The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053922	Pseudomonas aeruginosa strain YD001 chromosome, complete genome	6496756	653930	706696	6496756	plate,tail,tRNA	Pseudomonas_phage(24.0%)	55	NA	NA
WP_009875776.1|653930_654956_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.1	8.3e-109
WP_003085061.1|655034_655604_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|655687_656041_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003099585.1|656031_656574_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_003099584.1|656546_657779_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_023088786.1|657822_658329_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|658422_659976_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|659972_661244_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_003085078.1|661344_663267_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|663545_663878_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003099572.1|663921_664773_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2R4ALP3	Aeromonas_phage	44.2	2.4e-08
WP_003085085.1|664772_665153_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003099569.1|665189_665996_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003099567.1|666111_667098_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|667094_668387_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_003099560.1|668367_671139_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003099554.1|671265_672282_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003099549.1|672278_672953_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003099547.1|672954_673713_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_003099546.1|673713_674775_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_003099544.1|674926_677320_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|677365_677998_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|678126_679161_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|679394_680504_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003099539.1|680559_681606_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003109044.1|681720_682968_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003099535.1|683073_683904_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|684027_684702_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003142792.1|684701_685520_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_003085126.1|685592_687071_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003121843.1|687388_687703_-	pyocin activator PrtN family protein	NA	NA	NA	NA	NA
WP_003113202.1|687802_688573_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_003085132.1|689030_689231_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_023088787.1|689278_689638_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118908.1|690000_690450_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003101620.1|690471_690987_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	43.4	1.8e-32
WP_003085141.1|690983_691541_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	71.1	4.6e-45
WP_003085143.1|691693_692020_+	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003085151.1|692016_692904_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	5.3e-88
WP_003137385.1|692896_693430_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	5.2e-62
WP_023088788.1|693431_695540_+|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	51.9	9.4e-224
WP_003085172.1|695548_695989_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_003109051.1|696031_697192_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	2.7e-188
