The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053894	Proteus mirabilis strain JPM24 chromosome, complete genome	3983870	1082659	1094613	3983870		Mycobacterium_phage(25.0%)	12	NA	NA
WP_004247426.1|1082659_1083859_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_004247427.1|1084467_1085436_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
WP_004247428.1|1085461_1087588_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.2	3.4e-205
WP_004246072.1|1087616_1088021_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004246071.1|1088032_1088257_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246068.1|1089209_1089419_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246065.1|1089602_1089743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246058.1|1090486_1090861_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246057.1|1090876_1091842_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246056.1|1091943_1092588_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026090527.1|1092939_1093203_-	YbeD family protein	NA	NA	NA	NA	NA
WP_004246054.1|1093401_1094613_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
>prophage 2
NZ_CP053894	Proteus mirabilis strain JPM24 chromosome, complete genome	3983870	1296500	1374961	3983870	tRNA,plate,protease	Bacillus_phage(17.65%)	57	NA	NA
WP_004244558.1|1296500_1296815_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_004244559.1|1296845_1299140_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244560.1|1299259_1299478_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004247616.1|1299797_1300490_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_004252037.1|1300491_1302243_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	31.7	1.4e-18
WP_017628444.1|1302245_1304015_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004252032.1|1304156_1305116_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.5	3.4e-64
WP_004244566.1|1305658_1306153_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_150452761.1|1306280_1310063_+	DNA translocase FtsK 4TM domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244569.1|1310175_1310781_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012367706.1|1310791_1312141_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_004244571.1|1312274_1313564_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
WP_036908217.1|1313743_1314076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036971363.1|1314475_1315525_+	ureidoglycolate dehydrogenase	NA	NA	NA	NA	NA
WP_004244574.1|1315597_1316503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244575.1|1316859_1317600_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	27.0	2.3e-20
WP_004244576.1|1317707_1319990_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.6	1.0e-159
WP_004244577.1|1320044_1320899_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_036971369.1|1321568_1323326_-	30S ribosomal protein S12 methylthiotransferase accessory factor YcaO	NA	NA	NA	NA	NA
WP_004244579.1|1323553_1324591_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_104731560.1|1324665_1325919_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004252013.1|1326055_1327486_-	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	24.4	7.5e-07
WP_004244582.1|1327622_1328711_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	47.0	5.7e-84
WP_004244584.1|1328907_1330194_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_004244585.1|1330481_1331159_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_004244586.1|1331340_1333014_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_004244587.1|1333078_1333366_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.0	8.4e-11
WP_063215362.1|1333770_1336140_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q0H255	Geobacillus_phage	29.3	2.7e-22
WP_104731562.1|1336176_1337922_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	30.9	1.1e-60
WP_046335154.1|1337918_1338920_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_004247631.1|1339415_1339631_+	cold shock domain-containing protein	NA	NA	NA	NA	NA
WP_004244593.1|1340045_1340225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244594.1|1340229_1340991_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_004247632.1|1341113_1341944_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_004247633.1|1342323_1343097_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|1343106_1344429_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004247634.1|1344409_1345141_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_046335151.1|1345137_1349595_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_060554589.1|1349877_1350531_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	79.9	2.4e-101
WP_004247637.1|1350936_1351650_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_004244603.1|1351992_1353708_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_172764421.1|1354039_1354588_+	YcbK family protein	NA	NA	NA	NA	NA
