The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053898	Proteus mirabilis strain YPM35 chromosome, complete genome	4161306	493587	586961	4161306	protease,tail,capsid,head,transposase,tRNA,terminase,integrase,portal	uncultured_Caudovirales_phage(27.59%)	98	523852:523872	538813:538833
WP_012368599.1|493587_494004_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	1.5e-45
WP_104836204.1|494026_495235_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.3	2.8e-188
WP_104836205.1|495978_497118_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_104836206.1|497143_500278_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_017628206.1|500364_502755_-	zinc/cadmium/mercury/lead-transporting ATPase	NA	E4ZFI9	Streptococcus_phage	39.7	2.8e-131
WP_071233660.1|502925_503552_-	lysoplasmalogenase	NA	A0A140XAH6	Dickeya_phage	43.4	1.1e-15
WP_020945126.1|503698_504103_+	DUF2500 domain-containing protein	NA	NA	NA	NA	NA
WP_004248877.1|504166_504460_-	DUF1145 family protein	NA	NA	NA	NA	NA
WP_104836207.1|504477_505062_-	16S rRNA (guanine(966)-N(2))-methyltransferase	NA	NA	NA	NA	NA
WP_104836208.1|505289_507188_+	signal recognition particle-docking protein FtsY	NA	NA	NA	NA	NA
WP_004245385.1|507193_507859_+	cell division ATP-binding protein FtsE	NA	A0A2H4PQG7	Staphylococcus_phage	24.4	9.4e-13
WP_004248880.1|507851_508829_+	cell division protein FtsX	NA	NA	NA	NA	NA
WP_004245383.1|509170_510025_+	RNA polymerase sigma factor RpoH	NA	A0A248SJA5	Salicola_phage	39.4	2.5e-42
WP_046335251.1|510118_511267_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	39.5	1.0e-43
WP_049196403.1|511242_511659_-	aspartate 1-decarboxylase autocleavage activator PanM	NA	NA	NA	NA	NA
WP_020945132.1|511670_512858_-	MFS transporter	NA	NA	NA	NA	NA
WP_064506226.1|512972_513449_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_004245378.1|513488_514241_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_046335253.1|514730_515825_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	30.6	2.6e-20
WP_104836209.1|515826_516675_-	sn-glycerol-3-phosphate ABC transporter permease UgpE	NA	NA	NA	NA	NA
WP_104836210.1|516674_517559_-	sn-glycerol-3-phosphate ABC transporter permease UgpA	NA	NA	NA	NA	NA
WP_104836211.1|517626_518931_-	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_049221530.1|519106_519823_+	glycerophosphoryl diester phosphodiesterase	NA	NA	NA	NA	NA
WP_104836212.1|519885_521082_-	cyanate transporter	NA	NA	NA	NA	NA
WP_041700912.1|521369_522335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004248892.1|522365_522782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017827057.1|522820_523147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004248896.1|523233_523668_+	DUF1240 domain-containing protein	NA	NA	NA	NA	NA
523852:523872	attL	TGTGGGGTACACGGTGGGGTA	NA	NA	NA	NA
WP_172767651.1|523980_525204_+|integrase	site-specific integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	60.2	7.5e-149
WP_172767652.1|525200_525971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767653.1|526077_526359_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_172767654.1|526487_527177_+	Rha family transcriptional regulator	NA	A0A0S2SYC0	Pseudomonas_phage	39.0	7.7e-10
WP_172767655.1|527645_527825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_109406124.1|528015_528192_+	host cell division inhibitor Icd-like protein	NA	A0A222YWG3	Escherichia_phage	56.8	1.2e-07
WP_151253057.1|528184_528373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049194573.1|528369_528564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161769011.1|528556_528877_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767656.1|528869_531197_+	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	40.7	6.6e-154
WP_094960346.1|531426_531615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767657.1|531843_532998_+|capsid	phage major capsid protein	capsid	A0A2H4JED2	uncultured_Caudovirales_phage	71.9	1.9e-154
WP_094960327.1|533051_533606_+|head,protease	HK97 family phage prohead protease	head,protease	A0A2H4JB68	uncultured_Caudovirales_phage	66.7	2.6e-64
WP_064718846.1|533605_534826_+|portal	phage portal protein	portal	A0A2H4JFJ9	uncultured_Caudovirales_phage	76.9	1.1e-189
WP_172767658.1|534822_535161_+|head	phage head closure protein	head	A0A1W6JP44	Morganella_phage	48.6	8.1e-21
WP_100159952.1|535153_535450_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2H4JD08	uncultured_Caudovirales_phage	69.1	2.1e-33
WP_172767659.1|535450_535897_+	HNH endonuclease	NA	A0A2H4JAS8	uncultured_Caudovirales_phage	62.2	1.9e-46
WP_004245345.1|536170_536524_+|terminase	phage terminase small subunit P27 family	terminase	A0A2H4JHS3	uncultured_Caudovirales_phage	82.1	1.1e-49
WP_172767660.1|536520_538182_+|terminase	terminase large subunit	terminase	A0A2H4JB64	uncultured_Caudovirales_phage	80.3	9.2e-275
WP_004245342.1|538902_539199_-	DNA-binding transcriptional regulator Fis	NA	NA	NA	NA	NA
538813:538833	attR	TGTGGGGTACACGGTGGGGTA	NA	NA	NA	NA
WP_004248899.1|539215_540187_-|tRNA	tRNA dihydrouridine synthase DusB	tRNA	NA	NA	NA	NA
WP_004245340.1|540508_541390_-	50S ribosomal protein L11 methyltransferase	NA	NA	NA	NA	NA
WP_004245338.1|541414_542860_-	sodium/pantothenate symporter	NA	NA	NA	NA	NA
WP_004252713.1|542849_543098_-	YhdT family protein	NA	NA	NA	NA	NA
WP_004245336.1|543328_544678_-	acetyl-CoA carboxylase biotin carboxylase subunit	NA	NA	NA	NA	NA
WP_004245333.1|544690_545161_-	acetyl-CoA carboxylase biotin carboxyl carrier protein	NA	NA	NA	NA	NA
WP_004245332.1|545193_545637_-	type II 3-dehydroquinate dehydratase	NA	NA	NA	NA	NA
WP_012368829.1|546070_547045_-	oxidoreductase	NA	NA	NA	NA	NA
WP_004245330.1|547731_548775_+	rod shape-determining protein MreB	NA	F2Y0P3	Organic_Lake_phycodnavirus	21.8	5.1e-05
WP_004248904.1|548876_549923_+	rod shape-determining protein MreC	NA	NA	NA	NA	NA
WP_026164602.1|549928_550417_+	rod shape-determining protein MreD	NA	NA	NA	NA	NA
WP_004248907.1|550468_551056_+	septum formation inhibitor Maf	NA	NA	NA	NA	NA
WP_004245326.1|551052_552522_+	ribonuclease G	NA	NA	NA	NA	NA
WP_104836213.1|552566_556370_+	AsmA2 domain-containing protein	NA	NA	NA	NA	NA
WP_004245324.1|556366_557227_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_004245322.1|557223_558669_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_036932390.1|558762_559269_+	ribonuclease	NA	NA	NA	NA	NA
WP_104836214.1|559268_559556_+	barstar family protein	NA	NA	NA	NA	NA
WP_004248913.1|559640_560201_-	ribosome-associated protein	NA	NA	NA	NA	NA
WP_004248914.1|560387_561716_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_004245312.1|561821_562232_-	nucleoside diphosphate kinase regulator	NA	NA	NA	NA	NA
WP_004245309.1|562406_562679_-	PTS phosphocarrier protein NPr	NA	NA	NA	NA	NA
WP_004245308.1|562675_563530_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	29.3	1.1e-05
WP_004245307.1|563614_564082_-	PTS IIA-like nitrogen regulatory protein PtsN	NA	NA	NA	NA	NA
WP_004248916.1|564237_564525_-	ribosome hibernation promoting factor	NA	NA	NA	NA	NA
WP_004248917.1|564548_566024_-	RNA polymerase factor sigma-54	NA	NA	NA	NA	NA
WP_004245304.1|566083_566809_-	LPS export ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.4	3.2e-22
WP_004245303.1|566815_567349_-	lipopolysaccharide ABC transporter substrate-binding protein LptA	NA	NA	NA	NA	NA
WP_004245302.1|567329_567908_-	LPS export ABC transporter periplasmic protein LptC	NA	NA	NA	NA	NA
WP_004245301.1|567925_568483_-	3-deoxy-manno-octulosonate-8-phosphatase KdsC	NA	A0A140XBD6	Dickeya_phage	76.1	1.1e-51
WP_017628220.1|568510_569485_-	arabinose-5-phosphate isomerase KdsD	NA	A0A2P0VNK5	Tetraselmis_virus	31.2	5.6e-38
WP_012368835.1|569503_570484_-	calcium/sodium antiporter	NA	NA	NA	NA	NA
WP_004245298.1|570727_571540_+	phospholipid ABC transporter ATP-binding protein MlaF	NA	G3M9Y6	Bacillus_virus	32.2	3.0e-21
WP_004248921.1|571543_572323_+	lipid asymmetry maintenance ABC transporter permease subunit MlaE	NA	NA	NA	NA	NA
WP_004252690.1|572326_572863_+	outer membrane lipid asymmetry maintenance protein MlaD	NA	NA	NA	NA	NA
WP_004245295.1|572936_573566_+	phospholipid-binding protein MlaC	NA	NA	NA	NA	NA
WP_004248922.1|573567_573861_+	lipid asymmetry maintenance protein MlaB	NA	NA	NA	NA	NA
WP_004245293.1|574000_574255_+	BolA family transcriptional regulator	NA	NA	NA	NA	NA
WP_004245292.1|574303_575566_+	UDP-N-acetylglucosamine 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_012368837.1|575649_576954_-	SIR2 family protein	NA	NA	NA	NA	NA
WP_104836215.1|576946_577858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036971299.1|578186_579236_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245290.1|579276_580347_-	outer membrane-stress sensor serine endopeptidase DegS	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	36.5	3.4e-12
WP_020945150.1|580538_581930_-	Do family serine endopeptidase	NA	A0A1B1IT49	uncultured_Mediterranean_phage	29.8	3.2e-23
WP_004245287.1|582157_582562_-	DUF1043 family protein	NA	NA	NA	NA	NA
WP_020945151.1|582764_583883_+	cell division protein ZapE	NA	NA	NA	NA	NA
WP_004245285.1|584332_584761_+	50S ribosomal protein L13	NA	NA	NA	NA	NA
WP_004245284.1|584776_585169_+	30S ribosomal protein S9	NA	NA	NA	NA	NA
WP_004245282.1|585803_586445_+	stringent starvation protein A	NA	NA	NA	NA	NA
WP_012368841.1|586451_586961_+|protease	ClpXP protease specificity-enhancing factor	protease	A0A1S5R3H3	Pseudomonas_phage	49.2	2.0e-23
>prophage 2
NZ_CP053898	Proteus mirabilis strain YPM35 chromosome, complete genome	4161306	1132296	1143650	4161306		Mycobacterium_phage(25.0%)	12	NA	NA
WP_004246075.1|1132296_1133496_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_004247427.1|1134105_1135074_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	3.5e-133
WP_075206322.1|1135099_1137226_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.2e-205