WP_003085175.1|697204_697708_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|697722_698067_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_003101633.1|698236_700474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003085182.1|700483_701356_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003101635.1|701330_701537_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_003101637.1|701594_702584_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	55.8	2.2e-106
WP_003085188.1|702616_703246_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.5	3.2e-87
WP_003101639.1|703242_703605_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	1.9e-15
WP_003118919.1|703601_703859_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003101640.1|704206_704812_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	65.8	6.0e-75
WP_003085203.1|704813_705863_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|705859_706696_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 2
NZ_CP053922	Pseudomonas aeruginosa strain YD001 chromosome, complete genome	6496756	1442640	1507540	6496756	portal,lysis,holin,integrase,tRNA,terminase,protease	Pseudomonas_phage(71.64%)	82	1462063:1462085	1504539:1504561
WP_003122145.1|1442640_1443969_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	M1IB95	Acanthocystis_turfacea_Chlorella_virus	24.1	1.0e-05
WP_003092366.1|1444139_1445768_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	53.1	4.0e-158
WP_003092365.1|1445770_1446616_+	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	40.3	1.4e-48
WP_003092364.1|1446661_1447951_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	61.5	2.5e-139
WP_003098569.1|1448015_1448300_+	cell division protein FtsB	NA	NA	NA	NA	NA
WP_003122146.1|1448319_1449024_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
WP_003092358.1|1449084_1449333_-	sulfurtransferase-like selenium metabolism protein YedF	NA	NA	NA	NA	NA
WP_003098565.1|1449298_1450525_-	selenium metabolism membrane protein YedE/FdhT	NA	NA	NA	NA	NA
WP_003113868.1|1450600_1451509_-	glutathione-dependent formaldehyde neutralization regulator	NA	NA	NA	NA	NA
WP_003092351.1|1451640_1452753_+	S-(hydroxymethyl)glutathione dehydrogenase/class III alcohol dehydrogenase	NA	E3SJ82	Synechococcus_phage	29.1	1.3e-35
WP_003113869.1|1452806_1453658_+	S-formylglutathione hydrolase	NA	NA	NA	NA	NA
WP_003098560.1|1453728_1454202_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_023088112.1|1454198_1455266_+|tRNA	tRNA pseudouridine(13) synthase TruD	tRNA	NA	NA	NA	NA
WP_003092341.1|1455253_1456003_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	53.0	6.8e-68
WP_003098558.1|1456035_1456671_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_003115226.1|1456716_1457610_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1457714_1458719_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003092272.1|1459145_1459469_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_003105609.1|1459535_1462115_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
1462063:1462085	attL	TACTGCTGCATCATTGGCGTGTG	NA	NA	NA	NA
WP_077563222.1|1462174_1463149_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4J8E5	uncultured_Caudovirales_phage	57.6	4.9e-103
WP_071538228.1|1463158_1463368_-	DUF4224 domain-containing protein	NA	A0A1B0VMB6	Pseudomonas_phage	57.8	2.9e-13
WP_096861746.1|1463585_1463876_-	hypothetical protein	NA	A0A1B0Z2L6	Pseudomonas_phage	97.9	1.5e-47
WP_041025216.1|1463948_1464332_-	HNH endonuclease	NA	A0A0U4IIE4	Pseudomonas_phage	98.8	2.2e-46
WP_129754580.1|1465569_1466700_-	hypothetical protein	NA	A0A0A1IWF8	Pseudomonas_phage	42.2	4.9e-46
WP_003140732.1|1466696_1466903_-	hypothetical protein	NA	H2BDF2	Pseudomonas_virus	84.1	1.3e-26
WP_129754579.1|1466866_1467115_-	hypothetical protein	NA	A0A0U4J8Y4	Pseudomonas_phage	92.7	8.5e-36
WP_172792794.1|1467126_1468173_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	59.9	2.9e-117
WP_073652347.1|1468726_1469104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172792795.1|1469170_1469473_-	hypothetical protein	NA	A0A1B0YZY4	Pseudomonas_phage	96.0	5.3e-40
