The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053785	Escherichia coli isolate 2-101 chromosome, complete genome	4739049	1064447	1077630	4739049		Escherichia_phage(50.0%)	12	NA	NA
WP_001374723.1|1064447_1065209_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	48.0	2.0e-59
WP_000254708.1|1065202_1065829_+	protein-L-isoaspartate O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	49.7	5.7e-36
WP_001272592.1|1065968_1067108_+	murein hydrolase activator NlpD	NA	D7RWE0	Brochothrix_phage	35.6	1.7e-06
WP_000081550.1|1067170_1068163_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.6	6.1e-32
WP_000104456.1|1068256_1069621_-	GntP family transporter	NA	NA	NA	NA	NA
WP_001136918.1|1069709_1070486_-	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_001278994.1|1070490_1071129_-	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
WP_000590392.1|1071125_1072388_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_000847985.1|1072384_1073293_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.9	3.0e-118
WP_001297141.1|1073488_1074256_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	3.3e-70
WP_001141340.1|1074306_1074963_-	protein-serine/threonine phosphatase	NA	A0A222YWF0	Escherichia_phage	46.3	8.0e-49
WP_001272924.1|1075068_1077630_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.6	1.7e-30
>prophage 2
NZ_CP053785	Escherichia coli isolate 2-101 chromosome, complete genome	4739049	1686798	1696240	4739049		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569361.1|1686798_1687725_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.7e-23
WP_000783120.1|1687729_1688461_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1688441_1688549_-	protein YohO	NA	NA	NA	NA	NA
WP_001240401.1|1688608_1689340_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	9.7e-112
WP_001295431.1|1689561_1691247_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1691243_1691963_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001295430.1|1692009_1692480_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_001295429.1|1692520_1692982_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001374182.1|1693106_1695107_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001292773.1|1695103_1696240_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	3.2e-162
>prophage 3
NZ_CP053785	Escherichia coli isolate 2-101 chromosome, complete genome	4739049	1789053	1796591	4739049		Enterobacteria_phage(28.57%)	7	NA	NA
WP_097290573.1|1789053_1790448_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.0	1.3e-19
WP_001471778.1|1790605_1791601_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.3	8.6e-10
WP_001374047.1|1791843_1792737_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	5.1e-46
WP_001374049.1|1793105_1794191_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_001374048.1|1794190_1795090_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.2	2.0e-29
WP_001471777.1|1795147_1796026_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.9e-106
WP_001471776.1|1796030_1796591_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	57.5	4.6e-53
>prophage 4
NZ_CP053785	Escherichia coli isolate 2-101 chromosome, complete genome	4739049	1805036	1812883	4739049	transposase	Enterobacteria_phage(50.0%)	8	NA	NA
WP_072652779.1|1805036_1806443_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.3	1.1e-37
WP_001339197.1|1806585_1807794_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_172615596.1|1807815_1808670_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	40.5	2.4e-37
WP_001376207.1|1809009_1810092_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	53.1	3.7e-99
WP_001376206.1|1810094_1810994_+	dTDP-4-dehydrorhamnose reductase	NA	A0A140G5S3	Enterobacteria_phage	36.2	6.1e-31
WP_001376204.1|1811046_1811925_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.5	6.6e-107
WP_001471760.1|1811928_1812477_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	54.7	5.1e-49
WP_024203831.1|1812490_1812883_+	adenylyltransferase/cytidyltransferase family protein	NA	A0A1V0SGE7	Hokovirus	49.3	3.2e-29
>prophage 5