WP_104836297.1|1137254_1137659_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	6.3e-12
WP_004246071.1|1137670_1137895_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_017827772.1|1138176_1138650_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|1138847_1139057_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_004246058.1|1139513_1139888_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246057.1|1139903_1140869_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246056.1|1140970_1141615_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026090527.1|1141976_1142240_-	YbeD family protein	NA	NA	NA	NA	NA
WP_004246054.1|1142438_1143650_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
>prophage 3
NZ_CP053898	Proteus mirabilis strain YPM35 chromosome, complete genome	4161306	1292630	1397615	4161306	protease,tail,portal,capsid,head,tRNA,transposase,terminase,integrase,lysis	Morganella_phage(12.73%)	109	1296970:1296985	1349661:1349676
WP_004247587.1|1292630_1293332_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_004247588.1|1293325_1293793_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_094959986.1|1293928_1295956_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	24.0	4.6e-26
WP_004247590.1|1296160_1297273_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
1296970:1296985	attL	ACCCGTATTAGGTATT	NA	NA	NA	NA
WP_004247591.1|1297485_1298127_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.7	2.0e-36
WP_004244515.1|1298203_1298785_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	1.5e-30
WP_049218427.1|1298830_1300762_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_104836319.1|1301218_1302580_+	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_104836320.1|1302741_1304322_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.3	2.6e-37
WP_004247595.1|1304566_1305973_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D7RI04	Synechococcus_phage	29.7	8.6e-32
WP_080047956.1|1306041_1306293_-	pyocin activator PrtN family protein	NA	A0A1W6JP35	Morganella_phage	59.5	1.6e-18
WP_172767667.1|1306298_1306616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080047932.1|1306602_1307001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080047931.1|1306987_1307239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080047930.1|1307235_1307457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080047929.1|1307453_1308047_-	hypothetical protein	NA	A0A088C4R7	Shewanella_sp._phage	28.5	4.3e-09
WP_172767668.1|1308046_1308745_-	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	54.0	1.3e-57
WP_080047955.1|1308741_1308957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119563464.1|1308934_1309288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135024266.1|1309362_1309785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135024269.1|1309781_1310081_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172767669.1|1310077_1310482_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172409592.1|1310471_1310648_-	hypothetical protein	NA	NA	NA	NA	NA
WP_094959999.1|1310628_1310838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135024272.1|1310840_1311047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172767670.1|1311655_1312168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172767671.1|1312168_1313317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165122624.1|1313628_1314297_-	helix-turn-helix domain-containing protein	NA	K7P850	Enterobacteria_phage	54.5	1.7e-62
WP_172767672.1|1314402_1314621_+	hypothetical protein	NA	Q8W647	Enterobacteria_phage	75.0	5.2e-21
WP_172767812.1|1314613_1314862_+	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	56.0	1.4e-17
WP_172767673.1|1315123_1316689_+	DEAD/DEAH box helicase family protein	NA	A0A286N2P9	Klebsiella_phage	69.1	1.1e-218
WP_172767674.1|1316685_1317660_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	55.4	1.5e-104
WP_017827437.1|1317659_1318043_+	antitermination protein Q	NA	A0A088CD47	Shigella_phage	72.2	5.5e-50
WP_004247148.1|1318339_1318861_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_152964260.1|1318941_1319121_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_129623577.1|1319100_1319364_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_004250558.1|1319727_1319997_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.8	3.3e-17
WP_104836572.1|1319996_1320467_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	57.5	2.9e-48
WP_167767280.1|1320448_1320607_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767675.1|1320609_1321071_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	78.0	6.5e-45
WP_036976897.1|1321070_1321436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836570.1|1322069_1322447_+	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	72.4	2.5e-39
WP_104836569.1|1322506_1322857_+	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	93.0	2.4e-60
WP_049218006.1|1322853_1323051_+	hypothetical protein	NA	A0A1P8DTB8	Proteus_phage	87.7	6.4e-26
WP_104836568.1|1323198_1323672_+|terminase	phage terminase small subunit P27 family	terminase	A0A1P8DTK5	Proteus_phage	66.9	9.2e-55
WP_071425264.1|1323675_1325409_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	98.2	0.0e+00
WP_017827276.1|1325405_1325567_+	hypothetical protein	NA	A0A1W6JP78	Morganella_phage	62.3	1.6e-11
WP_036905261.1|1325556_1326786_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	87.8	4.8e-212
WP_036905264.1|1326775_1327381_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	81.0	5.3e-87
WP_064506418.1|1327396_1328626_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	82.0	2.9e-185
WP_026164628.1|1328711_1329014_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	70.0	6.8e-35
WP_080749322.1|1329020_1329347_+|head	phage head closure protein	head	Q7Y406	Yersinia_phage	44.5	2.6e-16
WP_017827270.1|1329333_1329723_+	hypothetical protein	NA	Q7Y405	Yersinia_phage	50.0	1.0e-30
WP_026164627.1|1329731_1330124_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	57.9	1.2e-31
WP_060961287.1|1330146_1330623_+|tail	phage tail protein	tail	Q7Y403	Yersinia_phage	75.5	1.2e-57
WP_017827267.1|1330622_1330973_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	40.5	6.2e-16
WP_172767676.1|1331229_1334535_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	43.5	2.7e-193
WP_036901058.1|1334535_1335135_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	55.4	4.0e-55
WP_017827264.1|1335131_1335713_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	1.1e-49
WP_172767677.1|1335754_1336399_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049210594.1|1336464_1336863_+	hypothetical protein	NA	A0A2H4IYI8	uncultured_Caudovirales_phage	47.7	4.1e-32
WP_172767678.1|1336863_1339785_+	DUF1983 domain-containing protein	NA	Q7Y3Z3	Yersinia_phage	49.1	5.1e-188
WP_172767679.1|1339787_1340828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080047907.1|1343241_1343616_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080047906.1|1343693_1344776_-|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	62.5	4.8e-131
WP_104836321.1|1345076_1345574_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
WP_036920008.1|1345887_1347039_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_049197219.1|1347181_1347799_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	30.1	1.2e-14
WP_004244523.1|1347798_1348572_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_004244524.1|1348553_1349291_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_094959759.1|1349297_1349888_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
1349661:1349676	attR	AATACCTAATACGGGT	NA	NA	NA	NA
WP_104836322.1|1349887_1350955_-	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_104836323.1|1351003_1352086_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_004252067.1|1352088_1353405_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_004244529.1|1353411_1354311_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	84.2	2.5e-08
WP_004247604.1|1354817_1355639_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004244532.1|1355635_1356256_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_004247605.1|1356413_1357616_+	serine hydrolase	NA	B6DZZ7	Stx2-converting_phage	50.1	4.0e-102
WP_161769285.1|1357705_1359376_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_004244536.1|1359723_1361088_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_004244537.1|1361202_1362531_-	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_041701073.1|1363460_1364072_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_104836325.1|1364929_1366138_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.5	2.5e-189
WP_004244541.1|1366516_1366780_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	6.5e-26
WP_004247610.1|1366950_1367253_+	YbjC family protein	NA	NA	NA	NA	NA
WP_012367695.1|1367422_1367926_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_049221460.1|1367954_1369088_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.5	4.5e-23
WP_004244548.1|1369230_1369899_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_004244549.1|1369898_1370603_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004244550.1|1370633_1371368_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012367698.1|1371382_1372111_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	8.4e-31
WP_036971351.1|1372217_1373681_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_004244553.1|1373732_1374635_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_020945404.1|1374980_1376654_+	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
WP_004244555.1|1376795_1377905_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_004247615.1|1377904_1379848_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.3	6.5e-38
WP_020945405.1|1380010_1380220_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	59.7	3.7e-16