WP_004247640.1|1354637_1355288_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|1355380_1355854_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_104731563.1|1355944_1357681_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004244609.1|1357673_1359029_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004244610.1|1359066_1362615_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_012367720.1|1362617_1364081_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244612.1|1364086_1364737_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|1364738_1365527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104731564.1|1365530_1368242_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.7	4.9e-84
WP_004244617.1|1368250_1369006_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_026164596.1|1368998_1370357_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_004244619.1|1370358_1370910_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004247648.1|1370911_1372180_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_004244621.1|1372184_1373222_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_046334530.1|1373185_1374961_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 3
NZ_CP053894	Proteus mirabilis strain JPM24 chromosome, complete genome	3983870	1528686	1563409	3983870	integrase,capsid,head,portal,lysis,protease,terminase,tail,tRNA	Morganella_phage(26.67%)	46	1529455:1529469	1540130:1540144
WP_004247117.1|1528686_1529790_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
1529455:1529469	attL	AAATGCTTTAAATTT	NA	NA	NA	NA
WP_036918198.1|1529895_1530348_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004247119.1|1530340_1530970_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004251822.1|1531108_1532362_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
WP_036908088.1|1532471_1533605_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	72.2	6.5e-155
WP_017628380.1|1533579_1533831_-	excisionase	NA	NA	NA	NA	NA
WP_036908086.1|1533916_1534441_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	60.5	1.1e-53
WP_017628378.1|1534725_1535358_-	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	44.4	1.5e-39
WP_006537203.1|1535458_1535665_+	cell division protein	NA	H9C161	Pectobacterium_phage	40.7	8.5e-05
WP_036908083.1|1535702_1536179_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	61.1	7.9e-46
WP_036908081.1|1536440_1536620_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	2.6e-10
WP_052124643.1|1537177_1537693_+	hypothetical protein	NA	U5P0A0	Shigella_phage	44.2	4.6e-23
WP_036908080.1|1537714_1538521_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.1	1.2e-89
WP_036908078.1|1538517_1539543_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	45.9	3.0e-82
WP_036908077.1|1539842_1540922_+	RelA/SpoT domain-containing protein	NA	A0A1B0VBT5	Salmonella_phage	39.6	1.4e-50
1540130:1540144	attR	AAATGCTTTAAATTT	NA	NA	NA	NA
WP_036908076.1|1541425_1541824_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.8	3.5e-31
WP_004247137.1|1542163_1542376_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	7.6e-25
WP_004247148.1|1542777_1543299_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004251632.1|1543622_1543958_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_036908075.1|1544061_1544988_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_036908073.1|1545404_1545833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894738.1|1545985_1546237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150452797.1|1546680_1546950_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	6.0e-19
WP_036900946.1|1546949_1547420_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	60.5	5.8e-49
WP_162837602.1|1547401_1547560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905787.1|1547562_1548024_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.6	3.7e-24
WP_001967215.1|1548921_1549260_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.6e-40
WP_006537823.1|1549262_1549475_+	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	44.8	1.4e-07
WP_006537822.1|1549597_1550065_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	9.5e-44
WP_017628363.1|1550018_1551752_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.6	3.1e-148
WP_017628362.1|1551751_1553020_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.4	1.8e-201
WP_004242476.1|1553037_1553706_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.8	6.6e-83
WP_017628361.1|1553709_1554876_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.5	1.6e-169
WP_017628360.1|1554914_1555214_+|head,tail	phage head-tail connector protein	head,tail	K7PKV5	Enterobacterial_phage	65.3	5.7e-34
WP_017628359.1|1555213_1555543_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_063073913.1|1555532_1556006_+	HK97 gp10 family phage protein	NA	A0A0R6PHU8	Moraxella_phage	30.6	2.8e-11
