4286466_-	solute:sodium symporter family transporter	NA	A0A240F3J2	Aeromonas_phage	29.6	5.6e-41
>prophage 314
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4292818	4293772	4726108		Synechococcus_phage(50.0%)	2	NA	NA
WP_001243431.1|4292818_4293247_-	heat shock chaperone IbpB	NA	A0A1D8KPX5	Synechococcus_phage	36.4	2.1e-13
WP_001243437.1|4293358_4293772_-	heat shock chaperone IbpA	NA	A0A1D7SU06	Cyanophage	36.2	1.0e-17
>prophage 315
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4298199	4299348	4726108		Oenococcus_phage(100.0%)	1	NA	NA
WP_000705001.1|4298199_4299348_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	32.8	3.6e-52
>prophage 316
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4304054	4311423	4726108		Bacillus_virus(33.33%)	8	NA	NA
WP_000072067.1|4304054_4306469_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	34.6	3.7e-115
WP_000060112.1|4306497_4307571_-	DNA replication/repair protein RecF	NA	NA	NA	NA	NA
WP_000673464.1|4307570_4308671_-	DNA polymerase III subunit beta	NA	B4UTW9	Rhizobium_phage	35.0	4.1e-53
WP_000059111.1|4308675_4310079_-	chromosomal replication initiator protein DnaA	NA	NA	NA	NA	NA
WP_120795392.1|4310375_4310456_+	protein YsdD	NA	NA	NA	NA	NA
WP_000831330.1|4310685_4310826_+	50S ribosomal protein L34	NA	NA	NA	NA	NA
WP_000239730.1|4310842_4311202_+	ribonuclease P protein component	NA	NA	NA	NA	NA
WP_001307474.1|4311165_4311423_+	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	56.7	5.4e-17
>prophage 317
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4321621	4322959	4726108		Moraxella_phage(100.0%)	1	NA	NA
WP_000019348.1|4321621_4322959_-	adenine permease AdeP	NA	A0A0R6PHV4	Moraxella_phage	35.7	2.6e-62
>prophage 318
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4333942	4341550	4726108		Bacillus_phage(25.0%)	6	NA	NA
WP_000063125.1|4333942_4334716_-	phosphate ABC transporter ATP-binding protein PstB	NA	W8CYL7	Bacillus_phage	31.7	4.0e-15
WP_001251998.1|4334898_4335789_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_000741625.1|4335788_4336748_-	phosphate ABC transporter permease PstC	NA	NA	NA	NA	NA
WP_000867146.1|4336834_4337875_-	phosphate ABC transporter substrate-binding protein PstS	NA	A0A1D7SRJ6	Cyanophage	38.3	2.7e-51
WP_000334099.1|4338188_4340018_-	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	A7IW18	Paramecium_bursaria_Chlorella_virus	43.4	1.9e-132
WP_172614353.1|4340179_4341550_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7I9	Chrysochromulina_ericina_virus	36.7	1.1e-34
>prophage 319
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4353504	4354497	4726108		Heterosigma_akashiwo_virus(100.0%)	1	NA	NA
WP_000845104.1|4353504_4354497_+	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.7	2.2e-50
>prophage 320
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4357665	4363518	4726108		Paramecium_bursaria_Chlorella_virus(33.33%)	5	NA	NA
WP_000102319.1|4357665_4359534_+	low affinity potassium transporter Kup	NA	M1I6H8	Paramecium_bursaria_Chlorella_virus	30.6	6.0e-65
WP_001301979.1|4359700_4360120_+	D-ribose pyranase	NA	NA	NA	NA	NA
WP_000387770.1|4360127_4361633_+	ribose ABC transporter ATP-binding protein RbsA	NA	G3M9Y6	Bacillus_virus	27.7	5.1e-14
WP_000211858.1|4361637_4362603_+	ribose ABC transporter permease	NA	NA	NA	NA	NA
WP_001056273.1|4362627_4363518_+	ribose ABC transporter substrate-binding protein RbsB	NA	C6ZCU4	Enterobacteria_phage	23.4	4.3e-05
>prophage 321
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4376909	4378556	4726108		Ostreococcus_lucimarinus_virus(100.0%)	1	NA	NA