WP_004244558.1|1380509_1380824_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_004244559.1|1380854_1383149_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244560.1|1383268_1383487_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_004247616.1|1383806_1384499_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_104836326.1|1384500_1386252_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	22.8	6.8e-18
WP_104836327.1|1386254_1388024_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	23.5	3.0e-21
WP_004247618.1|1388165_1389125_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	45.8	1.2e-64
WP_004244566.1|1389667_1390162_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_172767680.1|1390289_1394114_+	DNA translocase FtsK 4TM domain-containing protein	NA	A0A218M9A2	Mycobacterium_phage	49.3	1.7e-90
WP_004244569.1|1394226_1394832_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_012367706.1|1394842_1396192_+	replication-associated recombination protein A	NA	G3MBE0	Bacillus_virus	40.6	1.8e-79
WP_004244571.1|1396325_1397615_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	46.2	4.1e-97
>prophage 4
NZ_CP053898	Proteus mirabilis strain YPM35 chromosome, complete genome	4161306	1473436	1521203	4161306	tail,capsid,terminase,integrase,holin	Salmonella_phage(20.75%)	74	1473255:1473307	1521412:1521464
1473255:1473307	attL	TCTCTCCTCCTCCGCCATTTCAATGTCTCCTAACATCTCCTGAAGTCTCCTTA	NA	NA	NA	NA
WP_063693505.1|1473436_1474621_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	51.8	6.8e-115
WP_004247694.1|1474624_1474831_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	46.4	8.7e-10
WP_172767682.1|1475654_1476017_-	DUF2591 family protein	NA	A0A1P8DTH6	Proteus_phage	42.5	2.7e-14
WP_012367596.1|1476009_1476186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172767683.1|1476343_1476589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172767684.1|1476581_1476836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105881171.1|1476945_1477104_-	hook protein	NA	NA	NA	NA	NA
WP_172767685.1|1477144_1477702_-	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	60.0	3.1e-57
WP_159287667.1|1477691_1478390_-	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	57.3	1.2e-74
WP_172767686.1|1478386_1479271_-	recombinase RecT	NA	A0A2L1IV84	Escherichia_phage	62.2	1.0e-94
WP_172767687.1|1479267_1479519_-	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	92.8	2.7e-37
WP_172764467.1|1479515_1479770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036905381.1|1479986_1480247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161747556.1|1480264_1481206_-	cell envelope biogenesis protein TolA	NA	A0A2I7QK72	Vibrio_phage	46.6	2.3e-20
WP_162557014.1|1481270_1481435_-	hypothetical protein	NA	A0A1W6JP47	Morganella_phage	59.3	6.1e-14
WP_112842868.1|1481469_1482060_-	DUF5420 family protein	NA	A0A2I7QRH1	Vibrio_phage	30.8	1.5e-14
WP_172767688.1|1482117_1482291_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172767594.1|1482293_1482608_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073724.1|1483070_1483895_-	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	41.0	9.5e-39
WP_063073725.1|1484224_1484950_-	helix-turn-helix transcriptional regulator	NA	A0A2I6PIE7	Escherichia_phage	42.0	1.2e-40
WP_036907955.1|1485054_1485282_+	helix-turn-helix domain-containing protein	NA	E5AGE7	Erwinia_phage	67.6	6.0e-20
WP_063073726.1|1485424_1485757_+	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	99.1	3.5e-53
WP_063073727.1|1485778_1486462_+	phage antirepressor KilAC domain-containing protein	NA	A0A1P8DTE1	Proteus_phage	93.4	1.8e-112
WP_063073728.1|1486416_1486821_+	HNH endonuclease	NA	A0A1C9LVX4	Vibrio_phage	36.6	8.2e-12
WP_080978860.1|1487526_1488213_+	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	78.2	4.4e-98
WP_172767689.1|1488223_1489135_+	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	60.5	3.2e-96
WP_036976922.1|1489155_1489359_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152964332.1|1489369_1489537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088206657.1|1489600_1489846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767690.1|1489842_1490070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767691.1|1490066_1490240_+	restriction alleviation protein, Lar family	NA	NA	NA	NA	NA
WP_172767692.1|1490253_1490703_+	hypothetical protein	NA	A0A2I7R9W3	Vibrio_phage	35.1	6.4e-13
WP_172767693.1|1490699_1491059_+	hypothetical protein	NA	A0A077KB17	Edwardsiella_phage	38.8	2.2e-08
WP_172767694.1|1491055_1491196_+	hypothetical protein	NA	A0A1P8DTE6	Proteus_phage	90.2	7.2e-16
WP_124743776.1|1491332_1491953_+	recombination protein NinG	NA	A0A2I7RAC0	Vibrio_phage	53.6	3.0e-45
WP_172767695.1|1491952_1492144_+	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	92.1	5.6e-27
WP_081355096.1|1492140_1492779_+	hypothetical protein	NA	Q8HA89	Salmonella_phage	37.3	7.9e-33
WP_004916901.1|1493281_1493671_+	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_109848314.1|1493667_1493955_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_124724701.1|1493947_1494352_+	structural protein	NA	A0A2I7RXE2	Vibrio_phage	50.8	6.9e-27
WP_172767696.1|1494348_1494729_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767697.1|1494616_1494868_+	peptidase	NA	Q8SBD8	Shigella_phage	46.3	1.5e-11
WP_172767698.1|1494878_1495067_+	hypothetical protein	NA	A0A2I7RUD6	Vibrio_phage	85.2	5.3e-22
WP_172767699.1|1495523_1496306_+	KilA-N domain-containing protein	NA	K7PH51	Enterobacterial_phage	43.7	8.4e-53
WP_172767595.1|1496322_1496592_+	hypothetical protein	NA	NA	NA	NA	NA
WP_161682837.1|1496660_1496846_+	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	72.1	1.7e-20
WP_161682835.1|1496993_1497434_+	ubiquitin carboxyl-hydrolase	NA	Q716H4	Shigella_phage	65.5	1.7e-42
WP_172767700.1|1497414_1498659_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1V0E5Q3	Salmonella_phage	73.5	3.5e-186
WP_172767701.1|1498658_1500014_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	63.6	3.2e-161
WP_172767702.1|1499964_1500894_+|capsid	minor capsid protein	capsid	A0A1V0E5Q2	Salmonella_phage	54.4	2.3e-89
WP_172767703.1|1500897_1502175_+	hypothetical protein	NA	A0A1V0E5Q9	Salmonella_phage	69.1	6.4e-167
WP_172767704.1|1502174_1502621_+	hypothetical protein	NA	I6S1Q2	Salmonella_phage	67.8	1.6e-45
WP_004247762.1|1502636_1503731_+	hypothetical protein	NA	G0ZND9	Cronobacter_phage	68.9	2.0e-145
WP_004247764.1|1503740_1503914_+	hypothetical protein	NA	I6R9A3	Salmonella_phage	51.8	1.4e-08
WP_172767705.1|1503970_1504369_+	hypothetical protein	NA	I6S619	Salmonella_phage	78.8	1.3e-54
WP_172767706.1|1504368_1504707_+	hypothetical protein	NA	A0A1W6JNW7	Morganella_phage	53.4	4.2e-25
WP_172767707.1|1504708_1505080_+	HK97 gp10 family phage protein	NA	G0ZNE3	Cronobacter_phage	64.2	5.6e-39
WP_094960235.1|1505076_1505445_+	hypothetical protein	NA	F1C5E4	Cronobacter_phage	28.7	2.0e-09
WP_121909259.1|1505509_1506265_+	Ig-like domain-containing protein	NA	A0A1W6JNT1	Morganella_phage	79.7	2.0e-107
WP_060556627.1|1506314_1507007_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	71.9	1.2e-90
WP_172767708.1|1507079_1507403_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_155195934.1|1507500_1507671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767709.1|1508387_1509200_+	Rha family transcriptional regulator	NA	A0A2I7RX10	Vibrio_phage	41.4	3.0e-45
WP_063693349.1|1509322_1509730_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767710.1|1509801_1512966_+	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	44.3	5.7e-108
WP_172767711.1|1512981_1513239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767712.1|1513241_1513457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063109161.1|1513601_1513931_+|tail	phage tail protein	tail	A0A1W6JNT2	Morganella_phage	72.5	7.3e-43
WP_049199072.1|1513927_1514626_+|tail	phage minor tail protein L	tail	A0A1W6JNT8	Morganella_phage	83.6	1.8e-115
WP_161668639.1|1514629_1515349_+	C40 family peptidase	NA	A0A1W6JNU8	Morganella_phage	74.9	1.3e-111
WP_172767713.1|1515285_1515852_+|tail	tail assembly protein	tail	A0A1W6JP03	Morganella_phage	63.9	9.7e-35
WP_172767714.1|1515851_1519526_+	host specificity protein J	NA	A0A1W6JNW2	Morganella_phage	66.0	0.0e+00
WP_172767715.1|1519543_1520968_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	54.7	9.7e-116
WP_172767716.1|1520972_1521203_-	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	94.7	4.1e-32
1521412:1521464	attR	TCTCTCCTCCTCCGCCATTTCAATGTCTCCTAACATCTCCTGAAGTCTCCTTA	NA	NA	NA	NA
>prophage 5
NZ_CP053898	Proteus mirabilis strain YPM35 chromosome, complete genome	4161306	1541214	1598323	4161306	head,plate,transposase,terminase,integrase,lysis	Burkholderia_phage(19.51%)	69	1539584:1539643	1581053:1581147
1539584:1539643	attL	CAGACATAAAAAAACCAACCGTAAGTGGTTGGTTTTCTTAAATAAAAATGGTCGGCATGA	NA	NA	NA	NA
WP_163784957.1|1541214_1542390_-|integrase	site-specific integrase	integrase	A0A2H4J1K3	uncultured_Caudovirales_phage	29.5	7.2e-32
WP_161772614.1|1542391_1542604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250514.1|1543015_1543186_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250516.1|1543213_1543393_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836353.1|1543440_1543941_-	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	55.2	1.2e-39
WP_163784958.1|1543940_1545908_-	hypothetical protein	NA	H9C157	Pectobacterium_phage	39.6	1.3e-118
WP_004250523.1|1545920_1546181_-	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	45.3	7.9e-08
WP_036908171.1|1546180_1546513_-	hypothetical protein	NA	H9C158	Pectobacterium_phage	39.2	2.1e-05
WP_060556278.1|1546770_1546971_+	hypothetical protein	NA	NA	NA	NA	NA
WP_074561911.1|1546967_1547348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250527.1|1547675_1548434_-	helix-turn-helix transcriptional regulator	NA	A0A0M3LPF9	Mannheimia_phage	39.0	1.5e-27