WP_172792796.1|1469472_1470144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_105753167.1|1470357_1470606_-	hypothetical protein	NA	A0A1B0YZY1	Pseudomonas_phage	90.2	3.2e-35
WP_033950050.1|1470616_1471000_-	LuxR family transcriptional regulator	NA	A0A0U4IIG4	Pseudomonas_phage	96.1	6.3e-62
WP_172792797.1|1471317_1472235_-	hypothetical protein	NA	A0A1B0YZX8	Pseudomonas_phage	47.2	1.7e-60
WP_016263613.1|1472475_1472685_-	hypothetical protein	NA	L7TIA6	Pseudomonas_virus	100.0	3.8e-29
WP_057391413.1|1472724_1473510_-	hypothetical protein	NA	A0A1B0YZY3	Pseudomonas_phage	98.9	2.7e-144
WP_172792798.1|1474012_1474267_+	DUF1654 domain-containing protein	NA	A0A127KNY9	Pseudomonas_phage	70.7	1.7e-26
WP_023117102.1|1474299_1474536_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_172792799.1|1475136_1475892_-	helix-turn-helix transcriptional regulator	NA	L7TH81	Pseudomonas_virus	71.1	2.9e-74
WP_172792800.1|1476403_1477105_+	phage antirepressor KilAC domain-containing protein	NA	A0A1B0YZY9	Pseudomonas_phage	97.0	4.5e-122
WP_172792801.1|1477169_1477931_+	helix-turn-helix domain-containing protein	NA	A0A1B0YZZ0	Pseudomonas_phage	95.6	1.9e-89
WP_033991849.1|1477927_1478611_+	hypothetical protein	NA	A0A1B0YZY6	Pseudomonas_phage	99.1	1.4e-125
WP_003159465.1|1478607_1478814_+	hypothetical protein	NA	A0A1B0YZY8	Pseudomonas_phage	94.1	3.1e-31
WP_031630618.1|1478810_1479182_+	recombinase	NA	NA	NA	NA	NA
WP_172792802.1|1479178_1479526_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0H5AUD2	Pseudomonas_phage	55.3	2.4e-28
WP_172792803.1|1479522_1479822_+	hypothetical protein	NA	A0A1B0YZZ2	Pseudomonas_phage	92.8	3.8e-46
WP_121335454.1|1479823_1480198_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003124172.1|1480348_1480777_-	hypothetical protein	NA	Q7Y3V7	Yersinia_phage	50.4	1.0e-28
WP_033971890.1|1480823_1481006_-	type II toxin-antitoxin system HicA family toxin	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	55.0	4.2e-08
WP_015649339.1|1481206_1481521_+|holin	phage holin, lambda family	holin	A0A0A0YUH2	Pseudomonas_phage	100.0	5.7e-53
WP_172792804.1|1481520_1482138_+	glycoside hydrolase family 19 protein	NA	A0A0U4JP23	Pseudomonas_phage	95.1	7.7e-110
WP_172792805.1|1482137_1482608_+|lysis	lysis protein	lysis	A0A1B0Z001	Pseudomonas_phage	91.0	6.5e-69
WP_003159066.1|1482604_1483348_+	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	99.6	6.4e-135
WP_023083814.1|1483467_1484013_+|terminase	terminase small subunit	terminase	A0A1B0Z033	Pseudomonas_phage	86.7	3.4e-85
WP_034059294.1|1483984_1485961_+|terminase	phage terminase large subunit family protein	terminase	A0A1B0Z2K0	Pseudomonas_phage	86.2	0.0e+00
WP_034014260.1|1485957_1486176_+	hypothetical protein	NA	S5MBY8	Escherichia_phage	48.6	5.4e-10
WP_031640291.1|1486172_1487819_+|portal	phage portal protein	portal	A0A0A0YUB7	Pseudomonas_phage	67.9	3.1e-214
WP_172792806.1|1487793_1489884_+|protease	Clp protease ClpP	protease	A0A1W6JT88	Pseudomonas_phage	74.4	8.0e-276
WP_012613583.1|1489950_1490268_+	DUF2190 family protein	NA	A0A1W6JT93	Pseudomonas_phage	93.3	1.4e-46
WP_172792807.1|1490264_1490594_+	hypothetical protein	NA	A0A1W6JT71	Pseudomonas_phage	98.2	1.5e-56
WP_034014263.1|1490590_1491061_+	hypothetical protein	NA	A0A1W6JT75	Pseudomonas_phage	98.1	1.0e-85
WP_015980908.1|1491064_1491259_+	hypothetical protein	NA	A0A1W6JT79	Pseudomonas_phage	98.4	1.5e-27
WP_015980909.1|1491260_1492013_+	hypothetical protein	NA	A0A1B0YZT8	Pseudomonas_phage	99.6	2.4e-137
WP_049950365.1|1492094_1492616_+	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	A0A1B0YZT9	Pseudomonas_phage	100.0	4.7e-92
WP_172792808.1|1492687_1493215_+	DUF4124 domain-containing protein	NA	A0A1B0Z2K9	Pseudomonas_phage	98.9	5.6e-93
WP_033946351.1|1493277_1493580_+	hypothetical protein	NA	A0A1W6JT80	Pseudomonas_phage	97.0	5.9e-47