NZ_CP053785	Escherichia coli isolate 2-101 chromosome, complete genome	4739049	2283627	2309833	4739049	integrase,lysis	Escherichia_phage(27.78%)	29	2284692:2284706	2308482:2308496
WP_000041556.1|2283627_2286054_-	dimethyl sulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.0	7.7e-214
2284692:2284706	attL	CGCCGTCGCGGATTG	NA	NA	NA	NA
WP_001307224.1|2286252_2286558_-	DUF1161 domain-containing protein	NA	NA	NA	NA	NA
WP_001321287.1|2286665_2287376_+	YnfC family lipoprotein	NA	NA	NA	NA	NA
WP_001138581.1|2287378_2287939_-	spermidine N1-acetyltransferase	NA	NA	NA	NA	NA
WP_000705211.1|2287973_2288315_-	DUF1283 family protein	NA	NA	NA	NA	NA
WP_000598292.1|2288449_2288776_+	YnfA family protein	NA	A0A218MNG8	uncultured_virus	55.6	9.9e-24
WP_001295394.1|2288981_2290196_+	starvation-sensing protein RspA	NA	Q6A202	Oenococcus_phage	29.0	1.4e-46
WP_000836058.1|2290207_2291227_+	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
WP_001360138.1|2291284_2291395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000877001.1|2291414_2292695_-|integrase	site-specific integrase	integrase	B6DZ48	Enterobacteria_phage	62.3	6.6e-156
WP_000005552.1|2292729_2292981_-	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_001372999.1|2293053_2295525_-	exonuclease	NA	K7PLW7	Enterobacteria_phage	59.8	6.1e-57
WP_001083281.1|2295618_2295810_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|2295806_2295995_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_072163420.1|2296078_2296321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172615600.1|2296301_2297279_+	hypothetical protein	NA	U5P0A0	Shigella_phage	63.8	4.9e-58
WP_001373616.1|2297319_2297742_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	85.6	2.0e-61
WP_001678528.1|2297871_2298816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001678529.1|2299363_2300713_-	hypothetical protein	NA	A0A1W6JNS5	Morganella_phage	98.0	5.7e-259
WP_023147793.1|2301030_2301633_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	31.2	3.7e-08
WP_023147794.1|2301992_2302973_+	hypothetical protein	NA	NA	NA	NA	NA
WP_122083109.1|2303492_2303600_-	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	100.0	3.8e-09
WP_012578894.1|2303701_2303857_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	94.1	2.5e-17
WP_000980999.1|2304072_2304324_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023147795.1|2304390_2304669_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	48.4	7.4e-12
WP_001373319.1|2304670_2305720_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	54.3	4.2e-108
WP_000904112.1|2305732_2306107_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762889.1|2306103_2306925_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	2.7e-78
WP_171819265.1|2307817_2309833_+	host specificity protein J	NA	A0A291AWT4	Escherichia_phage	96.6	0.0e+00
2308482:2308496	attR	CGCCGTCGCGGATTG	NA	NA	NA	NA
>prophage 6
NZ_CP053785	Escherichia coli isolate 2-101 chromosome, complete genome	4739049	2714827	2726943	4739049	integrase,transposase	Enterobacteria_phage(36.36%)	12	2712800:2712823	2725646:2725669
2712800:2712823	attL	AACGGGCGTGTTATACGCCCGTTG	NA	NA	NA	NA
WP_000379042.1|2714827_2716783_-	AAA family ATPase	NA	K4I1H4	Acidithiobacillus_phage	28.6	7.5e-26
WP_001753331.1|2719147_2719687_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	65.6	7.5e-61
WP_072163463.1|2719869_2720181_+	recombinase	NA	A0A0N7KZJ3	Stx2-converting_phage	100.0	2.4e-43
WP_001372461.1|2720177_2720858_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	5.1e-131
WP_000149533.1|2720854_2721013_+	DUF1317 family protein	NA	M1FJ61	Enterobacteria_phage	88.5	6.4e-21
WP_001678641.1|2721009_2722074_+	DGQHR domain-containing protein	NA	T1SBJ4	Salmonella_phage	64.8	1.7e-133
WP_001678640.1|2722227_2722446_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	94.4	3.2e-34
WP_000488406.1|2722493_2722733_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	94.9	3.9e-38
WP_001339197.1|2722942_2724151_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_050562788.1|2724249_2724447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000741339.1|2724436_2725579_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21929	Phage_21	99.7	8.1e-206