WP_036937922.1|1548538_1548787_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020945464.1|1548834_1549290_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	55.4	9.9e-30
WP_172767717.1|1549307_1549532_+	hypothetical protein	NA	H9C163	Pectobacterium_phage	55.4	9.5e-18
WP_049210198.1|1549533_1550385_+	helix-turn-helix domain-containing protein	NA	Q8W642	Enterobacteria_phage	58.3	4.0e-32
WP_036895392.1|1550377_1550971_+	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	47.6	1.1e-44
WP_172767718.1|1550963_1552337_+	replicative DNA helicase	NA	A0A192Y673	Salmonella_phage	45.4	2.5e-100
WP_172767719.1|1552459_1553782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_163784796.1|1553907_1554501_+	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	54.7	2.5e-57
WP_071425521.1|1554512_1554824_+	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	68.8	1.0e-33
WP_087740823.1|1554858_1555407_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	44.9	8.2e-31
WP_020945472.1|1555534_1555855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_041701088.1|1555969_1556338_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250558.1|1556418_1556688_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	47.8	3.3e-17
WP_004250560.1|1556687_1557158_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	57.5	1.1e-47
WP_004250562.1|1557139_1557298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250565.1|1557300_1557762_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	34.0	8.5e-13
WP_020945474.1|1558251_1559262_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	37.0	1.1e-36
WP_172767720.1|1559469_1561074_+	TerL protein	NA	A9YWZ6	Burkholderia_phage	63.9	4.6e-199
WP_172767721.1|1561078_1562581_+	DUF1073 domain-containing protein	NA	A0A2H4P6S9	Pseudomonas_phage	42.7	5.5e-101
WP_172767813.1|1562618_1563332_+|head	phage head morphogenesis protein	head	A0A2H5BG15	Pseudoalteromonas_phage	34.7	6.7e-33
WP_172767722.1|1563328_1564588_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	50.8	1.0e-44
WP_049209851.1|1564587_1565085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767723.1|1565084_1566152_+	DUF2184 domain-containing protein	NA	A0A088C493	Shewanella_sp._phage	39.3	8.8e-53
WP_080047798.1|1566232_1566574_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	35.5	1.6e-08
WP_115353730.1|1566576_1567008_+	DUF4054 domain-containing protein	NA	Q6IWU8	Burkholderia_phage	31.7	5.7e-11
WP_172767724.1|1567007_1567466_+	hypothetical protein	NA	NA	NA	NA	NA
WP_165708651.1|1567465_1567837_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036937870.1|1567823_1568339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767725.1|1568347_1569835_+	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	37.5	4.3e-82
WP_004250586.1|1569845_1570298_+	hypothetical protein	NA	I7ATP4	Escherichia_phage	38.1	5.8e-22
WP_004250588.1|1570338_1570797_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	6.7e-26
WP_172767726.1|1570880_1573232_+	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	25.8	1.5e-17
WP_004250592.1|1573228_1573756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250595.1|1573755_1574073_+	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	32.3	7.4e-08
WP_036895344.1|1574038_1574854_+	hypothetical protein	NA	I7B2Q1	Escherichia_phage	27.1	2.9e-16
WP_004250599.1|1574856_1575549_+	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	40.1	2.2e-28
WP_004250600.1|1575545_1575890_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004250602.1|1575882_1577070_+|plate	baseplate J/gp47 family protein	plate	Q6IWQ3	Burkholderia_phage	40.6	1.1e-69
WP_004250603.1|1577066_1577723_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	40.3	7.5e-39
WP_107336970.1|1579242_1580775_-	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_063108968.1|1581303_1583037_-	DUF3413 domain-containing protein	NA	NA	NA	NA	NA
1581053:1581147	attR	CAGACATAAAAAAACCAACCGTAAGTGGTTGGTTTTCTTAAATAAAAATGGTCGGCATGATAGGATTTGAACCTACGACCCCTGACACCCCATGA	NA	NA	NA	NA
WP_004247042.1|1583060_1583288_-	YejL family protein	NA	NA	NA	NA	NA
WP_104836373.1|1583451_1584456_+	nucleoid-associated protein YejK	NA	A0A1V0E8C0	Vibrio_phage	47.9	4.3e-86
WP_004247799.1|1584539_1584824_-	50S ribosomal protein L25	NA	NA	NA	NA	NA
WP_104836861.1|1584964_1586728_-	DEAD/DEAH box helicase	NA	M4Q3N1	Vibrio_phage	41.2	1.1e-95
WP_049197359.1|1586922_1587627_+	16S rRNA pseudouridine(516) synthase RsuA	NA	NA	NA	NA	NA
WP_004247802.1|1587662_1588847_+	Bcr/CflA family multidrug efflux MFS transporter	NA	S4TR35	Salmonella_phage	23.9	3.6e-23
WP_004247049.1|1589362_1589710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247050.1|1589895_1590510_-	bifunctional murein DD-endopeptidase/murein LD-carboxypeptidase	NA	A0A0A8WIF2	Clostridium_phage	33.9	2.0e-09
WP_004247803.1|1590858_1591581_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_004247052.1|1591927_1592239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247806.1|1592503_1592830_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247807.1|1592964_1593537_-	elongation factor P-like protein YeiP	NA	NA	NA	NA	NA
WP_064505934.1|1593671_1594913_-	tryptophan permease	NA	NA	NA	NA	NA
WP_012367754.1|1595210_1595627_-	NUDIX domain-containing protein	NA	NA	NA	NA	NA
WP_104836374.1|1595711_1596557_-	deoxyribonuclease IV	NA	A0A1V0SBL9	Catovirus	33.7	1.2e-25
WP_172767727.1|1596675_1597884_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.3	2.8e-188
WP_012368599.1|1597906_1598323_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	1.5e-45
>prophage 6
NZ_CP053898	Proteus mirabilis strain YPM35 chromosome, complete genome	4161306	1657445	1702103	4161306	protease,tail,portal,capsid,head,tRNA,transposase,terminase,integrase,lysis	Morganella_phage(23.53%)	51	1648822:1648835	1667019:1667032
1648822:1648835	attL	AATTGATGTTTTCT	NA	NA	NA	NA
WP_004247117.1|1657445_1658549_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004247118.1|1658654_1659107_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_104836381.1|1659099_1659729_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004251822.1|1659867_1661121_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	90.7	1.8e-20
WP_110706675.1|1661229_1662363_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	72.2	2.9e-155
WP_017628380.1|1662337_1662589_-	excisionase	NA	NA	NA	NA	NA
WP_110706674.1|1662674_1663199_-	HD family hydrolase	NA	A0A1W6JP41	Morganella_phage	61.6	6.0e-55
WP_017628378.1|1663483_1664116_-	LexA family transcriptional regulator	NA	K7PLZ5	Enterobacterial_phage	44.4	1.5e-39
WP_006537203.1|1664216_1664423_+	cell division protein	NA	H9C161	Pectobacterium_phage	40.7	8.5e-05
WP_110706673.1|1664460_1664937_+	hypothetical protein	NA	A0A1W6JP72	Morganella_phage	60.4	3.0e-45
WP_036908081.1|1665198_1665378_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	55.2	2.6e-10
WP_110706931.1|1665935_1666451_+	hypothetical protein	NA	U5P0A0	Shigella_phage	44.2	2.0e-23
WP_110706671.1|1666472_1667279_+	KilA-N domain-containing protein	NA	A0A1W6JP13	Morganella_phage	62.1	3.0e-90
1667019:1667032	attR	AGAAAACATCAATT	NA	NA	NA	NA
WP_110706670.1|1667275_1668301_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	46.8	1.3e-85
WP_110706669.1|1668328_1668727_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	54.3	1.6e-31
WP_006537195.1|1669067_1669280_+	RNA chaperone/antiterminator CspA	NA	A0A1W6JNX5	Morganella_phage	80.0	6.8e-26
WP_036937653.1|1669611_1670070_+	Hsp20 family protein	NA	NA	NA	NA	NA
WP_110706668.1|1670388_1671933_-	RNA-directed DNA polymerase	NA	Q2P9X0	Enterobacteria_phage	76.3	6.8e-232
WP_121910090.1|1672180_1673104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_110706666.1|1673743_1674166_+	hypothetical protein	NA	J9Q7I1	Salmonella_phage	31.7	2.6e-08
WP_063691653.1|1674231_1674501_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	54.4	5.5e-20
WP_110706665.1|1674500_1674971_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	1.4e-50
WP_165718961.1|1674952_1675111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_121910091.1|1675113_1675575_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	45.6	2.4e-23
WP_121910092.1|1676868_1677276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767728.1|1677272_1677611_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	66.1	1.7e-39
WP_060556835.1|1677613_1677826_+	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	46.3	6.4e-08
WP_017628364.1|1677950_1678418_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	1.6e-43
WP_017628363.1|1678371_1680105_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.6	3.1e-148
WP_161779728.1|1680104_1681373_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.2	3.9e-201
WP_004242476.1|1681390_1682059_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.8	6.6e-83
WP_017628361.1|1682062_1683229_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.5	1.6e-169
WP_017628360.1|1683267_1683567_+|head,tail	phage head-tail connector protein	head,tail	K7PKV5	Enterobacterial_phage	65.3	5.7e-34
WP_017628359.1|1683566_1683896_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_017628358.1|1683885_1684359_+	HK97 gp10 family phage protein	NA	A0A0R6PHU8	Moraxella_phage	30.2	8.2e-11
WP_017628357.1|1684364_1684706_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_017628356.1|1684715_1685381_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628355.1|1685445_1685862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628354.1|1685858_1686137_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004242485.1|1686161_1686353_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_172767729.1|1686479_1689755_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	46.7	2.9e-54
WP_017628352.1|1689755_1690352_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.3	1.6e-51