WP_001012607.1|4376909_4378556_+	acetolactate synthase 2 catalytic subunit	NA	A0A0P0CDR3	Ostreococcus_lucimarinus_virus	31.8	1.6e-66
>prophage 322
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4387028	4392442	4726108		Bacillus_phage(33.33%)	4	NA	NA
WP_001238886.1|4387028_4389050_+	DNA helicase Rep	NA	A7KV33	Bacillus_phage	37.6	3.8e-113
WP_001295254.1|4389096_4390581_-	guanosine-5'-triphosphate,3'-diphosphate diphosphatase	NA	NA	NA	NA	NA
WP_000047499.1|4390716_4391982_-	ATP-dependent RNA helicase RhlB	NA	E3T5E1	Cafeteria_roenbergensis_virus	31.2	3.1e-41
WP_001280776.1|4392112_4392442_+	thioredoxin TrxA	NA	A0A1V0SD63	Indivirus	38.5	4.2e-14
>prophage 323
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4396484	4402628	4726108		Enterobacteria_phage(40.0%)	6	NA	NA
WP_001340422.1|4396484_4397615_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	32.8	3.9e-27
WP_000006621.1|4397611_4398874_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HNJ7	Paramecium_bursaria_Chlorella_virus	27.0	1.0e-23
WP_001226601.1|4398873_4399941_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.4	2.3e-101
WP_172614354.1|4399959_4400841_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	66.0	3.3e-106
WP_001145183.1|4400818_4401493_+	dTDP-4-amino-4,6-dideoxy-D-galactose acyltransferase	NA	NA	NA	NA	NA
WP_000612043.1|4401497_4402628_+	dTDP-4-amino-4,6-dideoxygalactose transaminase	NA	A0A0F7LAY0	uncultured_marine_virus	41.7	2.0e-18
>prophage 324
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4410703	4412359	4726108		Tetraselmis_virus(100.0%)	1	NA	NA
WP_000395863.1|4410703_4412359_-	arylsulfatase AslA	NA	A0A2P0VMN7	Tetraselmis_virus	29.7	2.3e-44
>prophage 325
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4422656	4426515	4726108		Bacillus_phage(100.0%)	3	NA	NA
WP_000130691.1|4422656_4423553_+	tyrosine recombinase XerC	NA	A0A142F1N9	Bacillus_phage	29.6	3.8e-25
WP_001213584.1|4423552_4424269_+	5-amino-6-(5-phospho-D-ribitylamino)uracil phosphatase YigB	NA	NA	NA	NA	NA
WP_000383406.1|4424352_4426515_+	DNA helicase II	NA	A7KV33	Bacillus_phage	37.2	4.6e-117
>prophage 326
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4432233	4434063	4726108		Catovirus(100.0%)	1	NA	NA
WP_000035581.1|4432233_4434063_+	ATP-dependent DNA helicase RecQ	NA	A0A1V0SBK0	Catovirus	37.8	7.4e-84
>prophage 327
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4446595	4449882	4726108		Ostreococcus_lucimarinus_virus(50.0%)	4	NA	NA
WP_000187530.1|4446595_4448236_+	ubiquinone biosynthesis regulatory protein kinase UbiB	NA	M4R0M8	Ostreococcus_lucimarinus_virus	29.0	8.2e-42
WP_064669546.1|4448314_4448584_+	Sec-independent protein translocase subunit TatA	NA	NA	NA	NA	NA
WP_000459594.1|4448587_4449103_+	Sec-independent protein translocase subunit TatB	NA	NA	NA	NA	NA
WP_000109943.1|4449105_4449882_+	Sec-independent protein translocase subunit TatC	NA	A0A1B1IVR7	uncultured_Mediterranean_phage	32.6	5.1e-26
>prophage 328
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4458763	4459378	4726108		Streptococcus_phage(100.0%)	1	NA	NA
WP_124064301.1|4458763_4459378_+	IMPACT family protein	NA	A0A1X9I5T8	Streptococcus_phage	33.0	2.8e-19
>prophage 329
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4473226	4476013	4726108		uncultured_virus(100.0%)	1	NA	NA
WP_000250006.1|4473226_4476013_+	DNA polymerase I	NA	A0A218MKQ4	uncultured_virus	32.1	1.7e-71
>prophage 330
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4480129	4482600	4726108		Bacillus_thuringiensis_phage(50.0%)	2	NA	NA
WP_001188777.1|4480129_4481539_-	nitrogen regulation protein NR(I)	NA	Q56AR1	Bacillus_thuringiensis_phage	28.7	2.4e-05