WP_172792809.1|1493682_1496166_+	tape measure protein	NA	A0A1B0YZV6	Pseudomonas_phage	99.2	0.0e+00
WP_023114587.1|1496205_1496727_+	hypothetical protein	NA	A0A1W6JT98	Pseudomonas_phage	99.4	4.4e-98
WP_172792810.1|1496726_1498424_+	hypothetical protein	NA	A0A1W6JTA3	Pseudomonas_phage	98.1	0.0e+00
WP_058165590.1|1498426_1498837_+	hypothetical protein	NA	A0A1B0YZV0	Pseudomonas_phage	97.1	2.9e-65
WP_128663785.1|1498836_1499382_+	hypothetical protein	NA	A0A1B0YZV4	Pseudomonas_phage	98.3	1.4e-99
WP_043106299.1|1499392_1499815_+	hypothetical protein	NA	A0A1W6JT91	Pseudomonas_phage	97.1	1.5e-69
WP_172792811.1|1499801_1501301_+	hypothetical protein	NA	A0A1W6JT90	Pseudomonas_phage	96.9	2.6e-260
WP_058165587.1|1501323_1501911_+	hypothetical protein	NA	A0A0U4B0K9	Pseudomonas_phage	95.9	6.0e-104
WP_058139559.1|1501903_1502095_+	hypothetical protein	NA	A0A1B0Z2L3	Pseudomonas_phage	96.8	3.5e-29
WP_058019610.1|1502099_1502660_+	hypothetical protein	NA	A0A0U4JIY3	Pseudomonas_phage	100.0	2.9e-100
WP_058139561.1|1502660_1502942_+	hypothetical protein	NA	A0A0A0YR51	Pseudomonas_phage	93.5	8.2e-43
WP_034011739.1|1503497_1503800_+	hypothetical protein	NA	A0A0S2SY61	Pseudomonas_phage	88.0	1.4e-43
WP_043106291.1|1503796_1504036_+	hypothetical protein	NA	A0A1B0YZV9	Pseudomonas_phage	91.1	5.9e-34
WP_023109386.1|1504064_1504337_+	hypothetical protein	NA	A0A0U4JEI3	Pseudomonas_phage	97.8	4.5e-46
WP_003098486.1|1504704_1505712_-	TolB family protein	NA	NA	NA	NA	NA
1504539:1504561	attR	TACTGCTGCATCATTGGCGTGTG	NA	NA	NA	NA
WP_003143267.1|1505859_1506366_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	2.8e-57
WP_003092260.1|1506499_1507540_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 3
NZ_CP053922	Pseudomonas aeruginosa strain YD001 chromosome, complete genome	6496756	2646762	2665845	6496756	transposase,tRNA	Pseudomonas_phage(46.67%)	25	NA	NA
WP_003097631.1|2646762_2648043_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_003113366.1|2648044_2649442_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
WP_003097628.1|2649446_2650421_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003097625.1|2650508_2651492_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	3.5e-141
WP_003090393.1|2651488_2651824_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	3.3e-38
WP_003116720.1|2651820_2652126_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2652125_2652485_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|2652481_2652877_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|2652987_2653656_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
WP_172792840.1|2654669_2655831_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	52.7	3.6e-84
WP_031300117.1|2656348_2656798_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_071557658.1|2656994_2657420_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_071536349.1|2657556_2657916_-	DUF4440 domain-containing protein	NA	NA	NA	NA	NA
WP_166737419.1|2658285_2658606_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031754259.1|2658633_2659284_-	hypothetical protein	NA	A0A0U4J8W4	Pseudomonas_phage	97.7	3.5e-121
WP_023088260.1|2659417_2659990_-	S24 family peptidase	NA	H2BD63	Pseudomonas_phage	91.7	1.9e-86
WP_073671462.1|2660367_2660586_+	helix-turn-helix domain-containing protein	NA	A0A2D1GND2	Pseudomonas_phage	63.2	1.1e-18
WP_023088261.1|2660617_2661190_+	hypothetical protein	NA	H2BD67	Pseudomonas_phage	98.9	6.0e-101
WP_023088263.1|2662916_2663546_+	glycoside hydrolase family 19 protein	NA	J7I4M6	Pseudomonas_phage	94.3	3.0e-109
WP_153549355.1|2663584_2663782_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003130908.1|2663907_2664171_+	hypothetical protein	NA	B5WZU5	Pseudomonas_phage	88.5	4.5e-35
WP_003160542.1|2664206_2664470_+	hypothetical protein	NA	Q9MC87	Pseudomonas_phage	94.3	9.0e-44