WP_017628351.1|1690351_1690933_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.5	8.1e-53
WP_049219722.1|1690949_1691285_+	hypothetical protein	NA	Q775B6	Bordetella_phage	35.3	3.7e-10
WP_049219720.1|1691363_1691762_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	46.2	7.1e-32
WP_049219718.1|1696168_1696507_-	BON domain-containing protein	NA	NA	NA	NA	NA
WP_049219717.1|1696650_1696899_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_060555884.1|1696952_1699259_-	YadA-like family protein	NA	A0A2L1IV32	Escherichia_phage	60.3	2.2e-16
WP_017827607.1|1699869_1700022_+	isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.0	6.8e-20
WP_020945527.1|1700190_1700349_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_158660324.1|1701860_1702103_+|transposase	transposase	transposase	A0A1B0VCD8	Salmonella_phage	81.7	2.6e-21
>prophage 7
NZ_CP053898	Proteus mirabilis strain YPM35 chromosome, complete genome	4161306	1956597	1966589	4161306		Escherichia_phage(66.67%)	8	NA	NA
WP_017628120.1|1956597_1958655_-	potassium-transporting ATPase subunit KdpB	NA	E4ZFI9	Streptococcus_phage	26.1	2.2e-31
WP_004248043.1|1958666_1960367_-	potassium-transporting ATPase subunit KdpA	NA	NA	NA	NA	NA
WP_004242887.1|1960702_1961389_+	ankyrin repeat domain-containing protein	NA	NA	NA	NA	NA
WP_004242888.1|1961388_1961850_+	nucleoside deaminase	NA	S4VYZ2	Pandoravirus	34.6	7.0e-15
WP_104836433.1|1961902_1962514_-	Tat proofreading chaperone DmsD	NA	A0A077SLS7	Escherichia_phage	39.1	5.6e-28
WP_004242891.1|1962653_1963514_-	dimethyl sulfoxide reductase anchor subunit family protein	NA	A0A077SK59	Escherichia_phage	35.5	3.7e-25
WP_004242892.1|1963515_1964133_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	58.6	2.2e-72
WP_017628118.1|1964144_1966589_-	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	50.4	5.6e-220
>prophage 8
NZ_CP053898	Proteus mirabilis strain YPM35 chromosome, complete genome	4161306	2301407	2342019	4161306	tail,holin,terminase,integrase	Salmonella_phage(17.65%)	48	2318141:2318155	2343415:2343429
WP_104836480.1|2301407_2302460_-	nucleotidyltransferase domain-containing protein	NA	A0A067XQU1	Caulobacter_phage	22.8	1.2e-06
WP_012368028.1|2302443_2303223_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	39.3	1.1e-31
WP_109418842.1|2303601_2304096_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020945794.1|2304095_2304440_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	84.3	7.7e-43
WP_104836483.1|2304442_2304715_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	37.8	3.2e-12
WP_020945795.1|2304711_2305083_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	39.1	3.9e-16
WP_172767815.1|2305244_2307527_-	hypothetical protein	NA	A0A193GYU1	Enterobacter_phage	44.9	1.5e-49
WP_109418844.1|2308033_2308285_+	hypothetical protein	NA	NA	NA	NA	NA
WP_109418845.1|2308363_2308975_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767737.1|2309043_2312427_-	hypothetical protein	NA	A0A2I7RY58	Vibrio_phage	36.4	2.0e-183
WP_172767738.1|2312426_2315510_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	50.5	6.0e-163
WP_109910716.1|2315512_2316061_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	60.2	3.4e-45
WP_172767739.1|2316060_2316549_-	hypothetical protein	NA	A0A0F6R7N6	Escherichia_coli_O157_typing_phage	60.5	9.2e-50
WP_172767740.1|2316532_2318995_-	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	70.1	0.0e+00
2318141:2318155	attL	TTTGCCATCTTCACT	NA	NA	NA	NA
WP_104836493.1|2318994_2319600_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	60.7	6.7e-66
WP_020945806.1|2319599_2319911_-	hypothetical protein	NA	Q858G5	Salmonella_phage	38.5	8.8e-14
WP_156868320.1|2319974_2320316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060555916.1|2320324_2320756_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	54.8	1.4e-30
WP_172767741.1|2320814_2321795_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	59.1	2.5e-110
WP_152134580.1|2321810_2322488_-	peptidase	NA	T1SAP9	Salmonella_phage	62.9	4.4e-42
WP_109391136.1|2322505_2322820_-	hypothetical protein	NA	Q2A090	Sodalis_phage	45.5	1.2e-13
WP_109023880.1|2322816_2324481_-|tail	phage tail protein	tail	A0A193GYI4	Enterobacter_phage	65.2	1.2e-197
WP_004243356.1|2324490_2324703_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123822191.1|2324886_2326371_-|terminase	terminase	terminase	G9L6B8	Escherichia_phage	77.8	1.2e-230
WP_080047821.1|2326370_2326934_-|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	50.3	2.5e-43
WP_172767742.1|2327038_2327398_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	58.3	1.1e-28
WP_172767743.1|2327457_2327952_-	hypothetical protein	NA	NA	NA	NA	NA
WP_070486730.1|2327962_2328157_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172767744.1|2328187_2328457_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143475677.1|2328504_2328900_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.9	1.2e-34
WP_143475676.1|2328896_2329310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243368.1|2329555_2330281_-	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	78.8	6.7e-105
WP_036976826.1|2330280_2331123_-	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	59.7	3.8e-51
WP_004243371.1|2331133_2331319_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	50.8	6.0e-10
WP_064505757.1|2331457_2331736_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243373.1|2331813_2332422_+	hypothetical protein	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	35.4	1.5e-28
WP_004243375.1|2332670_2332832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767745.1|2332818_2334543_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A0U2I1R6	Escherichia_phage	47.5	9.3e-113
WP_172767746.1|2334588_2335671_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	54.4	1.2e-105
WP_004250862.1|2335715_2335973_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_109418857.1|2336039_2336918_+	DNA cytosine methyltransferase	NA	A0A120HUM8	Bacillus_phage	25.8	4.6e-23
WP_172767747.1|2336924_2337626_+	hypothetical protein	NA	R9VWB9	Serratia_phage	51.2	6.3e-60
WP_109418919.1|2337798_2339253_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_172767748.1|2339315_2339789_+	class I SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	78.7	9.2e-71
WP_172767749.1|2339785_2340427_+	DNA methyltransferase	NA	I6PDF5	Cronobacter_phage	60.6	5.1e-72
WP_163754225.1|2340429_2340627_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	63.5	2.4e-17
WP_020945830.1|2340626_2340815_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767750.1|2340822_2342019_-|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	61.7	2.8e-140
2343415:2343429	attR	TTTGCCATCTTCACT	NA	NA	NA	NA
>prophage 9
NZ_CP053898	Proteus mirabilis strain YPM35 chromosome, complete genome	4161306	2528591	2547480	4161306	holin,plate,lysis	Escherichia_phage(21.43%)	21	NA	NA
WP_012368081.1|2528591_2531030_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
WP_004243609.1|2531041_2531659_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_004243611.1|2531662_2532439_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_104836535.1|2532554_2533097_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.2	2.7e-18
WP_017628013.1|2533665_2533845_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_004243615.1|2535244_2535901_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.9	2.3e-35
WP_104836536.1|2535897_2537085_-|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	37.9	1.3e-73
WP_004243617.1|2537077_2537422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368086.1|2537418_2538111_-	hypothetical protein	NA	A1Z003	Burkholderia_virus	37.1	1.6e-34
WP_004243622.1|2538113_2538926_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|2538894_2539215_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243624.1|2539227_2539716_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250717.1|2539718_2542022_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.3	1.1e-15
WP_004243627.1|2542104_2542563_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_004243628.1|2542622_2543075_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368089.1|2543085_2544573_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	4.2e-77
WP_012368090.1|2544581_2545094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368091.1|2545130_2545580_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_004243635.1|2545576_2545981_-	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	45.8	3.8e-25
WP_004248367.1|2545983_2546283_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_104836537.1|2546664_2547480_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	3.5e-54
>prophage 10
NZ_CP053898	Proteus mirabilis strain YPM35 chromosome, complete genome	4161306	2757510	2857978	4161306	protease,tail,portal,capsid,holin,head,plate,transposase,tRNA,terminase,integrase,lysis	Salmonella_phage(23.91%)	100	2845978:2845993	2852586:2852601
WP_104836595.1|2757510_2758752_+|integrase	integrase	integrase	A0A1B5FPC6	Escherichia_phage	46.8	2.4e-102
WP_104836596.1|2758966_2760277_-	hypothetical protein	NA	Q858S9	Enterobacteria_phage	33.6	5.7e-62
WP_104836597.1|2760452_2760743_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158660327.1|2760806_2761802_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836599.1|2762494_2764078_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152994956.1|2765210_2765591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335210.1|2765970_2766666_+	fimbrial protein	NA	NA	NA	NA	NA
WP_104836600.1|2766792_2767920_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836601.1|2768452_2769157_+	fimbrial protein	NA	NA	NA	NA	NA
WP_041701197.1|2772859_2773288_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004248486.1|2773277_2773535_+	MafI family immunity protein	NA	NA	NA	NA	NA