WP_000190577.1|4481550_4482600_-	nitrogen regulation protein NR(II)	NA	Q8QKV7	Ectocarpus_siliculosus_virus	26.1	2.5e-07
>prophage 331
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4498935	4501715	4726108		Staphylococcus_phage(50.0%)	3	NA	NA
WP_000718893.1|4498935_4499832_-	sulfolactaldehyde 3-reductase	NA	D2K0C8	Staphylococcus_phage	90.7	1.3e-60
WP_021578865.1|4499999_4500896_+	sulfofructose kinase	NA	NA	NA	NA	NA
WP_000059678.1|4500929_4501715_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.9	8.2e-24
>prophage 332
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4509032	4512083	4726108		Escherichia_phage(100.0%)	1	NA	NA
WP_010723259.1|4509032_4512083_-	formate dehydrogenase-N subunit alpha	NA	A0A077SK27	Escherichia_phage	23.8	1.1e-07
>prophage 333
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4527069	4531930	4726108		Bacillus_thuringiensis_phage(33.33%)	5	NA	NA
WP_000122641.1|4527069_4527690_+	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	59.3	8.4e-64
WP_001166063.1|4527949_4528933_+	2-keto-3-deoxygluconate transporter	NA	NA	NA	NA	NA
WP_001270260.1|4529081_4529756_+	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_000580417.1|4529861_4531235_-	envelope stress sensor histidine kinase CpxA	NA	W8CYF6	Bacillus_phage	25.9	3.8e-16
WP_172614357.1|4531231_4531930_-	envelope stress response regulator transcription factor CpxR	NA	Q6XM27	Feldmannia_irregularis_virus	30.3	5.3e-06
>prophage 334
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4543504	4548007	4726108		Paramecium_bursaria_Chlorella_virus(50.0%)	5	NA	NA
WP_000084268.1|4543504_4544350_-	glycerol uptake facilitator protein GlpF	NA	M1HWZ0	Paramecium_bursaria_Chlorella_virus	28.0	4.4e-15
WP_001296623.1|4544774_4545020_+	septal ring assembly protein ZapB	NA	NA	NA	NA	NA
WP_000872908.1|4545104_4545590_-	ribonuclease E activity regulator RraA	NA	NA	NA	NA	NA
WP_000139496.1|4545682_4546609_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_001293341.1|4546675_4548007_-	HslU--HslV peptidase ATPase subunit	NA	A0A191ZC11	Erwinia_phage	29.9	1.7e-45
>prophage 335
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4565305	4572552	4726108		Synechococcus_phage(33.33%)	5	NA	NA
WP_000424840.1|4565305_4565968_-	fructose-6-phosphate aldolase	NA	A0A0E3F0E2	Synechococcus_phage	34.6	5.5e-29
WP_001174077.1|4565979_4568481_-	phosphoenolpyruvate--protein phosphotransferase	NA	A0A1V0SGR7	Hokovirus	26.9	1.0e-11
WP_001004446.1|4568789_4569869_+	PTS fructose transporter subunit EIIC	NA	NA	NA	NA	NA
WP_000161265.1|4569883_4570204_+	PTS fructose-like transporter subunit IIB	NA	NA	NA	NA	NA
WP_000184811.1|4570254_4572552_+	formate C-acetyltransferase	NA	A0A1S6UAD4	Serratia_phage	48.1	4.6e-06
>prophage 336
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4589898	4591743	4726108		Acinetobacter_phage(100.0%)	1	NA	NA
WP_000591359.1|4589898_4591743_+	TonB-dependent vitamin B12 receptor BtuB	NA	A0A0P0I887	Acinetobacter_phage	32.0	7.1e-10
>prophage 337
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4600335	4603388	4726108		uncultured_Mediterranean_phage(50.0%)	2	NA	NA
WP_000023081.1|4600335_4601286_-	type I pantothenate kinase	NA	A0A1B1ISL9	uncultured_Mediterranean_phage	32.0	8.7e-28
WP_000031784.1|4602203_4603388_+	elongation factor Tu	NA	A0A2K9L516	Tupanvirus	26.1	4.4e-13
>prophage 338
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4607504	4615833	4726108		Chrysochromulina_ericina_virus(50.0%)	2	NA	NA
WP_000263098.1|4607504_4611533_+	DNA-directed RNA polymerase subunit beta	NA	A0A0N9R0J7	Chrysochromulina_ericina_virus	29.0	9.4e-23