WP_021263881.1|2664574_2665063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004354886.1|2665059_2665305_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023088265.1|2665329_2665845_-	hypothetical protein	NA	L7TIE6	Pseudomonas_virus	88.2	1.7e-86
>prophage 4
NZ_CP053922	Pseudomonas aeruginosa strain YD001 chromosome, complete genome	6496756	2981663	3020144	6496756	plate,tail	Planktothrix_phage(33.33%)	32	NA	NA
WP_023084238.1|2981663_2982941_-|tail	pyoverdine-tailoring periplasmic protein PvdN	tail	NA	NA	NA	NA
WP_012614138.1|2982952_2984311_-|tail	pyoverdine-tailoring dipeptidase-like protein PvdM	tail	NA	NA	NA	NA
WP_031633213.1|2984525_2986163_+	pyoverdine maturation tyrosinase PvdP	NA	NA	NA	NA	NA
WP_003120134.1|2986211_2987636_-	pyoverdine export/recycling transporter outer membrane subunit OmpQ	NA	NA	NA	NA	NA
WP_003139295.1|2987641_2989633_-	pyoverdine export/recycling transporter ATP-binding/permease subunit PvdT	NA	G9BWD6	Planktothrix_phage	41.9	1.2e-34
WP_003089547.1|2989632_2990808_-	pyoverdine export/recycling transporter periplasmic adaptor subunit PvdR	NA	NA	NA	NA	NA
WP_003120136.1|2990908_2991904_-	FecR family protein	NA	NA	NA	NA	NA
WP_003103620.1|2992067_2992547_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_003114509.1|2992679_2994011_+	lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein	NA	NA	NA	NA	NA
WP_023088794.1|2994133_2996422_+	acylase	NA	NA	NA	NA	NA
WP_003114511.1|2996967_2997888_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_023088795.1|2997984_2999136_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003089526.1|2999217_2999460_-	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_003089523.1|2999754_2999997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003089521.1|3000262_3000733_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_003116948.1|3000729_3003045_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_003115787.1|3003461_3004667_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_023088796.1|3004867_3005509_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003089513.1|3005785_3006181_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_003104933.1|3006203_3006740_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_023088797.1|3006750_3008757_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.5	1.3e-41
WP_003104930.1|3008756_3008945_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003122693.1|3009104_3009677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003114516.1|3009698_3012248_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.4	1.2e-76
WP_003114517.1|3012249_3013266_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_003114518.1|3013229_3015023_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_003122696.1|3015006_3015432_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003089495.1|3015444_3015942_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003089494.1|3016015_3017500_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_003089493.1|3017522_3018068_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_019371765.1|3018276_3018753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023088798.1|3018812_3020144_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 5
NZ_CP053922	Pseudomonas aeruginosa strain YD001 chromosome, complete genome	6496756	3520109	3567770	6496756	portal,tail,integrase,terminase,head,capsid	Pseudomonas_phage(69.35%)	74	3559524:3559540	3572130:3572146
WP_172792849.1|3520109_3522845_-	hypothetical protein	NA	H2BDC9	Pseudomonas_virus	84.3	0.0e+00
WP_172792850.1|3523228_3523717_-	DUF1833 family protein	NA	B5WZT6	Pseudomonas_phage	98.1	2.9e-88
WP_015994282.1|3523713_3524178_-	hypothetical protein	NA	B5WZT5	Pseudomonas_phage	100.0	1.9e-89
WP_172792851.1|3524174_3526703_-|tail	phage tail tape measure protein	tail	A0A0U4JEA4	Pseudomonas_phage	87.8	0.0e+00
WP_172792852.1|3527029_3527389_-|tail	phage tail assembly chaperone family protein, TAC	tail	Q9MCA4	Pseudomonas_phage	99.2	1.0e-58