WP_017628357.1|1556011_1556353_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017628356.1|1556362_1557028_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628355.1|1557092_1557509_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628354.1|1557505_1557784_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004242485.1|1557808_1558000_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_017628353.1|1558126_1561402_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	46.7	2.9e-54
WP_017628352.1|1561402_1561999_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.3	1.6e-51
WP_017628351.1|1561998_1562580_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.5	8.1e-53
WP_049219722.1|1562596_1562932_+	hypothetical protein	NA	Q775B6	Bordetella_phage	35.3	3.7e-10
WP_049219720.1|1563010_1563409_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	46.2	7.1e-32
>prophage 4
NZ_CP053894	Proteus mirabilis strain JPM24 chromosome, complete genome	3983870	1828030	1838022	3983870		Escherichia_phage(66.67%)	8	NA	NA
WP_104731639.1|1828030_1830088_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	4.8e-31
WP_004248043.1|1830099_1831800_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004242887.1|1832135_1832822_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004242888.1|1832821_1833283_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_004242890.1|1833335_1833947_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	7.3e-28
WP_060554654.1|1834086_1834947_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	35.5	2.1e-25
WP_004242892.1|1834948_1835566_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_004248044.1|1835577_1838022_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	7.3e-220
>prophage 5
NZ_CP053894	Proteus mirabilis strain JPM24 chromosome, complete genome	3983870	2191188	2247551	3983870	integrase,transposase,terminase,tail,holin	Salmonella_phage(20.0%)	61	2216415:2216430	2238194:2238209
WP_104836482.1|2191188_2191533_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	84.3	2.6e-43
WP_104836483.1|2191535_2191808_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	37.8	3.2e-12
WP_020945795.1|2191804_2192176_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	39.1	3.9e-16
WP_172764432.1|2192262_2193717_-	glucosyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_104836485.1|2193703_2194633_-	glycosyltransferase family 2 protein	NA	M1FQW5	Enterobacteria_phage	83.0	1.2e-146
WP_172764433.1|2194632_2194995_-	GtrA family protein	NA	S5FXN2	Shigella_phage	53.8	5.3e-26
WP_172764434.1|2195135_2197328_-	hypothetical protein	NA	A0A2P0QGN7	Salmonella_phage	48.6	1.4e-126
WP_004243332.1|2197501_2197753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124740950.1|2197777_2198077_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124740949.1|2198088_2201460_-	hypothetical protein	NA	A0A2I7RY58	Vibrio_phage	36.2	2.6e-183
WP_124740948.1|2201459_2204543_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	50.9	1.4e-164
WP_004243338.1|2204545_2205094_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	60.2	3.4e-45
WP_124740947.1|2205093_2205582_-	hypothetical protein	NA	A0A0F6R7N6	Escherichia_coli_O157_typing_phage	59.9	4.6e-49
WP_124740946.1|2205565_2208028_-	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	70.1	0.0e+00
WP_104836493.1|2208027_2208633_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	60.7	6.7e-66
WP_020945806.1|2208632_2208944_-	hypothetical protein	NA	Q858G5	Salmonella_phage	38.5	8.8e-14
WP_020945807.1|2209007_2209349_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836494.1|2209357_2209789_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	54.8	2.5e-30
WP_172764435.1|2209847_2210828_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	59.1	2.5e-110
WP_172764436.1|2210843_2211521_-	peptidase	NA	T1SAP9	Salmonella_phage	64.3	6.8e-43
WP_004243354.1|2211538_2211853_-	hypothetical protein	NA	Q2A090	Sodalis_phage	45.5	1.2e-13
WP_172764437.1|2211849_2213514_-|tail	phage tail protein	tail	A0A193GYI4	Enterobacter_phage	66.1	9.7e-200
WP_004243356.1|2213523_2213736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172764438.1|2213920_2215402_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	77.0	4.0e-229
WP_115065431.1|2215401_2215971_-|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	50.3	2.0e-43
WP_004243359.1|2216069_2216429_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	56.2	3.3e-28
2216415:2216430	attL	AGGTGATTTAGCCATT	NA	NA	NA	NA
WP_161780006.1|2216421_2216769_-	DUF2591 family protein	NA	NA	NA	NA	NA
WP_161780005.1|2216765_2217056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_141192049.1|2217042_2217333_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049203709.1|2217458_2217854_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.9	5.2e-35
WP_064505760.1|2217850_2218264_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049211513.1|2218485_2218968_-	replication protein	NA	NA	NA	NA	NA
WP_049211516.1|2218936_2219872_-	hypothetical protein	NA	A0A193GZ86	Enterobacter_phage	57.6	2.4e-70
WP_004250866.1|2219873_2220095_-	hypothetical protein	NA	A0A193GYW4	Enterobacter_phage	48.3	8.5e-11