WP_000653944.1|4611609_4615833_+	DNA-directed RNA polymerase subunit beta'	NA	A0A2I7QNZ7	Vibrio_phage	26.5	2.5e-66
>prophage 339
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4625049	4626813	4726108		Klosneuvirus(50.0%)	3	NA	NA
WP_000362388.1|4625049_4625721_+	deoxyribonuclease V	NA	A0A1V0SJW5	Klosneuvirus	28.7	6.1e-20
WP_000940106.1|4625763_4626354_+	YjaG family protein	NA	NA	NA	NA	NA
WP_001044513.1|4626540_4626813_+	DNA-binding protein HU-alpha	NA	A7KV42	Bacillus_phage	58.9	3.2e-20
>prophage 340
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4632202	4633792	4726108		Prochlorococcus_phage(100.0%)	1	NA	NA
WP_001187559.1|4632202_4633792_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	47.7	2.9e-68
>prophage 341
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4650184	4653868	4726108		Dickeya_phage(100.0%)	1	NA	NA
WP_000096011.1|4650184_4653868_+	methionine synthase	NA	A0A140XBC7	Dickeya_phage	90.2	1.3e-26
>prophage 342
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4673140	4674256	4726108		Mycoplasma_phage(100.0%)	1	NA	NA
WP_000179165.1|4673140_4674256_+	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
>prophage 343
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4683471	4684080	4726108		Lactococcus_phage(100.0%)	1	NA	NA
WP_000646078.1|4683471_4684080_+	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
>prophage 344
NZ_CP053736	Escherichia coli strain CP8-3_Sichuan chromosome, complete genome	4726108	4688025	4725618	4726108	holin,head,terminase,capsid,protease,tail,portal,tRNA,plate	Shigella_phage(54.39%)	59	NA	NA
WP_096933068.1|4688025_4688193_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_096933069.1|4688354_4688924_+	hypothetical protein	NA	G8C7Q8	Escherichia_phage	45.0	1.2e-37
WP_096933070.1|4688932_4689373_+	type II toxin-antitoxin system YafO family toxin	NA	G8C7Q9	Escherichia_phage	64.6	1.2e-45
WP_096933071.1|4689421_4689682_-	pyocin activator PrtN family protein	NA	S5MQM5	Escherichia_phage	90.7	4.3e-38
WP_172614373.1|4689718_4690291_-	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	96.8	1.4e-105
WP_172614361.1|4690290_4690938_-	ead/Ea22-like family protein	NA	Q5G8U8	Enterobacteria_phage	50.3	2.3e-32
WP_061336294.1|4690934_4691420_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	77.1	4.4e-68
WP_172614362.1|4691416_4691767_-	Eae protein	NA	A0A0P0ZBF8	Stx2-converting_phage	95.7	2.8e-56
WP_000008200.1|4691757_4692294_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	100.0	4.3e-101
WP_000081287.1|4692421_4693246_-	DUF2303 family protein	NA	U5P439	Shigella_phage	100.0	6.0e-150
WP_000135682.1|4693311_4693674_-	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_072037893.1|4694274_4694550_-	hypothetical protein	NA	Q8SBF7	Shigella_phage	97.8	5.4e-47
WP_001083098.1|4694558_4694762_-	hypothetical protein	NA	A0A1C9II97	Salmonella_phage	75.5	2.0e-14
WP_000859462.1|4694933_4695608_-	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000649477.1|4695698_4695899_+	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000515860.1|4695942_4696494_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_021823601.1|4696490_4697327_+	ash family protein	NA	Q8SBF3	Shigella_phage	98.9	2.3e-149
WP_172614363.1|4697319_4697556_+	hypothetical protein	NA	A0A291AX25	Escherichia_phage	97.4	7.9e-39
WP_029396281.1|4697552_4698371_+	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	5.2e-122
WP_001332382.1|4698367_4698862_+	PerC family transcriptional regulator	NA	A0A0P0ZCF0	Stx2-converting_phage	99.4	1.9e-87
WP_038988926.1|4698861_4699515_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.1	4.3e-127