WP_000444487.1|2725692_2726943_-	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	100.0	3.8e-23
2725646:2725669	attR	CAACGGGCGTATAACACGCCCGTT	NA	NA	NA	NA
>prophage 7
NZ_CP053785	Escherichia coli isolate 2-101 chromosome, complete genome	4739049	3116602	3141236	4739049	integrase,lysis	Enterobacteria_phage(46.88%)	40	3115948:3115962	3141310:3141324
3115948:3115962	attL	TTAGTATAAAAAAGC	NA	NA	NA	NA
WP_001753290.1|3116602_3117934_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	37.1	1.4e-20
WP_000239881.1|3118333_3119002_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001372490.1|3119892_3120453_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.8	4.9e-87
WP_000105084.1|3120841_3121075_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	94.4	7.3e-21
WP_000079508.1|3121131_3121542_+	DUF1398 family protein	NA	C6ZCX4	Enterobacteria_phage	76.3	1.3e-52
WP_001139678.1|3121893_3122046_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	96.0	3.1e-20
WP_000092273.1|3122033_3122501_-|lysis	lysis protein	lysis	A0A2D1GLQ7	Escherichia_phage	96.8	1.6e-75
WP_001372488.1|3122497_3122995_-	lysozyme RrrD	NA	A0A1B5FP97	Escherichia_phage	97.0	1.6e-89
WP_000839582.1|3122994_3123210_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_000592543.1|3124479_3125439_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|3125631_3126156_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|3126311_3126689_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971068.1|3126774_3126915_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	67.4	5.5e-08
WP_001372483.1|3126911_3127274_-	crossover junction endodeoxyribonuclease RusA	NA	K7PM48	Enterobacteria_phage	97.4	1.5e-60
WP_001372487.1|3127270_3127561_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	91.7	4.8e-46
WP_000224914.1|3127553_3127724_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	69.8	2.4e-13
WP_001372486.1|3127723_3128179_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.2	5.9e-59
WP_072157016.1|3128175_3128277_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000825400.1|3128369_3128822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000720581.1|3128818_3129379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000145917.1|3129863_3130157_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_001372464.1|3130153_3130855_-	replication P family protein	NA	K7P6G2	Enterobacteria_phage	99.6	3.8e-129
WP_077249941.1|3130851_3131871_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	63.4	1.7e-109
WP_001182899.1|3131867_3132407_-	hypothetical protein	NA	M9NZI6	Enterobacteria_phage	66.1	2.0e-61
WP_001067458.1|3132476_3132707_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000858975.1|3132811_3133501_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	2.8e-92
WP_000389051.1|3133623_3134373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000210934.1|3134369_3135197_+	DUF3037 domain-containing protein	NA	NA	NA	NA	NA
WP_000233576.1|3135705_3135912_+	phage encoded cell division inhibitor protein	NA	K7P6H3	Enterobacteria_phage	85.3	3.2e-28
WP_000995439.1|3135987_3136284_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	100.0	1.6e-49
WP_000100847.1|3136289_3137075_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_001372450.1|3137071_3137752_+	YqaJ viral recombinase family protein	NA	A0A0P0ZCD4	Stx2-converting_phage	98.7	3.0e-131
WP_072126246.1|3137748_3137931_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	2.2e-28
WP_023148020.1|3137903_3138095_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	98.4	2.8e-26
WP_001395510.1|3138105_3138387_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	100.0	2.5e-47
WP_000763365.1|3138485_3138707_+	TraR/DksA family transcriptional regulator	NA	A0A0N7C211	Escherichia_phage	97.3	1.4e-34
WP_000120065.1|3138917_3139520_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545745.1|3139762_3139930_+	hypothetical protein	NA	A5VWB7	Enterobacteria_phage	98.2	2.9e-27