WP_126438315.1|3527398_3527920_-|tail	phage tail protein	tail	H2BDC0	Pseudomonas_virus	96.5	1.5e-93
WP_172792853.1|3527995_3528361_-	DUF3168 domain-containing protein	NA	A0A1J0GUW9	Halomonas_phage	65.3	3.8e-40
WP_155688080.1|3528553_3529096_-	HK97 gp10 family phage protein	NA	K7PM60	Enterobacteria_phage	60.7	6.4e-44
WP_172792854.1|3529088_3529703_-	methyltransferase domain-containing protein	NA	B5WZS8	Pseudomonas_phage	84.8	3.9e-106
WP_015648614.1|3529699_3529885_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172792901.1|3529881_3530700_-	hypothetical protein	NA	B5WZS7	Pseudomonas_phage	96.6	1.1e-156
WP_172792855.1|3530696_3531266_-	hypothetical protein	NA	B5WZS6	Pseudomonas_phage	96.8	1.7e-108
WP_034020450.1|3531265_3531601_-|head	phage head closure protein	head	B5WZS5	Pseudomonas_phage	98.2	2.4e-57
WP_126633585.1|3531616_3531991_-|head,tail	phage gp6-like head-tail connector protein	head,tail	B5WZS4	Pseudomonas_phage	98.4	1.9e-63
WP_172792856.1|3531987_3532983_-	hypothetical protein	NA	B5WZS3	Pseudomonas_phage	90.1	9.2e-121
WP_172792857.1|3532979_3534383_-|portal	phage portal protein	portal	B5WZS2	Pseudomonas_phage	90.6	1.7e-242
WP_015994268.1|3534375_3534594_-	hypothetical protein	NA	NA	NA	NA	NA
WP_126633588.1|3534602_3534836_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172792858.1|3534880_3536884_-|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	47.4	2.4e-152
WP_172792902.1|3537037_3538612_-|terminase	terminase large subunit	terminase	A0A0N7KZG0	Stx2-converting_phage	69.9	5.4e-216
WP_126633590.1|3538700_3539141_-	hypothetical protein	NA	S4TNN3	Salmonella_phage	37.1	4.3e-14
WP_172792903.1|3539908_3540217_-	HNH endonuclease	NA	B5WZZ4	Pseudomonas_phage	70.4	2.0e-34
WP_172792859.1|3540255_3540426_-	hypothetical protein	NA	B5WZZ3	Pseudomonas_phage	89.3	7.2e-18
WP_172792860.1|3540582_3540936_-	hypothetical protein	NA	B5WZZ2	Pseudomonas_phage	91.5	7.1e-52
WP_172792861.1|3540928_3541105_-	hypothetical protein	NA	W6MVP1	Pseudomonas_phage	91.4	6.3e-25
WP_034020399.1|3541104_3541539_-	lysozyme	NA	A0A0S2SYD0	Pseudomonas_phage	50.0	1.0e-31
WP_015994332.1|3541535_3541928_-	hypothetical protein	NA	B5WZY9	Pseudomonas_phage	100.0	6.7e-67
WP_172792862.1|3542123_3542696_-	hypothetical protein	NA	H2BDI9	Pseudomonas_virus	36.4	6.4e-26
WP_172792863.1|3542692_3543706_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172792864.1|3543705_3543963_-	DUF3310 domain-containing protein	NA	Q774Z7	Bordetella_phage	77.8	2.5e-22
WP_126860170.1|3543962_3544346_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172792865.1|3544342_3544549_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088172874.1|3544545_3544773_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172792866.1|3544769_3544955_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172792867.1|3544951_3545182_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172792868.1|3545178_3545481_-	hypothetical protein	NA	A0A0H5ARP9	Pseudomonas_phage	69.0	9.8e-34
WP_172792869.1|3545477_3545786_-	hypothetical protein	NA	Q9MC48	Pseudomonas_phage	98.0	4.3e-53
WP_172792870.1|3545782_3546199_-	recombination protein NinB	NA	B5WZY4	Pseudomonas_phage	98.6	4.1e-75
WP_033942800.1|3546191_3546407_-	hypothetical protein	NA	A0A125RNK4	Pseudomonas_phage	94.4	9.0e-34
WP_172792871.1|3546519_3546672_-	hypothetical protein	NA	B5WZY1	Pseudomonas_phage	92.0	2.9e-18
WP_073657050.1|3546664_3547471_-	ATP-binding protein	NA	A0A2H4J3E5	uncultured_Caudovirales_phage	52.1	2.0e-73
WP_172792872.1|3547460_3548261_-	phage replication protein	NA	A0A2H4J580	uncultured_Caudovirales_phage	49.3	1.3e-64
WP_033990280.1|3548336_3548540_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023125075.1|3548559_3548760_-	hypothetical protein	NA	A0A2H4J528	uncultured_Caudovirales_phage	64.6	1.1e-14