WP_064505757.1|2220236_2220515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243373.1|2220592_2221201_+	hypothetical protein	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	35.4	1.5e-28
WP_004243375.1|2221449_2221611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172764439.1|2221597_2223322_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0U2I1R6	Escherichia_phage	46.6	1.0e-111
WP_172764440.1|2223367_2224408_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	51.0	8.4e-101
WP_172764441.1|2224452_2224710_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_172764442.1|2224765_2225035_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172764443.1|2225058_2225553_+	ASCH domain-containing protein	NA	H2BDG4	Pseudomonas_virus	27.5	1.6e-09
WP_172764444.1|2225552_2226086_+	hypothetical protein	NA	A0A1W5PTP2	Pseudoalteromonas_phage	31.7	1.1e-11
WP_049210369.1|2226163_2226790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172764445.1|2226839_2227487_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	61.1	1.8e-72
WP_004250849.1|2227489_2227687_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	65.1	3.4e-19
WP_172764446.1|2227882_2229079_-|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	62.2	9.6e-141
WP_004250844.1|2229297_2230875_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004250843.1|2230959_2232426_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.7e-89
WP_104731683.1|2232595_2233984_+	exodeoxyribonuclease VII large subunit	NA	A0A2H4UVM9	Bodo_saltans_virus	34.5	1.2e-38
WP_104731684.1|2234096_2236346_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004243395.1|2236531_2238700_-	oligopeptidase B	NA	NA	NA	NA	NA
2238194:2238209	attR	AATGGCTAAATCACCT	NA	NA	NA	NA
WP_004248270.1|2238724_2239534_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_004243399.1|2239551_2240421_-	ChaN family lipoprotein	NA	NA	NA	NA	NA
WP_004250839.1|2240607_2242890_-	NADP-dependent oxaloacetate-decarboxylating malate dehydrogenase	NA	NA	NA	NA	NA
WP_004248273.1|2243439_2244063_+	response regulator	NA	NA	NA	NA	NA
WP_004248274.1|2244132_2244693_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004248275.1|2244893_2245265_+	ArsC family reductase	NA	NA	NA	NA	NA
WP_104731685.1|2245270_2246401_+	succinyl-diaminopimelate desuccinylase	NA	NA	NA	NA	NA
WP_004250835.1|2246397_2247066_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_104731686.1|2247134_2247551_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	59.9	7.9e-42
>prophage 6
NZ_CP053894	Proteus mirabilis strain JPM24 chromosome, complete genome	3983870	2413611	2432415	3983870	holin,plate,lysis	Burkholderia_phage(26.67%)	22	NA	NA
WP_104731704.1|2413611_2416050_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.3	5.5e-260
WP_004243609.1|2416061_2416679_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_049218815.1|2416682_2417459_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	8.6e-42
WP_004250729.1|2417574_2418117_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.2	1.6e-18
WP_017628013.1|2418685_2418865_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_104731705.1|2418968_2420174_-	hypothetical protein	NA	Q6IWQ6	Burkholderia_phage	34.1	2.4e-14
WP_017628011.1|2420179_2420836_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.4	6.6e-35
WP_012368085.1|2420832_2422020_-|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	37.7	3.2e-72
WP_004243617.1|2422012_2422357_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104731706.1|2422353_2423046_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	8.8e-30
WP_004243622.1|2423048_2423861_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|2423829_2424150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243624.1|2424162_2424651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104731707.1|2424653_2426957_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.3	1.1e-15
WP_004243627.1|2427039_2427498_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_004243628.1|2427557_2428010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004248362.1|2428020_2429508_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.9e-77
WP_012368090.1|2429516_2430029_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049210638.1|2430065_2430515_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_017628006.1|2430511_2430916_-	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.6	1.0e-25
WP_004248367.1|2430918_2431218_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_004243640.1|2431599_2432415_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	2.1e-54
>prophage 7
NZ_CP053894	Proteus mirabilis strain JPM24 chromosome, complete genome	3983870	2539803	2575941	3983870	integrase,coat,lysis,portal,tail,holin	Proteus_phage(23.68%)	58	2536207:2536266	2576078:2576164
2536207:2536266	attL	CACCACAAAAACGGTACTATACGGACACTGAGAAACAGTTAAGCACCCTCTCGCAAAATG	NA	NA	NA	NA
WP_172764452.1|2539803_2541834_-	lytic transglycosylase domain-containing protein	NA	Q716G2	Shigella_phage	49.3	1.6e-164