WP_001303849.1|3139969_3140188_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_000533646.1|3140165_3141236_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	99.7	1.9e-201
3141310:3141324	attR	TTAGTATAAAAAAGC	NA	NA	NA	NA
>prophage 8
NZ_CP053785	Escherichia coli isolate 2-101 chromosome, complete genome	4739049	3585464	3652018	4739049	integrase,holin,tail,transposase	Enterobacteria_phage(24.0%)	61	3629284:3629343	3648103:3648162
WP_001352368.1|3585464_3586673_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
WP_001323764.1|3587294_3588158_-	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000153100.1|3588197_3588803_-	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_001013877.1|3589060_3589558_+	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_001084397.1|3589649_3590582_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001323766.1|3590623_3591712_-	DNA-binding transcriptional activator/c-di-GMP phosphodiesterase PdeL	NA	NA	NA	NA	NA
WP_120795374.1|3592206_3592281_-	protein YahV	NA	NA	NA	NA	NA
WP_000131044.1|3592586_3594620_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	27.4	3.4e-21
WP_001299022.1|3594748_3595336_+	transcriptional regulator BetI	NA	NA	NA	NA	NA
WP_000089055.1|3595349_3596822_+	betaine-aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001159094.1|3596835_3598506_+|holin	choline dehydrogenase	holin	A0A1V0S9M4	Catovirus	31.2	4.7e-61
WP_001209100.1|3598718_3599387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001323770.1|3599629_3600325_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_000023927.1|3600317_3601745_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_001102099.1|3601755_3602475_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_000339586.1|3603002_3603857_-	DNA-binding transcriptional regulator RclR	NA	NA	NA	NA	NA
WP_001046317.1|3604082_3605408_+	pyridine nucleotide-disulfide oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	47.6	2.5e-113
WP_000474091.1|3605516_3605753_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001306921.1|3605764_3606358_+	reactive chlorine species resistance protein RclC	NA	NA	NA	NA	NA
WP_000621009.1|3606948_3607800_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000020229.1|3607939_3612196_-	intimin-like adhesin FdeC	NA	NA	NA	NA	NA
WP_000662258.1|3613310_3613412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000803998.1|3613775_3614039_+	type B 50S ribosomal protein L31	NA	NA	NA	NA	NA
WP_000866436.1|3614038_3614179_+	50S ribosomal protein L36	NA	NA	NA	NA	NA
WP_001147279.1|3614213_3614441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001323479.1|3615263_3615806_+	ECP biosynthesis operon DNA-binding transcriptional regulator EcpR	NA	NA	NA	NA	NA
WP_000730974.1|3615880_3616468_+	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_000716398.1|3616525_3617194_+	fimbrial chaperone EcpB	NA	NA	NA	NA	NA
WP_001131091.1|3617219_3619745_+	fimbrial usher EcpC	NA	NA	NA	NA	NA
WP_001323478.1|3619734_3621378_+	fimbrial adhesin EcpD	NA	NA	NA	NA	NA
WP_001305432.1|3621346_3622057_+	fimbrial chaperone EcpE	NA	NA	NA	NA	NA
WP_001303809.1|3622369_3622699_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_001019920.1|3622946_3623561_-	YagU family protein	NA	NA	NA	NA	NA
WP_000070694.1|3623978_3624668_+	aldehyde dehydrogenase iron-sulfur subunit	NA	NA	NA	NA	NA
WP_000643336.1|3624664_3625621_+	aldehyde oxidoreductase FAD-binding subunit PaoB	NA	NA	NA	NA	NA
WP_000667031.1|3625617_3627816_+	aldehyde oxidoreductase molybdenum-binding subunit PaoC	NA	A0A0P0I429	Acinetobacter_phage	25.8	1.1e-38
WP_000121355.1|3627825_3628782_+	molybdenum cofactor insertion chaperone PaoD	NA	NA	NA	NA	NA
WP_001111345.1|3628760_3629171_+	hypothetical protein	NA	NA	NA	NA	NA
3629284:3629343	attL	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_000246049.1|3629832_3630576_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000355482.1|3632180_3632954_+	hypothetical protein	NA	G9IA57	Pseudomonas_phage	37.7	4.1e-36
WP_072195243.1|3633023_3633152_-|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	84.6	1.7e-11