WP_000210144.1|4699511_4699838_+	LexA repressor	NA	A0A291AWY9	Escherichia_phage	99.1	9.2e-54
WP_000767113.1|4699834_4700224_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	100.0	7.1e-69
WP_001061383.1|4700243_4701053_+	KilA-N domain-containing protein	NA	Q8SBE6	Shigella_phage	99.3	7.4e-153
WP_001436142.1|4701060_4702050_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	5.6e-195
WP_001047106.1|4702063_4702816_+	antitermination protein	NA	Q8SBE4	Shigella_phage	99.6	1.1e-137
WP_000917724.1|4703068_4703272_+	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	6.1e-32
WP_000799659.1|4703422_4704475_+	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	99.1	6.8e-207
WP_001120502.1|4704551_4704887_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	100.0	5.2e-60
WP_016244989.1|4704890_4705367_+	glycoside hydrolase family protein	NA	S5FV07	Shigella_phage	97.5	2.4e-87
WP_024249233.1|4705350_4705743_+	DUF2570 domain-containing protein	NA	Q8SBD9	Shigella_phage	89.2	3.1e-56
WP_063048012.1|4705627_4705900_+	hypothetical protein	NA	Q8SBD8	Shigella_phage	98.9	6.3e-40
WP_032172868.1|4705926_4706277_+	HNH endonuclease	NA	Q8SBD7	Shigella_phage	99.1	3.6e-64
WP_123005419.1|4706402_4706888_+|terminase	phage terminase small subunit P27 family	terminase	A0A1B3B2F4	Salmonella_phage	98.8	7.9e-86
WP_065312442.1|4707138_4708635_+|terminase	terminase large subunit	terminase	A0A1C9IIA1	Salmonella_phage	99.6	1.7e-299
WP_000605606.1|4708646_4708829_+	hypothetical protein	NA	S5FXQ9	Shigella_phage	100.0	1.7e-25
WP_000466255.1|4708828_4710070_+|portal	phage portal protein	portal	U5P411	Shigella_phage	99.8	2.0e-242
WP_001193632.1|4710047_4710698_+|head,protease	HK97 family phage prohead protease	head,protease	U5P4H2	Shigella_phage	99.5	1.6e-118
WP_000257507.1|4710712_4711918_+|capsid	phage major capsid protein	capsid	M1FPN2	Enterobacteria_phage	100.0	1.8e-224
WP_000601360.1|4711967_4712168_+	hypothetical protein	NA	S5FNU1	Shigella_phage	97.0	3.8e-26
WP_000927719.1|4712170_4712494_+|head,tail	phage gp6-like head-tail connector protein	head,tail	U5P072	Shigella_phage	99.1	1.1e-56
WP_000702401.1|4712490_4712901_+|head	phage head closure protein	head	M1FJ87	Enterobacteria_phage	94.9	8.0e-71
WP_000224835.1|4712875_4713382_+	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	92.9	1.3e-83
WP_000779292.1|4713378_4713939_+	hypothetical protein	NA	M1FQV7	Enterobacteria_phage	100.0	1.0e-105
WP_000497753.1|4713947_4714118_+	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	98.2	2.7e-25
WP_113446785.1|4714101_4715598_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	M1FN90	Enterobacteria_phage	99.8	2.2e-275
WP_000090993.1|4715597_4715954_+|tail	phage tail tube protein	tail	U5P076	Shigella_phage	99.2	1.2e-62
WP_000571712.1|4715950_4716274_+|tail	phage tail assembly protein	tail	U5P0R5	Shigella_phage	100.0	6.5e-52
WP_032277691.1|4716358_4718260_+|tail	phage tail tape measure protein	tail	U5P420	Shigella_phage	99.4	0.0e+00
WP_032277692.1|4718324_4718813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172614364.1|4718869_4720243_+	DNA circularization N-terminal domain-containing protein	NA	U5P4I0	Shigella_phage	97.1	1.4e-241
WP_172614365.1|4720239_4721319_+|plate	baseplate protein	plate	U5P0H6	Shigella_phage	99.4	3.4e-206
WP_001522208.1|4721318_4721867_+|plate	phage baseplate assembly protein	plate	U5P081	Shigella_phage	99.5	3.0e-97
WP_000424732.1|4721866_4722292_+	phage GP46 family protein	NA	U5P0R9	Shigella_phage	100.0	2.3e-81
WP_038988910.1|4722278_4723337_+|plate	baseplate J/gp47 family protein	plate	M1FQW3	Enterobacteria_phage	99.4	5.0e-202