WP_044264005.1|3548773_3548953_-	Cro/Cl family transcriptional regulator	NA	A0A0S2SYB8	Pseudomonas_phage	66.1	3.9e-14
WP_053092377.1|3549053_3549764_+	LexA family transcriptional regulator	NA	Q6J1N3	Burkholderia_virus	38.8	5.7e-32
WP_003159008.1|3550348_3550555_+	hypothetical protein	NA	A0A0U4ISE6	Pseudomonas_phage	100.0	1.5e-33
WP_128549802.1|3550793_3551057_+	hypothetical protein	NA	A0A125RNS4	Pseudomonas_phage	94.3	1.3e-42
WP_172792873.1|3551671_3552163_+	hypothetical protein	NA	H2BDH2	Pseudomonas_virus	83.9	5.6e-71
WP_071536911.1|3552261_3552474_+	DUF551 domain-containing protein	NA	W6MW45	Pseudomonas_phage	98.5	1.5e-36
WP_172792874.1|3552490_3552745_+	hypothetical protein	NA	A0A0S2SY55	Pseudomonas_phage	45.8	3.7e-10
WP_003140713.1|3552787_3553165_+	hypothetical protein	NA	W6MWX7	Pseudomonas_phage	97.6	1.2e-65
WP_124083087.1|3553370_3553601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172792875.1|3553597_3553963_+	hypothetical protein	NA	W6MYA8	Pseudomonas_phage	97.5	2.0e-65
WP_172792773.1|3553959_3554463_+	hypothetical protein	NA	A0A0S2SY59	Pseudomonas_phage	66.7	9.9e-23
WP_073668182.1|3554582_3555260_+	DNA cytosine methyltransferase	NA	A0A0H5AU88	Pseudomonas_phage	72.0	1.1e-90
WP_172792876.1|3555269_3555413_+	hypothetical protein	NA	A0A0S2SY24	Pseudomonas_phage	91.3	6.2e-15
WP_172792877.1|3555923_3556670_+	hypothetical protein	NA	H2BDF8	Pseudomonas_virus	99.2	9.6e-131
WP_003124818.1|3556666_3557164_+	siphovirus Gp157 family protein	NA	H2BDF7	Pseudomonas_virus	100.0	6.4e-83
WP_023980859.1|3557174_3557621_+	single-stranded DNA-binding protein	NA	W6MWX5	Pseudomonas_phage	94.6	5.3e-68
WP_023980860.1|3557684_3558284_+	hypothetical protein	NA	W6MVF6	Pseudomonas_phage	98.5	2.6e-110
WP_172792878.1|3558679_3560341_+	hypothetical protein	NA	A0A0S2SY72	Pseudomonas_phage	40.5	8.2e-74
3559524:3559540	attL	CCGAGCGCGACGCTGCC	NA	NA	NA	NA
WP_003097974.1|3560340_3560841_+	class I SAM-dependent methyltransferase	NA	A0A0N7IRF6	Acinetobacter_phage	61.3	4.4e-55
WP_025297378.1|3560837_3561104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172792774.1|3561100_3561676_+	hypothetical protein	NA	A0A1B0YZW8	Pseudomonas_phage	57.9	9.6e-22
WP_172792879.1|3561668_3562001_+	Lar family restriction alleviation protein	NA	A0A0U3TGW4	Pseudomonas_phage	71.6	6.1e-37
WP_172792775.1|3561981_3562287_+	hypothetical protein	NA	H2BDE9	Pseudomonas_virus	94.6	4.6e-23
WP_172792880.1|3562370_3562517_+	hypothetical protein	NA	J7I4M1	Pseudomonas_phage	95.7	6.1e-18
WP_126123908.1|3562501_3562714_+	hypothetical protein	NA	A0A0A1IWD5	Pseudomonas_phage	61.1	1.6e-14
WP_172792776.1|3562716_3563016_+	hypothetical protein	NA	K4RI24	Pseudomonas_phage	63.0	2.0e-23
WP_023114236.1|3563762_3564131_+	hypothetical protein	NA	J7HXK7	Pseudomonas_phage	43.7	3.0e-13
WP_172792881.1|3564282_3564654_+	DUF2591 family protein	NA	J7I4M3	Pseudomonas_phage	42.7	1.1e-18
WP_172792882.1|3564932_3566150_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U4B0G7	Pseudomonas_phage	99.5	2.5e-229
WP_003111315.1|3566180_3567770_+	ABC-F family ATPase	NA	A0A2K9L0W2	Tupanvirus	28.3	5.9e-61
3572130:3572146	attR	GGCAGCGTCGCGCTCGG	NA	NA	NA	NA
>prophage 6
NZ_CP053922	Pseudomonas aeruginosa strain YD001 chromosome, complete genome	6496756	4870027	4961730	6496756	portal,tail,holin,integrase,capsid,head,plate,tRNA,terminase,protease	uncultured_Caudovirales_phage(38.3%)	107	4917772:4917798	4969201:4969227
WP_003116502.1|4870027_4870432_+|protease	protease inhibitor I42 family protein	protease	NA	NA	NA	NA
WP_003114186.1|4870530_4871283_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085577.1|4871414_4871987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003123029.1|4872091_4872832_+	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	A0A1B0XTP2	Freshwater_phage	26.4	6.4e-10