WP_172764453.1|2541833_2543279_-	phage DNA ejection protein	NA	A0A2H4FND5	Salmonella_phage	40.6	5.6e-87
WP_104836671.1|2543288_2543948_-	DNA transfer protein	NA	Q2A0B2	Sodalis_phage	68.1	8.6e-59
WP_036976869.1|2543941_2544403_-	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	71.3	9.3e-60
WP_104836672.1|2544402_2545101_-|tail	phage tail protein	tail	C6ZR14	Salmonella_phage	66.5	7.0e-35
WP_172764493.1|2545100_2546339_-	hypothetical protein	NA	B6SCW0	Bacteriophage	68.9	3.9e-145
WP_049220809.1|2546853_2547351_-	recombinase RmuC	NA	A0A2D1GLR5	Escherichia_phage	62.5	4.4e-47
WP_049220811.1|2547328_2547538_-	hypothetical protein	NA	E7C9T9	Salmonella_phage	40.3	3.8e-05
WP_049220813.1|2547590_2548874_-|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	66.9	3.2e-166
WP_172764454.1|2548873_2549788_-	scaffolding protein	NA	A0A192Y6T4	Salmonella_phage	61.5	1.4e-91
WP_172764455.1|2549802_2551893_-|portal	portal protein	portal	A0A2H4FNE2	Salmonella_phage	66.2	6.8e-235
WP_159108758.1|2551895_2553329_-	DNA packaging protein	NA	Q2A0C1	Sodalis_phage	76.1	1.5e-220
WP_104459280.1|2553306_2553747_-	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	52.5	8.6e-31
WP_159108757.1|2553743_2554112_-	hypothetical protein	NA	R9VYK9	Serratia_phage	42.3	1.3e-19
WP_172764456.1|2554166_2554598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036977151.1|2554607_2554832_-	DUF2560 family protein	NA	A0A286N2R1	Klebsiella_phage	53.4	3.9e-11
WP_172764457.1|2555155_2555608_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	79.2	2.7e-51
WP_036976899.1|2555609_2555942_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	70.3	4.4e-35
WP_004918415.1|2555928_2556222_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004916901.1|2556218_2556608_-	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_036969493.1|2557039_2557543_-	DUF1133 family protein	NA	A0A1P8DTF1	Proteus_phage	88.0	4.0e-80
WP_172764458.1|2557539_2557731_-	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	96.8	1.3e-28
WP_094960298.1|2557730_2558351_-	recombination protein NinG	NA	A0A2I7RAC0	Vibrio_phage	54.1	1.0e-45
WP_109395754.1|2558462_2558696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172764459.1|2558692_2559136_-	recombination protein NinB	NA	K7P7B8	Enterobacteria_phage	56.0	2.1e-37
WP_134736543.1|2559137_2559347_-	hypothetical protein	NA	A0A1P8DTG8	Proteus_phage	98.4	5.3e-31
WP_172764460.1|2559464_2559662_-	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_049199117.1|2559872_2560130_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_172764461.1|2560129_2560375_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172764462.1|2560394_2561771_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	58.3	9.3e-156
WP_161729024.1|2561770_2562508_-	conserved phage C-terminal domain-containing protein	NA	E5AGE9	Erwinia_phage	55.4	6.4e-63
WP_164484703.1|2562935_2563112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049220837.1|2563227_2563554_-	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	79.6	6.2e-42
WP_012367616.1|2563684_2563870_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_012367615.1|2563977_2564679_+	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	46.7	2.6e-45
WP_012367614.1|2564709_2565015_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172764463.1|2565536_2565815_+	hypothetical protein	NA	A0A1P8DTK1	Proteus_phage	84.6	1.2e-33
WP_172764464.1|2565811_2565982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172764465.1|2566309_2566900_+	DUF5420 family protein	NA	A0A2I7QRH1	Vibrio_phage	30.3	4.4e-14
WP_172764395.1|2566929_2567163_+	hypothetical protein	NA	A0A2H4JA69	uncultured_Caudovirales_phage	40.7	7.3e-05
WP_172764396.1|2567164_2567413_+	hypothetical protein	NA	A0A1X9Y8A5	Proteus_phage	79.1	2.1e-10
WP_161747556.1|2567477_2568419_+	cell envelope biogenesis protein TolA	NA	A0A2I7QK72	Vibrio_phage	46.6	2.3e-20
WP_036905381.1|2568436_2568697_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172764466.1|2568750_2568906_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172764467.1|2568913_2569168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159262583.1|2569164_2569419_+	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	95.2	1.4e-38
WP_049216798.1|2569415_2570234_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1P8DTH1	Proteus_phage	97.8	7.0e-159
WP_049216795.1|2570226_2571033_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	98.9	6.7e-146
WP_124740880.1|2571022_2571523_+	single-stranded DNA-binding protein	NA	A0A1W6JNW8	Morganella_phage	68.9	1.3e-51
WP_172764468.1|2571538_2571877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172764469.1|2571910_2572075_+	hook protein	NA	NA	NA	NA	NA
WP_070487054.1|2572110_2572431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124740882.1|2572430_2572775_+	hypothetical protein	NA	NA	NA	NA	NA