WP_172615606.1|3633206_3636413_-|tail	tail fiber domain-containing protein	tail	K7PGT9	Enterobacteria_phage	57.4	9.4e-260
WP_000090895.1|3636974_3637607_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	89.5	5.5e-95
WP_053890196.1|3637543_3638287_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_172615607.1|3638292_3639087_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	99.1	4.6e-131
WP_001250269.1|3639151_3639331_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	68.5	7.8e-15
WP_000515846.1|3639506_3640064_-	protein YmfL	NA	S5FXP0	Shigella_phage	96.2	1.5e-96
WP_000205494.1|3640101_3640302_-	cell division protein	NA	NA	NA	NA	NA
WP_000450738.1|3640399_3641026_+	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	48.8	2.5e-47
WP_001312635.1|3641256_3641754_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000135680.1|3642247_3642610_+	hypothetical protein	NA	Q8SBF8	Shigella_phage	100.0	8.6e-61
WP_000081269.1|3642675_3643500_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	6.0e-150
WP_148049215.1|3643627_3643828_+	hypothetical protein	NA	S5MW55	Escherichia_phage	90.3	4.9e-26
WP_001339197.1|3643897_3645106_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_105963688.1|3645118_3645502_+	hypothetical protein	NA	S5MW55	Escherichia_phage	96.9	5.0e-67
WP_024176184.1|3645492_3646371_+	phosphoadenosine phosphosulfate reductase family protein	NA	A0A2R2Z314	Escherichia_phage	92.4	5.3e-165
WP_000206058.1|3646367_3646712_+	hypothetical protein	NA	U5P0J0	Shigella_phage	80.7	2.0e-30
WP_000051887.1|3646938_3648102_+|integrase	site-specific integrase	integrase	U5P434	Shigella_phage	100.0	2.4e-229
WP_000893260.1|3648306_3649560_-	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	47.0	1.7e-95
3648103:3648162	attR	CTTATTGATTTAAATGGTGCCGATAATAGGAGTCGAACCTACGACCTTCGCATTACGAAT	NA	NA	NA	NA
WP_001285288.1|3649571_3650675_-	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000749881.1|3650962_3652018_+	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
>prophage 9
NZ_CP053785	Escherichia coli isolate 2-101 chromosome, complete genome	4739049	3948013	3970264	4739049	integrase,tail	Escherichia_phage(48.15%)	27	3949539:3949558	3970495:3970514
WP_000202566.1|3948013_3949600_-	peptide chain release factor 3	NA	D0R0F5	Streptococcus_phage	24.9	5.3e-30
3949539:3949558	attL	GGGTGAGAAATAATGGCAAA	NA	NA	NA	NA
WP_001378647.1|3950152_3950449_+	hypothetical protein	NA	A0A291AWW6	Escherichia_phage	99.0	6.8e-48
WP_001378643.1|3950784_3951288_-	hypothetical protein	NA	A0A291AWW1	Escherichia_phage	100.0	1.1e-90
WP_001171282.1|3952243_3953206_+	hypothetical protein	NA	A0A0A7NV63	Enterobacteria_phage	91.1	4.0e-174
WP_001681074.1|3953209_3953737_+|tail	tail fiber assembly protein	tail	A0A077SK10	Escherichia_phage	98.3	1.9e-93
WP_000972143.1|3953765_3954299_-|tail	tail fiber assembly protein	tail	C9DGR0	Escherichia_phage	99.4	6.4e-97
WP_001377378.1|3954755_3954932_-	hypothetical protein	NA	A0A291AWX6	Escherichia_phage	100.0	1.7e-25
WP_000217632.1|3955155_3955581_-	hypothetical protein	NA	A0A291AWZ9	Escherichia_phage	100.0	3.6e-74
WP_001047105.1|3955861_3956614_-	antitermination protein	NA	A0A291AWZ5	Escherichia_phage	100.0	1.3e-138
WP_001360050.1|3956627_3957617_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061444.1|3957624_3958434_-	KilA-N domain-containing protein	NA	A0A291AWU7	Escherichia_phage	100.0	1.8e-151
WP_001373593.1|3958453_3958843_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	99.2	1.2e-68
WP_000210170.1|3958839_3959166_-	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	100.0	5.4e-54
WP_072165319.1|3959165_3959660_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.6	1.9e-87
WP_021527492.1|3959656_3960475_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	3.1e-122
WP_000933942.1|3960471_3960708_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	100.0	1.6e-39
WP_032181493.1|3960700_3961537_-	ash family protein	NA	Q8SBF3	Shigella_phage	91.7	2.6e-137
WP_000515860.1|3961533_3962085_-	hypothetical protein	NA	Q8SBF4	Shigella_phage	100.0	7.6e-101