WP_046335316.1|2774227_2774914_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_104836602.1|2775505_2775901_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_004250418.1|2775912_2777409_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_096043063.1|2778548_2779565_-|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	7.0e-185
WP_104836603.1|2780062_2780641_-	histidine phosphatase family protein	NA	M1IB93	Acanthocystis_turfacea_Chlorella_virus	35.1	2.5e-30
WP_004243958.1|2780669_2781248_-	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_004243961.1|2783224_2784751_+	L-lactate permease	NA	NA	NA	NA	NA
WP_104836604.1|2784887_2785607_+	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_060554794.1|2785617_2787039_+	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_004250409.1|2787040_2787745_+	lactate utilization protein C	NA	NA	NA	NA	NA
WP_012368164.1|2787851_2788265_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_004248496.1|2788721_2789066_+	DMT family protein	NA	NA	NA	NA	NA
WP_104836605.1|2789453_2789837_+	YkgJ family cysteine cluster protein	NA	NA	NA	NA	NA
WP_104731732.1|2790304_2790958_-	DUF1287 domain-containing protein	NA	NA	NA	NA	NA
WP_004248501.1|2791082_2792249_-	MFS transporter	NA	NA	NA	NA	NA
WP_060554795.1|2792607_2793465_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_004243977.1|2793545_2795585_-	IreA family TonB-dependent siderophore receptor	NA	A0A0P0I887	Acinetobacter_phage	31.4	4.8e-15
WP_004243978.1|2795822_2797457_-	sodium/sugar symporter	NA	A0A240F3J2	Aeromonas_phage	39.0	7.5e-88
WP_004243980.1|2797833_2798844_-	substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_046334641.1|2799023_2800094_-	galactose-1-epimerase	NA	NA	NA	NA	NA
WP_020945988.1|2800080_2801253_-	galactokinase	NA	NA	NA	NA	NA
WP_004243985.1|2801364_2802423_-	UDP-glucose--hexose-1-phosphate uridylyltransferase	NA	NA	NA	NA	NA
WP_004248507.1|2802471_2803488_-	UDP-glucose 4-epimerase GalE	NA	A0A2K9L5H6	Tupanvirus	48.9	5.7e-86
WP_004248508.1|2803919_2804879_+	glyoxylate/hydroxypyruvate reductase GhrB	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	25.9	1.1e-17
WP_004243988.1|2804954_2805872_-	cation transporter	NA	NA	NA	NA	NA
WP_004248510.1|2806412_2806850_+	universal stress protein	NA	NA	NA	NA	NA
WP_004243990.1|2806912_2807404_-|protease	serine protease inhibitor ecotin	protease	NA	NA	NA	NA
WP_004243991.1|2807656_2807872_+	DUF465 domain-containing protein	NA	NA	NA	NA	NA
WP_004248513.1|2808016_2808256_+	YecH family protein	NA	NA	NA	NA	NA
WP_012368173.1|2808368_2808614_-	DinI-like family protein	NA	A0A0M4S6H1	Salmonella_phage	38.2	2.7e-10
WP_004248514.1|2808798_2809146_+	nitrous oxide-stimulated promoter family protein	NA	NA	NA	NA	NA
WP_046334644.1|2809123_2809684_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004243999.1|2809758_2810445_-	polymer-forming cytoskeletal protein	NA	NA	NA	NA	NA
WP_004244000.1|2811533_2812370_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_046334645.1|2812436_2813297_+	T3SS regulon anti-activator ExsD family protein	NA	NA	NA	NA	NA
WP_104836606.1|2813354_2815970_-	sugar transporter	NA	NA	NA	NA	NA
WP_004244003.1|2815975_2816428_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004244004.1|2816890_2817439_+	NAD(P)H-dependent oxidoreductase	NA	A0A2P0ZL77	Lactobacillus_phage	35.1	2.2e-15
WP_004244005.1|2817944_2818154_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004244007.1|2818461_2818671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012368178.1|2819944_2820163_-	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	70.3	1.7e-19
WP_172767753.1|2820215_2821313_-	phage late control D family protein	NA	E5G6Q3	Salmonella_phage	56.5	1.9e-111
WP_104836608.1|2821312_2821777_-|tail	phage tail protein	tail	S4TUC3	Salmonella_phage	56.2	8.8e-42
WP_104836609.1|2821776_2824611_-|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	41.6	5.8e-112
WP_075204427.1|2824603_2824777_-|tail	GpE family phage tail protein	tail	A0A2I8TV82	Erwinia_phage	50.9	1.6e-09
WP_104836610.1|2824737_2825085_-|tail	phage tail assembly protein	tail	E5G6P9	Salmonella_phage	56.8	3.5e-19
WP_104836611.1|2825104_2825620_-|tail	phage major tail tube protein	tail	E5G6P8	Salmonella_phage	58.5	1.6e-55
WP_104836612.1|2825623_2826796_-|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	71.4	1.0e-166
WP_104836613.1|2826895_2828527_-|tail	phage tail protein	tail	A0A2I8TVA9	Erwinia_phage	72.4	1.8e-57
WP_104836614.1|2828516_2829128_-|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	69.4	3.2e-76
WP_104836615.1|2829120_2830029_-|plate	baseplate assembly protein	plate	A0A218M4K5	Erwinia_phage	66.6	1.3e-108
WP_104836616.1|2830030_2830369_-	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	49.5	1.4e-25
WP_104836617.1|2830365_2830992_-|plate	phage baseplate assembly protein V	plate	Q6K1H6	Salmonella_virus	59.8	9.0e-58
WP_104836618.1|2831057_2831693_-	phage virion morphogenesis protein	NA	A0A0M4RCU1	Salmonella_phage	35.8	1.5e-28
WP_104836619.1|2831682_2832120_-|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	48.6	1.2e-32
WP_087726277.1|2832094_2832598_-|lysis	lysis protein	lysis	M1FJ79	Enterobacteria_phage	30.1	1.4e-05
WP_087726278.1|2832594_2832999_-	M15 family metallopeptidase	NA	K4F776	Cronobacter_phage	57.4	4.6e-39
WP_012368194.1|2832991_2833306_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_104836620.1|2833325_2833532_-|tail	tail protein X	tail	K4PAW7	Burkholderia_phage	51.5	8.1e-16
WP_104836621.1|2833531_2833987_-|head	head completion/stabilization protein	head	E5E3S2	Burkholderia_phage	45.3	2.4e-28
WP_012368197.1|2834064_2834733_-|terminase	terminase	terminase	F1BUQ7	Erwinia_phage	46.6	7.2e-45
WP_102086891.1|2834732_2835878_-|capsid	phage major capsid protein, P2 family	capsid	A0A1S6KZZ3	Salmonella_phage	67.7	6.8e-128
WP_104836622.1|2835893_2836703_-|capsid	GPO family capsid scaffolding protein	capsid	F1BUR1	Erwinia_phage	48.8	3.4e-65
WP_104836623.1|2836875_2838630_+|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	73.2	2.3e-260
WP_104836624.1|2838629_2839658_+|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	67.5	4.0e-135
WP_087726286.1|2840137_2840533_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_104836625.1|2840603_2841284_-	hypothetical protein	NA	V9IQL5	Stenotrophomonas_phage	27.2	1.9e-16
WP_104836626.1|2841490_2843869_-	replication endonuclease	NA	Q7Y4B8	Escherichia_virus	47.3	1.1e-164
WP_104836627.1|2843868_2844192_-	DUF5405 family protein	NA	NA	NA	NA	NA
WP_104836628.1|2844191_2845019_-	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	F1BUN1	Cronobacter_phage	47.8	3.0e-61
WP_087726417.1|2845018_2845327_-	DUF3850 domain-containing protein	NA	A0A218M496	Shigella_phage	41.1	6.5e-09
WP_012368208.1|2845328_2845550_-	TraR/DksA family transcriptional regulator	NA	F1BUS2	Erwinia_phage	52.1	2.6e-12
WP_104836629.1|2845542_2845800_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_049220105.1|2845817_2846213_-	DUF5347 family protein	NA	NA	NA	NA	NA
2845978:2845993	attL	ATACGATTATTTTCAT	NA	NA	NA	NA
WP_036908537.1|2846262_2846538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_152964418.1|2846547_2846700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368212.1|2846696_2846894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012368213.1|2846899_2847175_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	47.0	3.7e-16
WP_012368214.1|2847277_2847577_+	helix-turn-helix transcriptional regulator	NA	Q1JS29	Enterobacteria_phage	70.7	4.8e-33
WP_087726416.1|2847643_2848627_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	56.2	8.2e-98
WP_004244024.1|2848795_2850310_-|tRNA	lysine--tRNA ligase	tRNA	A0A2K9L3L6	Tupanvirus	38.0	4.1e-88
WP_096043105.1|2850318_2851417_-	peptide chain release factor 2	NA	A0A0S4KWG0	Pseudomonas_phage	37.3	4.1e-05
WP_046334647.1|2851588_2853322_-	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.1	4.7e-64
2852586:2852601	attR	ATACGATTATTTTCAT	NA	NA	NA	NA
WP_046334648.1|2853331_2854039_-	bifunctional protein-disulfide isomerase/oxidoreductase DsbC	NA	NA	NA	NA	NA
WP_004244032.1|2854072_2855014_-	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	30.7	4.1e-30
WP_004244033.1|2855121_2855640_+	flavodoxin FldB	NA	NA	NA	NA	NA
WP_004244035.1|2855740_2856148_-	protein YgfX	NA	NA	NA	NA	NA
WP_026090407.1|2856455_2856731_-	FAD assembly factor SdhE	NA	NA	NA	NA	NA
WP_004248524.1|2856991_2857978_+|tRNA	tRNA-modifying protein YgfZ	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP053898	Proteus mirabilis strain YPM35 chromosome, complete genome	4161306	3033887	3085224	4161306	tail,head,plate,terminase,integrase,holin	Acinetobacter_phage(17.86%)	81	3036947:3037002	3084074:3084129
WP_046334688.1|3033887_3034514_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	31.6	1.7e-11
WP_172767757.1|3034704_3035361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836659.1|3035777_3036470_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
3036947:3037002	attL	TTGATTTTAAATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_172767758.1|3037176_3037407_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	97.4	1.3e-33
WP_172767759.1|3037407_3038028_-|tail	tail fiber assembly protein	tail	A0A0M4RTP2	Salmonella_phage	30.2	2.2e-16
WP_172767760.1|3038027_3039719_-|tail	tail fiber protein	tail	M1TAS6	Escherichia_phage	48.9	1.9e-25
WP_172767761.1|3039726_3040359_-	DUF2612 domain-containing protein	NA	K4HYS2	Acinetobacter_phage	49.0	3.3e-47
WP_172767762.1|3040358_3041549_-|plate	baseplate J/gp47 family protein	plate	E2GM17	Acinetobacter_phage	40.4	8.2e-76
WP_049206563.1|3041545_3041899_-	hypothetical protein	NA	I2GUF7	Acinetobacter_phage	52.1	9.4e-28
WP_172767763.1|3041900_3042593_-|plate	phage baseplate protein	plate	A0A2R3UAK1	Myoviridae_environmental_samples	42.0	1.5e-29
WP_172767764.1|3042573_3043464_-	hypothetical protein	NA	E2GM20	Acinetobacter_phage	41.4	6.8e-59