WP_124740883.1|2573081_2573414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036970024.1|2573406_2573772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172764470.1|2573761_2574307_+	phage N-6-adenine-methyltransferase	NA	A0A1W6JP96	Morganella_phage	63.1	5.5e-59
WP_036905342.1|2574596_2574788_+	50S ribosomal protein L7/L12	NA	NA	NA	NA	NA
WP_172764471.1|2574765_2575941_-|integrase	site-specific integrase	integrase	G3CFG6	Escherichia_phage	76.5	4.5e-183
2576078:2576164	attR	CACCACAAAAACGGTACTATACGGACACTGAGAAACAGTTAAGCACCCTCTCGCAAAATGTTCCCTTAGTTAAATGGATATAACGAG	NA	NA	NA	NA
>prophage 8
NZ_CP053894	Proteus mirabilis strain JPM24 chromosome, complete genome	3983870	3035250	3111560	3983870	integrase,transposase,tRNA	Salmonella_phage(20.83%)	69	3033421:3033434	3103730:3103746
3033421:3033434	attL	CGGCTTCATCAAGC	NA	NA	NA	NA
WP_001352368.1|3035250_3036459_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	100.0	1.8e-235
3033421:3033434	attL	CGGCTTCATCAAGC	NA	NA	NA	NA
WP_000599533.1|3036824_3038030_-	sodium/glutamate symporter	NA	NA	NA	NA	NA
WP_000562370.1|3038473_3038794_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_000460651.1|3038786_3039173_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001284954.1|3039180_3039867_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000088605.1|3039844_3040468_-	tetracycline resistance transcriptional repressor TetR(B)	NA	NA	NA	NA	NA
WP_114200720.1|3040549_3041755_+	tetracycline efflux MFS transporter Tet(B)	NA	A0A2H4UVM2	Bodo_saltans_virus	24.4	3.0e-09
WP_000428546.1|3041867_3042461_-	tetracyline resistance-associated transcriptional repressor TetC	NA	NA	NA	NA	NA
WP_000376623.1|3045212_3045713_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000939727.1|3047166_3047988_-	lincosamide nucleotidyltransferase Lnu(F)	NA	NA	NA	NA	NA
WP_071593219.1|3048119_3048911_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000845054.1|3049056_3050070_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_000454193.1|3050272_3050623_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000147567.1|3050748_3051309_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_015344976.1|3051311_3054263_+|transposase	Tn3-like element TnAs3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.5	0.0e+00
3052601:3052614	attR	CGGCTTCATCAAGC	NA	NA	NA	NA
WP_046788546.1|3054271_3054673_+	hypothetical protein	NA	NA	NA	NA	NA
3052601:3052614	attR	CGGCTTCATCAAGC	NA	NA	NA	NA
WP_001067784.1|3054757_3055462_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_172764476.1|3056386_3057271_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|3057487_3058702_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|3058729_3059035_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_015344975.1|3059146_3060640_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|3060670_3060922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|3060815_3061118_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|3061204_3062020_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_085940648.1|3062109_3063199_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_170628443.1|3063396_3063756_-	phenol hydroxylase	NA	NA	NA	NA	NA
WP_000602738.1|3065692_3066445_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|3066866_3067892_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001199192.1|3068120_3068897_-	aminoglycoside N-acetyltransferase AAC(3)-IVa	NA	NA	NA	NA	NA
WP_001067855.1|3069010_3069715_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|3069904_3070720_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067858.1|3070870_3071575_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	1.2e-138
WP_064732565.1|3071584_3071989_+	bleomycin binding protein	NA	NA	NA	NA	NA
WP_004193041.1|3072308_3072701_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_172764477.1|3072867_3074067_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001206356.1|3074628_3075420_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_001336345.1|3075425_3075716_-	DUF1010 domain-containing protein	NA	NA	NA	NA	NA
WP_001083725.1|3075827_3076325_-	trimethoprim-resistant dihydrofolate reductase DfrA12	NA	A0A0A0PL85	Bacillus_phage	40.9	7.5e-23
WP_001162012.1|3077787_3078345_+	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	81.3	5.8e-48
WP_172764478.1|3078347_3081320_+|transposase	Tn3 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	73.0	0.0e+00
WP_096865212.1|3083165_3083768_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1V0E036	Clostridioides_phage	27.6	5.0e-05
WP_096865211.1|3084155_3084395_+	hypothetical protein	NA	NA	NA	NA	NA
WP_164561199.1|3084396_3084573_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096865210.1|3084575_3084899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096865209.1|3084882_3085137_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_096865208.1|3085220_3085811_+	DUF1643 domain-containing protein	NA	NA	NA	NA	NA