WP_000649477.1|3962128_3962329_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859462.1|3962419_3963094_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000135682.1|3963760_3964123_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_001763729.1|3964188_3965013_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.6	1.7e-149
WP_001401560.1|3965141_3965678_+	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	99.4	2.2e-100
WP_001242749.1|3965668_3966031_+	phage protein	NA	U5P092	Shigella_phage	100.0	2.1e-67
WP_001377405.1|3966030_3966651_+	DUF551 domain-containing protein	NA	A5LH60	Enterobacteria_phage	91.7	1.2e-113
WP_001419254.1|3967083_3968784_-	AIPR family protein	NA	D0UIM0	Aggregatibacter_phage	27.6	4.0e-07
WP_001680166.1|3969040_3970264_-|integrase	site-specific integrase	integrase	A0A291AWU1	Escherichia_phage	98.8	7.6e-234
3970495:3970514	attR	GGGTGAGAAATAATGGCAAA	NA	NA	NA	NA
>prophage 10
NZ_CP053785	Escherichia coli isolate 2-101 chromosome, complete genome	4739049	4059908	4066467	4739049	transposase	uncultured_Caudovirales_phage(16.67%)	7	NA	NA
WP_000684856.1|4059908_4060865_+	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000175457.1|4060865_4061633_+	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000177060.1|4062190_4062448_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001254876.1|4063499_4064651_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	36.0	2.6e-42
WP_000747102.1|4064570_4064921_-|transposase	transposase	transposase	Q716C1	Shigella_phage	97.7	8.9e-39
WP_000227281.1|4065021_4065594_+	hypothetical protein	NA	Q858R9	Enterobacteria_phage	69.0	2.2e-71
WP_000594911.1|4065642_4066467_-	hypothetical protein	NA	L7TR00	Rhizobium_phage	35.5	3.0e-16
>prophage 11
NZ_CP053785	Escherichia coli isolate 2-101 chromosome, complete genome	4739049	4309182	4362304	4739049	integrase,tail,tRNA,transposase,lysis,terminase	Enterobacteria_phage(28.12%)	57	4300909:4300923	4353351:4353365
4300909:4300923	attL	CTGATAAGACGCATC	NA	NA	NA	NA
WP_000543841.1|4309182_4310220_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_000332259.1|4310308_4311406_+|integrase	site-specific integrase	integrase	S5MDN5	Escherichia_phage	99.2	1.8e-210
WP_001217553.1|4311466_4311715_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000543834.1|4311937_4312489_+	SLATT domain-containing protein	NA	NA	NA	NA	NA
WP_001678535.1|4312466_4313837_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_001753753.1|4314274_4316428_-|tail	tail fiber domain-containing protein	tail	K7PGT9	Enterobacteria_phage	53.6	1.4e-211
WP_072713908.1|4316654_4318232_-|terminase	phage terminase large subunit family protein	terminase	K7PH40	Enterobacteria_phage	99.8	0.0e+00
WP_000349509.1|4318231_4318723_-	DUF1441 family protein	NA	A0A291AWV8	Escherichia_phage	87.2	1.3e-72
WP_046657214.1|4319401_4319641_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046657216.1|4319687_4320149_-|lysis	lysis protein	lysis	A0A0K2FJD0	Enterobacteria_phage	67.1	3.4e-46
WP_046657217.1|4320145_4320643_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	96.4	6.0e-89
WP_000839596.1|4320642_4320858_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	9.0e-34
WP_000799656.1|4320925_4321978_-	site-specific DNA-methyltransferase	NA	A5LH81	Enterobacteria_phage	100.0	2.7e-208
WP_001355891.1|4322127_4322322_-	hypothetical protein	NA	Q8SBE3	Shigella_phage	100.0	1.8e-28
WP_046657263.1|4322568_4323735_+	nucleoid-associated protein	NA	A0A291AUQ0	Sinorhizobium_phage	25.3	1.7e-12
WP_046657265.1|4323731_4324958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016159280.1|4324950_4325295_-	hypothetical protein	NA	A0A0P0ZCW0	Stx2-converting_phage	84.1	3.3e-54
WP_001360050.1|4325312_4326302_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	100.0	1.5e-195
WP_001061404.1|4326309_4327107_-	KilA-N domain-containing protein	NA	A0A0P0ZCS0	Stx2-converting_phage	100.0	5.2e-151
WP_022296585.1|4327126_4327516_-	RusA family crossover junction endodeoxyribonuclease	NA	A0A291AX14	Escherichia_phage	99.2	2.1e-68
WP_032235543.1|4327512_4327839_-	LexA family transcriptional regulator	NA	A5LH73	Enterobacteria_phage	98.1	6.6e-52