WP_156733210.1|3043450_3043726_-	hypothetical protein	NA	A0A1X9SFF3	Acinetobacter_phage	46.7	2.9e-16
WP_172767765.1|3043726_3044434_-	hypothetical protein	NA	A0A1V0DZ59	Acinetobacter_phage	55.0	4.8e-47
WP_161706779.1|3044509_3045334_-	DUF3800 domain-containing protein	NA	A5X9G9	Aeromonas_virus	43.8	3.8e-56
WP_172767766.1|3045687_3046683_-	DUF4431 domain-containing protein	NA	NA	NA	NA	NA
WP_161748304.1|3046679_3046895_-	hypothetical protein	NA	A0A1W6JPG4	Morganella_phage	69.7	4.1e-18
WP_172767767.1|3046963_3049357_-	hypothetical protein	NA	A0A1W6JPF2	Morganella_phage	47.6	1.2e-179
WP_172767768.1|3049610_3050021_-	hypothetical protein	NA	A0A068CGG2	Acinetobacter_phage	40.7	1.4e-19
WP_129037599.1|3050020_3050467_-	hypothetical protein	NA	A0A1V0DZ74	Acinetobacter_phage	51.0	9.7e-38
WP_172767769.1|3050479_3051937_-	DUF3383 domain-containing protein	NA	H9C0W5	Aeromonas_phage	34.3	1.3e-67
WP_156733202.1|3051948_3052434_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172767770.1|3052421_3052802_-	hypothetical protein	NA	K4I3A0	Acinetobacter_phage	42.6	2.6e-23
WP_161769605.1|3052788_3053247_-	hypothetical protein	NA	A0A077KC03	Edwardsiella_phage	57.6	2.7e-35
WP_161769604.1|3053239_3053644_-	DUF4054 domain-containing protein	NA	NA	NA	NA	NA
WP_172767771.1|3053646_3053973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172767772.1|3053974_3055000_-	hypothetical protein	NA	A0A077KC85	Edwardsiella_phage	37.5	3.1e-63
WP_172767773.1|3054999_3055488_-	hypothetical protein	NA	A0A077KAW3	Edwardsiella_phage	47.8	2.2e-35
WP_129037614.1|3055490_3056651_-	DUF2213 domain-containing protein	NA	A0A219YBB9	Aeromonas_phage	36.2	7.5e-58
WP_172767818.1|3056700_3057414_-|head	phage head morphogenesis protein	head	A0A2R3UAK2	Myoviridae_environmental_samples	40.8	3.9e-41
WP_172767774.1|3057472_3058891_-	DUF1073 domain-containing protein	NA	A0A077KC81	Edwardsiella_phage	37.8	6.8e-77
WP_172767775.1|3058887_3060231_-|terminase	PBSX family phage terminase large subunit	terminase	A0A191ZDJ9	Acinetobacter_phage	65.1	3.0e-167
WP_172767776.1|3060223_3060622_-|terminase	terminase small subunit	terminase	E5AGA2	Erwinia_phage	68.4	3.4e-34
WP_172767777.1|3060632_3060770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036935861.1|3060854_3061394_-	Rha family transcriptional regulator	NA	A0A088CBJ5	Shigella_phage	73.0	2.7e-74
WP_172767778.1|3061720_3061990_-	peptidase	NA	Q8SBD8	Shigella_phage	47.6	2.5e-12
WP_172767779.1|3061877_3062255_-	hypothetical protein	NA	A0A1W6JP00	Morganella_phage	30.8	2.4e-05
WP_036976899.1|3062256_3062589_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	70.3	4.4e-35
WP_004918415.1|3062575_3062869_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004916901.1|3062865_3063255_-	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_161728928.1|3063917_3064532_-	hypothetical protein	NA	A0A2H4JCH5	uncultured_Caudovirales_phage	48.1	2.8e-43
WP_172767780.1|3064528_3064729_-	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	50.0	3.3e-06
WP_161728930.1|3064718_3065084_-	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	64.1	1.0e-37
WP_063108505.1|3065080_3065371_-	DUF1364 domain-containing protein	NA	K7P6U2	Enterobacteria_phage	80.0	4.3e-39
WP_104731782.1|3065482_3066145_-	metallophosphoesterase	NA	A0A2D1GLI5	Escherichia_phage	60.0	4.1e-69
WP_172767781.1|3066141_3066285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172767782.1|3066277_3066508_-	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	75.4	2.8e-25
WP_163773687.1|3066513_3066957_-	recombination protein NinB	NA	A0A1W6JNZ4	Morganella_phage	62.4	4.4e-43
WP_063108501.1|3067124_3067334_-	hypothetical protein	NA	A0A1P8DTG8	Proteus_phage	90.3	5.0e-29
WP_049216821.1|3067326_3067581_-	Lar family restriction alleviation protein	NA	A0A1P8DTF4	Proteus_phage	98.8	1.2e-45
WP_049257594.1|3067791_3068040_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_063693402.1|3068026_3068248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172767783.1|3068247_3068415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172767784.1|3068434_3069811_-	replicative DNA helicase	NA	E5AGF0	Erwinia_phage	57.9	2.1e-155
WP_159262679.1|3069810_3070896_-	replication protein	NA	E5AGE9	Erwinia_phage	50.7	1.4e-82
WP_168725563.1|3070888_3071113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_168725711.1|3071161_3071497_-	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	96.3	2.0e-51
WP_036895075.1|3071632_3071818_-	hypothetical protein	NA	A4KWW0	Enterobacteria_phage	58.3	2.3e-09
WP_168725712.1|3071913_3072624_+	helix-turn-helix domain-containing protein	NA	A4KWV9	Enterobacteria_phage	62.1	3.3e-80
WP_036908283.1|3072658_3073438_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036908285.1|3073434_3073800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767785.1|3074190_3074460_+	hypothetical protein	NA	A0A1P8DTK1	Proteus_phage	71.4	2.4e-23
WP_049220845.1|3074474_3074711_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049220847.1|3074682_3074964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_112842868.1|3075130_3075721_+	DUF5420 family protein	NA	A0A2I7QRH1	Vibrio_phage	30.8	1.5e-14
WP_162557014.1|3075755_3075920_+	hypothetical protein	NA	A0A1W6JP47	Morganella_phage	59.3	6.1e-14
WP_161747556.1|3075984_3076926_+	cell envelope biogenesis protein TolA	NA	A0A2I7QK72	Vibrio_phage	46.6	2.3e-20
WP_017827449.1|3076943_3077204_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170110775.1|3077257_3077413_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767786.1|3077420_3077675_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049199148.1|3077671_3077893_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073718.1|3077889_3078816_+	recombinase RecT	NA	F1C5B8	Cronobacter_phage	66.6	1.2e-109
WP_172767685.1|3079499_3080057_+	single-stranded DNA-binding protein	NA	C6ZR36	Salmonella_phage	60.0	3.1e-57
WP_105881171.1|3080097_3080256_+	hook protein	NA	NA	NA	NA	NA
WP_099660651.1|3080365_3080659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158660332.1|3080658_3080817_+	hypothetical protein	NA	A0A1P8DTH4	Proteus_phage	79.5	1.1e-09
WP_172767787.1|3080971_3081337_+	DUF2528 family protein	NA	NA	NA	NA	NA
WP_172767788.1|3081340_3081658_+	DUF2591 family protein	NA	A0A1P8DTH6	Proteus_phage	43.0	8.2e-15
WP_134736555.1|3081654_3081882_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172767789.1|3081868_3082471_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	58.1	4.2e-60
WP_049206334.1|3082905_3084063_+|integrase	site-specific integrase	integrase	A0A0M4R586	Salmonella_phage	75.1	1.4e-176
WP_060554830.1|3084351_3085224_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	5.7e-34
3084074:3084129	attR	TTGATTTTAAATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
>prophage 12
NZ_CP053898	Proteus mirabilis strain YPM35 chromosome, complete genome	4161306	3348601	3357451	4161306		Caulobacter_phage(50.0%)	9	NA	NA
WP_046334925.1|3348601_3350170_-	chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_012368337.1|3350570_3351251_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|3351347_3351923_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_104836740.1|3351999_3352578_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	43.1	3.2e-33
WP_049196995.1|3352645_3353671_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.0e-74
WP_004245607.1|3353705_3354161_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_172767796.1|3354185_3355328_-	TerD family protein	NA	NA	NA	NA	NA
WP_004250201.1|3355328_3355913_-	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_017827550.1|3356305_3357451_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	1.2e-31
>prophage 13
NZ_CP053898	Proteus mirabilis strain YPM35 chromosome, complete genome	4161306	3879608	3923271	4161306	transposase	Enterobacteria_phage(18.18%)	43	NA	NA
WP_104836818.1|3879608_3880817_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	81.3	2.8e-188
WP_012368599.1|3880839_3881256_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	1.5e-45
WP_004249011.1|3882076_3882595_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_104836819.1|3882667_3884839_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004249009.1|3884838_3886062_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_049210069.1|3886058_3889277_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836821.1|3889273_3890200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836822.1|3890309_3891248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004249835.1|3891240_3891510_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_104836823.1|3891688_3892624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004249831.1|3892636_3892777_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836824.1|3892773_3893700_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836825.1|3893721_3894633_+	hypothetical protein	NA	NA	NA	NA	NA
WP_104836826.1|3894742_3895681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020946446.1|3895673_3895943_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_104836827.1|3896134_3897058_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017827148.1|3897147_3897825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335148.1|3897917_3899525_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046335149.1|3899538_3902034_-	CS1-pili formation C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004246670.1|3902056_3902740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246669.1|3902829_3903453_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_004246668.1|3903592_3903913_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_104836828.1|3904960_3905995_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	41.3	1.9e-65