WP_044124618.1|3086006_3086189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096865207.1|3087878_3088985_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096865206.1|3089069_3089267_-	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_096865205.1|3089521_3090118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096865204.1|3090123_3090645_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164561200.1|3090715_3091150_-	DUF2787 family protein	NA	NA	NA	NA	NA
WP_096865235.1|3091428_3091746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102780616.1|3091755_3092097_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001967176.1|3092204_3092480_-	helix-turn-helix domain-containing protein	NA	M1PVU4	Vibrio_phage	64.1	4.4e-17
WP_172764479.1|3092599_3093034_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096865153.1|3093095_3093893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096865152.1|3093978_3094389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096865151.1|3094575_3095595_-	restriction endonuclease	NA	NA	NA	NA	NA
WP_096865150.1|3095640_3098883_-	type I restriction endonuclease subunit R	NA	A0A220A398	Liberibacter_phage	28.6	1.8e-64
WP_164561201.1|3098948_3100157_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_096865147.1|3100153_3101701_-	SAM-dependent DNA methyltransferase	NA	A0A2H4PQP4	Staphylococcus_phage	26.7	2.1e-47
WP_096865146.1|3102062_3103343_-|integrase	site-specific integrase	integrase	R9TMP3	Vibrio_phage	43.0	2.7e-08
WP_017627877.1|3103573_3106138_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	21.9	2.8e-28
WP_004244343.1|3106203_3107193_-	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	36.2	1.6e-32
WP_004244344.1|3107867_3108992_-	murein hydrolase activator NlpD	NA	A0A292GJG6	Xanthomonas_phage	45.8	5.5e-13
WP_004244345.1|3109145_3109772_-	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	46.2	1.9e-31
WP_004244347.1|3109765_3110530_-	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.4	2.1e-64
WP_004250266.1|3110507_3111560_-|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
>prophage 9
NZ_CP053894	Proteus mirabilis strain JPM24 chromosome, complete genome	3983870	3279619	3288463	3983870		Caulobacter_phage(50.0%)	9	NA	NA
WP_004245601.1|3279619_3281188_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_004245602.1|3281588_3282269_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|3282365_3282941_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004249446.1|3283017_3283596_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004249445.1|3283663_3284689_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|3284723_3285179_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_104731827.1|3285203_3286340_-	TerD family protein	NA	NA	NA	NA	NA
WP_049257396.1|3286340_3286925_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	30.2	9.4e-17
WP_049199390.1|3287317_3288463_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	1.6e-31
>prophage 10
NZ_CP053894	Proteus mirabilis strain JPM24 chromosome, complete genome	3983870	3903754	3979054	3983870	integrase,transposase,tRNA,protease	Bacillus_phage(22.22%)	55	3947620:3947638	3979258:3979276
WP_017628739.1|3903754_3904339_-|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_004246555.1|3904433_3905345_-	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_017628737.1|3906787_3907183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104459538.1|3907329_3909444_+	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_104731889.1|3909446_3911795_+	cellulose biosynthesis cyclic di-GMP-binding regulatory protein BcsB	NA	NA	NA	NA	NA
WP_104731890.1|3911805_3915492_+	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_004246549.1|3915507_3915978_+	cellulose biosynthesis protein	NA	NA	NA	NA	NA
WP_104731891.1|3916016_3916922_+	sensor domain-containing diguanylate cyclase	NA	NA	NA	NA	NA
WP_017628731.1|3917095_3918058_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	45.1	2.5e-59
WP_060555791.1|3918131_3919169_+	endoglucanase	NA	NA	NA	NA	NA
WP_071425880.1|3919307_3920957_-	sulfatase-like hydrolase/transferase	NA	NA	NA	NA	NA
WP_104731892.1|3921065_3922928_-	selenocysteine-specific translation elongation factor	NA	A0A2K9KZ60	Tupanvirus	26.0	1.1e-13
WP_004249787.1|3922924_3924316_-|tRNA	L-seryl-tRNA(Sec) selenium transferase	tRNA	NA	NA	NA	NA
WP_004246539.1|3924331_3925252_-	formate dehydrogenase accessory protein FdhE	NA	NA	NA	NA	NA
WP_004246538.1|3925450_3926107_-	formate dehydrogenase cytochrome b556 subunit	NA	NA	NA	NA	NA
WP_004246537.1|3926103_3927042_-	formate dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_080633831.1|3927053_3930101_-	formate dehydrogenase-N subunit alpha	NA	NA	NA	NA	NA
WP_004246534.1|3930280_3931111_+	formate dehydrogenase accessory sulfurtransferase FdhD	NA	NA	NA	NA	NA
WP_004246527.1|3931270_3932146_-	glycosyl transferase	NA	NA	NA	NA	NA
WP_004246526.1|3932437_3932980_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246525.1|3933194_3934166_+	apolipoprotein N-acyltransferase	NA	NA	NA	NA	NA
WP_004249779.1|3934290_3935178_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_104731895.1|3935592_3936393_+	transferrin-binding protein-like solute binding protein	NA	NA	NA	NA	NA