WP_000383572.1|4723327_4723912_+	YmfQ family protein	NA	O22003	Shigella_phage	99.5	2.4e-113
WP_172614366.1|4723915_4724596_+	hypothetical protein	NA	U5P0I1	Shigella_phage	60.9	2.5e-61
WP_001045291.1|4724600_4725044_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	46.4	3.3e-22
WP_074599212.1|4725015_4725618_-|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	87.2	1.4e-92
>prophage 1
NZ_CP053738	Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFIB, complete sequence	75733	1204	61459	75733	integrase,transposase	Salmonella_phage(18.18%)	58	NA	NA
WP_077248828.1|1204_2173_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	2.8e-183
WP_033548869.1|2339_2756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001039462.1|3340_3676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001515192.1|3684_3876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000807690.1|5003_5759_+	replication initiation protein RepE	NA	I3WF20	Macacine_betaherpesvirus	96.0	4.5e-136
WP_160784086.1|6883_7024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000079938.1|7096_7366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_101968911.1|7383_8073_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	99.4	2.2e-89
WP_032193599.1|8102_8807_+	replication initiation protein	NA	I3WF20	Macacine_betaherpesvirus	28.7	6.4e-20
WP_000105383.1|9400_10837_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001067858.1|11103_11808_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000429836.1|11854_12289_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|12360_12711_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|12724_13000_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|13035_13458_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|13509_15204_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_168999444.1|15221_15584_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000993386.1|15580_15817_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|15852_16521_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|17910_18615_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_032492336.1|19064_20294_+	macrolide efflux MFS transporter Mef(B)	NA	A0A1B0RXG2	Streptococcus_phage	39.0	2.1e-74
WP_000612791.1|20439_21303_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	31.0	2.5e-05
WP_001354008.1|21340_21586_+	GrpB family protein	NA	NA	NA	NA	NA
WP_000034420.1|22054_22846_+	sulfonamide-resistant dihydropteroate synthase Sul3	NA	A0A0B5J4J5	Pandoravirus	26.5	1.2e-14
WP_109023896.1|22848_23124_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000800531.1|24025_24358_-	quaternary ammonium compound efflux SMR transporter QacL	NA	NA	NA	NA	NA
WP_001206316.1|24527_25319_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000095725.1|25411_26671_-	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206356.1|26932_27724_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|27729_28020_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|28131_28629_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_000845039.1|28773_29787_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|29989_30340_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001161490.1|30515_31076_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_001138014.1|31079_34046_+|transposase	Tn3-like element TnAs1 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	100.0	0.0e+00
WP_000844627.1|34103_34346_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001493764.1|34377_35028_-	tetracycline resistance transcriptional repressor TetR(A)	NA	NA	NA	NA	NA