WP_001274561.1|3906539_3907385_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_060589331.1|3907469_3907757_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761716.1|3907686_3908175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094437.1|3908171_3908549_-	toxin	NA	NA	NA	NA	NA
WP_001390338.1|3908595_3908973_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692345.1|3909135_3909357_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001535682.1|3909419_3909896_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855064.1|3909911_3910385_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	29.6	3.3e-12
WP_001535681.1|3910726_3911545_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	3.6e-46
WP_001323397.1|3911699_3911858_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_164076301.1|3912824_3914037_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.9e-168
WP_001387788.1|3915310_3915913_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072153745.1|3916007_3916286_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000148641.1|3917876_3918446_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271020.1|3918611_3918995_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032181455.1|3918991_3919417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080195.1|3919896_3921510_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624711.1|3921540_3921891_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.0e-39
WP_000981822.1|3921887_3922292_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	84.3	1.4e-30
WP_096043063.1|3922254_3923271_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	7.0e-185
>prophage 14
NZ_CP053898	Proteus mirabilis strain YPM35 chromosome, complete genome	4161306	3929885	3984521	4161306	transposase,integrase	Escherichia_phage(38.89%)	51	3936847:3936861	3984811:3984825
WP_000845048.1|3929885_3930899_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_001456218.1|3931065_3931908_+	alpha/beta fold putative hydrolase EstX	NA	W8EKH7	Mycobacterium_phage	26.1	3.0e-08
WP_000050382.1|3932003_3932612_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_001261740.1|3932669_3933461_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA2	NA	NA	NA	NA	NA
WP_000095725.1|3933722_3934982_+	chloramphenicol efflux MFS transporter CmlA1	NA	S4TR35	Salmonella_phage	31.7	4.8e-26
WP_001206316.1|3935074_3935866_+	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000800531.1|3936035_3936368_+	quaternary ammonium compound efflux SMR transporter QacL	NA	E5E3Y9	Acinetobacter_phage	35.3	2.0e-08
3936847:3936861	attL	CGCCAGTTTACCTCT	NA	NA	NA	NA
WP_109023896.1|3937269_3937545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000034420.1|3937547_3938339_-	sulfonamide-resistant dihydropteroate synthase Sul3	NA	NA	NA	NA	NA
WP_001354008.1|3938807_3939053_-	GrpB family protein	NA	NA	NA	NA	NA
WP_000612791.1|3939090_3939954_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_172767804.1|3940184_3940889_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_000376616.1|3941113_3941317_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000679427.1|3942276_3942624_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_001749986.1|3942846_3943299_-	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000186237.1|3943383_3944016_-	type B-3 chloramphenicol O-acetyltransferase CatB3	NA	A0A2R8FE91	Brazilian_cedratvirus	41.2	4.1e-26
WP_001334766.1|3944153_3944984_-	oxacillin-hydrolyzing class D beta-lactamase OXA-1	NA	NA	NA	NA	NA
WP_063840321.1|3945114_3945669_-	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001067855.1|3945812_3946517_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|3947101_3947962_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_172767805.1|3948559_3949264_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	99.6	9.0e-139
WP_046788546.1|3951974_3952376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001067784.1|3952455_3953160_-|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_001447541.1|3954084_3954969_+	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_000214122.1|3955185_3956400_+	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001255015.1|3956427_3956733_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001120888.1|3956844_3958338_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001445143.1|3958368_3958620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000251875.1|3958513_3958816_-	phosphoglucosamine mutase	NA	NA	NA	NA	NA
WP_001043260.1|3958902_3959718_-	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_085940648.1|3959807_3960897_+|transposase	IS4 family transposase ISAba1	transposase	NA	NA	NA	NA
WP_170628443.1|3961094_3961454_-	phenol hydroxylase	NA	NA	NA	NA	NA
WP_000602738.1|3963390_3964143_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_000742814.1|3964564_3965590_-	aminoglycoside O-phosphotransferase APH(4)-Ia	NA	NA	NA	NA	NA
WP_001067855.1|3966707_3967412_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|3968167_3969019_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|3969326_3970142_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_001082319.1|3970202_3971006_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	Q75ZG1	Hepacivirus	34.3	4.9e-24
WP_000480968.1|3971005_3971842_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_001067855.1|3971902_3972607_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001300294.1|3973996_3974665_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|3974700_3974937_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_049217963.1|3974933_3975170_-	mercuric resistance transcriptional repressor protein MerD	NA	NA	NA	NA	NA
WP_000105636.1|3975187_3976882_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|3976933_3977356_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|3977391_3977667_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|3977680_3978031_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|3978102_3978537_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_169774393.1|3980505_3981309_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	38.6	4.4e-33
WP_119563495.1|3981538_3982492_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001218908.1|3983336_3984521_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	3.4e-162
3984811:3984825	attR	AGAGGTAAACTGGCG	NA	NA	NA	NA
>prophage 1
NZ_CP053899	Proteus mirabilis strain YPM35 plasmid pJPM35-1, complete sequence	135623	1655	44704	135623	integrase,transposase	Escherichia_phage(46.67%)	36	36893:36906	48270:48283
WP_172767592.1|1655_2411_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.7	2.4e-41
WP_172767591.1|2358_2601_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015344975.1|2631_4125_-|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_001255015.1|4236_4542_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000214122.1|4569_5784_-	chloramphenicol/florfenicol efflux MFS transporter FloR	NA	S4TR35	Salmonella_phage	28.7	1.2e-18
WP_001447541.1|6006_6891_-	DUF3363 domain-containing protein	NA	NA	NA	NA	NA
WP_001067784.1|7815_8520_+|transposase	IS6-like element IS1006 family transposase	transposase	A0A077SL39	Escherichia_phage	85.8	1.9e-120
WP_046788546.1|8604_9006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000147567.1|11941_12502_-	recombinase family protein	NA	A0A1B0V7I5	Salmonella_phage	86.2	4.0e-49
WP_000454193.1|12627_12978_-	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_000845054.1|13179_14193_-|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	6.1e-72
WP_063840321.1|14484_15039_+	fluoroquinolone-acetylating aminoglycoside 6'-N-acetyltransferase AAC(6')-Ib-cr5	NA	NA	NA	NA	NA
WP_001749986.1|15135_15588_+	NAD(+)--rifampin ADP-ribosyltransferase Arr-3	NA	NA	NA	NA	NA
WP_000679427.1|15810_16158_+	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000050481.1|17394_18936_+|transposase	IS91 family transposase	transposase	NA	NA	NA	NA
WP_004236386.1|19748_20888_-	class C beta-lactamase DHA-1	NA	NA	NA	NA	NA
WP_004193231.1|20998_21874_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_025999322.1|21877_22243_-	hydrogenase maturation nickel metallochaperone HypA	NA	NA	NA	NA	NA
WP_052238321.1|22135_22471_+	ethidium bromide resistance protein	NA	NA	NA	NA	NA
WP_000376623.1|23430_23931_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000983249.1|24465_25251_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.0	3.3e-33
WP_001324342.1|25237_26761_-|transposase	IS21-like element IS1326 family transposase	transposase	A0A2L1IVA1	Escherichia_phage	24.2	1.2e-15
WP_000287615.1|26883_28428_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	34.6	1.0e-38
WP_000344784.1|28478_29339_-	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_001067855.1|29829_30534_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|30684_31500_+	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|31689_32394_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_140173007.1|32429_32741_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000155092.1|32930_33815_-	Mph(E) family macrolide 2'-phosphotransferase	NA	NA	NA	NA	NA
WP_000052512.1|33870_35346_-	ABC-F type ribosomal protection protein Msr(E)	NA	A0A1B0RXA0	Streptococcus_phage	59.0	2.3e-160
WP_001067855.1|35795_36500_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_071538080.1|36524_38099_+	PAS domain-containing methyl-accepting chemotaxis protein	NA	A0A1B0V854	Salmonella_phage	99.4	2.8e-87
36893:36906	attL	GGCTGCGGAAAAAT	NA	NA	NA	NA
WP_001276994.1|38901_40569_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_000267723.1|40565_42674_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001029679.1|42660_43482_-	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_048821757.1|43750_44704_-|integrase	site-specific integrase	integrase	A0A1P8DJ76	Virus_Rctr85	29.2	9.6e-27
48270:48283	attR	ATTTTTCCGCAGCC	NA	NA	NA	NA