WP_049194461.1|3936567_3937920_+	DUF560 domain-containing protein	NA	NA	NA	NA	NA
WP_104731896.1|3937964_3941042_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_004249775.1|3941069_3941873_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_172764490.1|3941926_3943888_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246518.1|3943919_3944849_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_004246516.1|3945033_3945498_-	DUF1097 domain-containing protein	NA	NA	NA	NA	NA
WP_104731898.1|3945899_3947213_-	type II toxin-antitoxin system HipA family toxin	NA	NA	NA	NA	NA
WP_004249771.1|3947213_3947471_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
3947620:3947638	attL	TTACTTCCCAATACAGAAA	NA	NA	NA	NA
WP_001145449.1|3947746_3948376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001389365.1|3948723_3949488_-|transposase	IS6-like element IS6100 family transposase	transposase	A0A077SL39	Escherichia_phage	65.7	4.3e-86
WP_000376623.1|3949994_3950495_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000679427.1|3951454_3951802_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001931474.1|3952018_3952885_-	PSE family carbenicillin-hydrolyzing class A beta-lactamase CARB-2	NA	A0A077SL40	Escherichia_phage	44.1	4.8e-57
WP_000845039.1|3953090_3954104_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001072145.1|3954377_3954962_+	recombinase family protein	NA	E5FFF9	Burkholderia_phage	58.1	5.5e-49
WP_049208435.1|3955040_3956030_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_001536280.1|3956050_3958594_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000766277.1|3958671_3960597_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000562220.1|3960593_3962255_+	ATP-dependent helicase	NA	S5MMD7	Bacillus_phage	22.8	7.1e-09
WP_001536335.1|3963230_3964196_+|integrase	integrase domain-containing protein	integrase	NA	NA	NA	NA
WP_022742851.1|3964199_3964496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000901446.1|3965344_3965614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000060800.1|3966028_3966424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000783473.1|3966420_3967278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001536376.1|3967521_3968946_+	conjugal transfer protein TraH	NA	NA	NA	NA	NA
WP_000347732.1|3968949_3972354_+	conjugal transfer protein TraG N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000043897.1|3972353_3972608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086010879.1|3972894_3974071_+|transposase	IS3-like element ISVch4 family transposase	transposase	Q716C2	Shigella_phage	65.1	1.5e-117
WP_001187968.1|3975946_3976174_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000802150.1|3976160_3977114_+	replication protein	NA	NA	NA	NA	NA
WP_000215270.1|3977471_3977840_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000868887.1|3977836_3979054_-|integrase	site-specific integrase	integrase	H7BUI8	unidentified_phage	28.3	6.3e-15
3979258:3979276	attR	TTACTTCCCAATACAGAAA	NA	NA	NA	NA
>prophage 1
NZ_CP053895	Proteus mirabilis strain JPM24 plasmid pJPM24, complete sequence	102319	42356	65212	102319	transposase,integrase	Escherichia_phage(37.5%)	20	41588:41602	69517:69531
41588:41602	attL	TTGGTTATAGGTAAT	NA	NA	NA	NA
WP_048821757.1|42356_43310_+|integrase	site-specific integrase	integrase	A0A1P8DJ76	Virus_Rctr85	29.2	9.6e-27
WP_001029679.1|43578_44400_+	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000267723.1|44386_46495_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|46491_48159_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_071538080.1|48961_50536_-	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	2.8e-87
WP_001067855.1|50560_51265_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000052512.1|51715_53191_+	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_000155092.1|53246_54131_+	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_140173007.1|54320_54632_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|54667_55372_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_004201164.1|56152_56965_+	subclass B1 metallo-beta-lactamase NDM-1	NA	NA	NA	NA	NA
WP_004201167.1|56968_57334_+	bleomycin binding protein Ble-MBL	NA	NA	NA	NA	NA
WP_004201168.1|57338_57977_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_004201169.1|57987_59019_-	twin-arginine translocation (TAT) pathway signal sequence domain protein	NA	NA	NA	NA	NA
WP_004201171.1|59023_59353_-	divalent-cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_004201172.1|59546_59837_+	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.8	2.1e-17
WP_004201176.1|59892_61533_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	62.1	8.2e-175
WP_015056392.1|61721_63251_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_015056391.1|63461_63746_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001067855.1|64507_65212_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
69517:69531	attR	TTGGTTATAGGTAAT	NA	NA	NA	NA