WP_000066917.1|4327835_4328489_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_072165319.1|4328488_4328983_-	PerC family transcriptional regulator	NA	U5P0U0	Shigella_phage	97.6	1.9e-87
WP_021527492.1|4328979_4329798_-	helix-turn-helix domain-containing protein	NA	Q8SBF1	Shigella_phage	99.6	3.1e-122
WP_000933942.1|4329794_4330031_-	hypothetical protein	NA	A0A291AX25	Escherichia_phage	100.0	1.6e-39
WP_064764817.1|4330023_4330569_-	ash family protein	NA	Q8SBF3	Shigella_phage	87.8	3.5e-82
WP_001341559.1|4330531_4330711_-	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	96.6	1.3e-30
WP_000649477.1|4331166_4331367_-	helix-turn-helix domain-containing protein	NA	U5P445	Shigella_phage	100.0	7.9e-32
WP_000859462.1|4331457_4332132_+	LexA family transcriptional repressor	NA	Q8SBF6	Shigella_phage	100.0	1.2e-132
WP_000135682.1|4332798_4333161_+	hypothetical protein	NA	U5P4J6	Shigella_phage	100.0	3.3e-60
WP_001753751.1|4333226_4334051_+	DUF2303 family protein	NA	U5P439	Shigella_phage	99.3	6.6e-149
WP_001701368.1|4334267_4335020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093912.1|4335056_4335326_+	pyocin activator PrtN family protein	NA	S5MQM5	Escherichia_phage	97.8	2.5e-41
WP_000019186.1|4335359_4335908_-	hypothetical protein	NA	S5M7T3	Escherichia_phage	89.6	2.7e-82
WP_000287252.1|4335930_4336404_-	SocA family protein	NA	K4NZT7	Burkholderia_phage	31.8	2.4e-18
WP_001300034.1|4336690_4336813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000912595.1|4337175_4338192_-	DUF2713 family protein	NA	NA	NA	NA	NA
WP_001295691.1|4338509_4339025_+	zinc uptake transcriptional repressor Zur	NA	NA	NA	NA	NA
WP_001030593.1|4339066_4339276_-	CsbD family protein	NA	NA	NA	NA	NA
WP_001301116.1|4339391_4340717_-	MATE family efflux transporter DinF	NA	NA	NA	NA	NA
WP_000646078.1|4340789_4341398_-	repressor LexA	NA	Q9G0C2	Lactococcus_phage	38.0	1.0e-13
WP_000002907.1|4341507_4341876_-	diacylglycerol kinase	NA	NA	NA	NA	NA
WP_000017354.1|4342046_4344470_+	glycerol-3-phosphate 1-O-acyltransferase PlsB	NA	NA	NA	NA	NA
WP_000455228.1|4344624_4345497_-	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_001297295.1|4345509_4346007_-	chorismate lyase	NA	NA	NA	NA	NA
WP_000783444.1|4348038_4348959_-	maltose operon protein MalM	NA	NA	NA	NA	NA
WP_000973658.1|4349201_4350542_-	maltoporin LamB	NA	NA	NA	NA	NA
WP_000179165.1|4350613_4351729_-	maltose/maltodextrin ABC transporter ATP-binding protein MalK	NA	Q6GZ03	Mycoplasma_phage	31.7	4.3e-18
WP_000695387.1|4352093_4353284_+	maltose/maltodextrin ABC transporter substrate-binding protein MalE	NA	NA	NA	NA	NA
WP_001297290.1|4353437_4354982_+	maltose ABC transporter permease MalF	NA	NA	NA	NA	NA
4353351:4353365	attR	CTGATAAGACGCATC	NA	NA	NA	NA
WP_001252058.1|4354996_4355887_+	maltose ABC transporter permease MalG	NA	NA	NA	NA	NA
WP_001097291.1|4356258_4357734_+	D-xylose transporter XylE	NA	NA	NA	NA	NA
WP_000202902.1|4357777_4358188_-	phosphate-starvation-inducible protein PsiE	NA	NA	NA	NA	NA
WP_000487767.1|4358313_4358457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295279.1|4358457_4358736_+	periplasmic protein	NA	NA	NA	NA	NA
WP_000745767.1|4358782_4360879_-	YjbH domain-containing protein	NA	NA	NA	NA	NA
WP_001339197.1|4361095_4362304_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
>prophage 1
NZ_CP053786	Escherichia coli isolate 2-101 plasmid p2-101, complete sequence	108661	2508	49652	108661	transposase,integrase	Salmonella_phage(11.11%)	58	3394:3409	37365:37380
WP_000198533.1|2508_3717_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
3394:3409	attL	GGTGAAGACCAGGTGC	NA	NA	NA	NA
WP_000019163.1|3697_3970_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161490.1|6464_7025_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	100.0	1.1e-59
WP_000454193.1|7200_7551_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845048.1|7753_8767_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001389366.1|8924_9398_+	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IAU3	Erwinia_phage	34.6	1.3e-16
WP_000503573.1|9528_10317_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001067855.1|10518_11223_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000954592.1|12212_12389_-	DUF4102 domain-containing protein	NA	T1S9J3	Salmonella_phage	68.6	1.0e-06