WP_001493765.1|35133_36333_+	tetracycline efflux MFS transporter Tet(A)	NA	NA	NA	NA	NA
WP_000058717.1|36364_37249_-	EamA family transporter	NA	NA	NA	NA	NA
WP_001214976.1|37386_37794_-	cysteine hydrolase	NA	NA	NA	NA	NA
WP_072656931.1|39595_41227_-	copper resistance system multicopper oxidase	NA	NA	NA	NA	NA
WP_001023231.1|41461_41911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000287499.1|42185_42923_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	31.9	1.3e-10
WP_000843501.1|42956_43154_-	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_011251358.1|43194_45672_-	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.0	3.8e-83
WP_000758221.1|45769_46210_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011251357.1|46296_49443_-	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.4	1.2e-60
WP_001398209.1|49453_50746_-	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_001246155.1|50859_51213_-	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_063107410.1|51240_52626_-	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_000697965.1|52815_53496_+	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	36.0	1.2e-31
WP_000555737.1|53488_54964_+	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_000790483.1|55214_55646_+	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_000694953.1|55789_56140_+	DUF305 domain-containing protein	NA	A0A218MND9	uncultured_virus	54.3	1.9e-20
WP_001372261.1|56528_57437_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_011251353.1|58074_59049_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_000796235.1|59979_60651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022631000.1|60670_61459_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	92.0	5.5e-52
>prophage 1
NZ_CP053737	Escherichia coli strain CP8-3_Sichuan plasmid pCP8-3-IncFII, complete sequence	87125	1988	29536	87125	transposase	Escherichia_phage(45.45%)	18	NA	NA
WP_001067858.1|1988_2693_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_024198294.1|3048_3840_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA22	NA	NA	NA	NA	NA
WP_000131886.1|4006_4906_+	aminoglycoside N-acetyltransferase AAC(3)-VIa	NA	NA	NA	NA	NA
WP_000535481.1|5112_5433_+	co-chaperone GroES	NA	A0A221S4G8	uncultured_virus	47.9	1.0e-17
WP_000719078.1|5488_7126_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	60.6	1.8e-174
WP_001137772.1|7314_8844_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001067858.1|9784_10489_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_000147567.1|10762_11323_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_001067858.1|11547_12252_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_001447541.1|13097_13982_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_094322497.1|14198_15413_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	5.5e-19
WP_001067855.1|16507_17212_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001814923.1|17977_18094_+	tetracycline resistance determinant leader peptide	NA	NA	NA	NA	NA
WP_025989258.1|18109_20029_+	tetracycline resistance ribosomal protection protein Tet(M)	NA	A0A2K5B2A5	Erysipelothrix_phage	96.4	0.0e+00
WP_001067858.1|23346_24051_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_094307857.1|24322_25894_+	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2I4R674	Erysipelothrix_phage	25.0	6.1e-18
WP_001516695.1|26708_27365_+	quinolone resistance pentapeptide repeat protein QnrS1	NA	NA	NA	NA	NA
WP_001493761.1|28144_29536_-|transposase	ISKra4-like element ISKpn19 family transposase	transposase	NA	NA	NA	NA