WP_001043260.1|12718_13534_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	A0A0B5J4J5	Pandoravirus	27.6	5.9e-09
WP_000251875.1|13620_13923_+	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001445143.1|13816_14068_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023140202.1|14098_15235_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_000079941.1|15601_15871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000970007.1|15867_16149_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_021265674.1|16188_17037_+	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.1	3.5e-28
WP_001334658.1|17153_17627_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000955263.1|18103_18370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001459505.1|18369_18864_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000517695.1|18919_19522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001132032.1|19875_21222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001283341.1|21500_23381_+	colicin 1B	NA	NA	NA	NA	NA
WP_000762570.1|23398_23746_-	colicin 1B immunity protein	NA	NA	NA	NA	NA
WP_000194553.1|24232_24823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371888.1|24822_25080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000774874.1|25430_26432_+	DUF4238 domain-containing protein	NA	NA	NA	NA	NA
WP_025653526.1|26607_26952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000678527.1|27450_27705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001290416.1|27749_28676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000465043.1|29207_29621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021537353.1|29622_30402_+|integrase	phage integrase family protein	integrase	I3WFA4	Macacine_betaherpesvirus	95.6	4.0e-55
WP_001144036.1|30581_31226_+	ParA family protein	NA	NA	NA	NA	NA
WP_000030199.1|31312_31621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000688514.1|32034_33015_+	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	51.4	1.7e-79
WP_001278818.1|33007_33424_+	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_000457492.1|33425_34700_-	Y-family DNA polymerase	NA	F1C5A5	Cronobacter_phage	60.2	1.7e-143
WP_000109071.1|34699_35137_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	48.4	8.3e-26
WP_000618110.1|35133_35382_-	DinI-like family protein	NA	Q2A098	Sodalis_phage	48.0	1.9e-14
WP_000273918.1|35799_36702_+	DUF1281 domain-containing protein	NA	NA	NA	NA	NA
WP_010891263.1|36698_37010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000086178.1|37086_37770_+	DNA methylase	NA	A0A2I7RE86	Vibrio_phage	37.4	1.0e-30
37365:37380	attR	GCACCTGGTCTTCACC	NA	NA	NA	NA
WP_001104887.1|37770_37992_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000274403.1|38003_38438_+	DUF1380 domain-containing protein	NA	NA	NA	NA	NA
WP_015059345.1|39131_39704_+	YubH family protein	NA	NA	NA	NA	NA
WP_072132163.1|39799_40102_+	antirestriction protein	NA	NA	NA	NA	NA
WP_000271729.1|40148_40571_+	DUF1380 family protein	NA	NA	NA	NA	NA
WP_001027500.1|40567_40759_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001276110.1|41528_42056_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.6e-47
WP_000006014.1|42113_42347_+	DUF905 domain-containing protein	NA	NA	NA	NA	NA
WP_021265661.1|42405_44364_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.2	2.1e-20
WP_000845897.1|44418_44853_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276261.1|44849_45569_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000978012.1|45565_46162_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	61.9	3.1e-15
WP_001347396.1|46233_46704_+	YubH family protein	NA	NA	NA	NA	NA
WP_000117609.1|46624_47125_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	26.9	9.3e-05
WP_000218863.1|47853_48288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001247862.1|48379_48646_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000038339.1|48710_49652_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	51.0	3.5e-61