WP_003085573.1|4872828_4873797_+|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_003101974.1|4873887_4874634_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_003101972.1|4874626_4875328_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_003085566.1|4875388_4876306_-	GTPase Era	NA	NA	NA	NA	NA
WP_003085565.1|4876298_4876988_-	ribonuclease III	NA	A0A2K9L5P0	Tupanvirus	31.4	7.2e-24
WP_003085562.1|4876984_4877362_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_003101969.1|4877530_4878385_-	signal peptidase I	NA	NA	NA	NA	NA
WP_003085555.1|4878390_4880190_-	elongation factor 4	NA	A0A2K9L2P9	Tupanvirus	38.5	1.5e-20
WP_003101964.1|4880339_4881764_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	32.0	3.4e-28
WP_003101962.1|4881803_4882259_-	SoxR reducing system RseC family protein	NA	NA	NA	NA	NA
WP_003101960.1|4882255_4883206_-	sigma factor AlgU regulatory protein MucB	NA	NA	NA	NA	NA
WP_003101958.1|4883214_4883799_-	sigma-E factor negative regulatory protein	NA	NA	NA	NA	NA
WP_003085543.1|4883830_4884412_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_023088516.1|4884820_4886437_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_003114181.1|4886405_4886858_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085532.1|4886841_4887096_-	succinate dehydrogenase assembly factor 2	NA	NA	NA	NA	NA
WP_019396903.1|4887368_4888313_+	folate-binding protein YgfZ	NA	NA	NA	NA	NA
WP_003085528.1|4888413_4889250_+	HDOD domain-containing protein	NA	A0A1C3NFB0	Phage_NCTB	36.6	2.5e-26
WP_003101943.1|4889258_4890641_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_003085524.1|4890633_4891305_-	response regulator	NA	NA	NA	NA	NA
WP_003134362.1|4891515_4892799_+	OprD family porin	NA	NA	NA	NA	NA
WP_003085519.1|4892828_4893812_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_003101933.1|4893860_4894331_+	tripartite tricarboxylate transporter TctB family protein	NA	NA	NA	NA	NA
WP_003116509.1|4894341_4895859_+	tripartite tricarboxylate transporter permease	NA	NA	NA	NA	NA
WP_003114172.1|4895851_4896889_+	AbrB family transcriptional regulator	NA	NA	NA	NA	NA
WP_003106436.1|4897015_4897711_-	uracil-DNA glycosylase	NA	A0A0A7D9F8	Equid_alphaherpesvirus	45.2	1.0e-49
WP_003114171.1|4897810_4898632_-	VanW family protein	NA	NA	NA	NA	NA
WP_003106441.1|4898688_4899570_-	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_003116510.1|4899702_4901211_+	CoA-acylating methylmalonate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_003116511.1|4901222_4902386_+	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_023088517.1|4902451_4903270_+	enoyl-CoA hydratase	NA	NA	NA	NA	NA
WP_003106451.1|4903328_4904432_+	enoyl-CoA hydratase/isomerase family protein	NA	NA	NA	NA	NA
WP_003454697.1|4904543_4905440_+	3-hydroxyisobutyrate dehydrogenase	NA	NA	NA	NA	NA
WP_003085490.1|4905496_4906141_+	two pore domain potassium channel family protein	NA	NA	NA	NA	NA
WP_003110820.1|4906256_4906898_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_003161664.1|4906932_4908909_-	alkyl/aryl-sulfatase	NA	M1I0S7	Paramecium_bursaria_Chlorella_virus	44.8	1.8e-160
WP_023088518.1|4909011_4909731_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_003098351.1|4909734_4909923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003085479.1|4910045_4910291_-	DUF1145 domain-containing protein	NA	NA	NA	NA	NA
WP_003114164.1|4910407_4910863_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003098355.1|4910958_4911138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003098356.1|4911370_4912447_+	DUF2157 domain-containing protein	NA	NA	NA	NA	NA
WP_023088519.1|4912443_4913259_+	DUF4824 family protein	NA	NA	NA	NA	NA
WP_003120794.1|4913279_4913552_+	cysteine-rich CWC family protein	NA	NA	NA	NA	NA
WP_003098362.1|4913551_4914244_+	16S rRNA pseudouridine(516) synthase	NA	NA	NA	NA	NA
WP_003098363.1|4914379_4915423_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_003085453.1|4915502_4916240_+	murein L,D-transpeptidase catalytic domain family protein	NA	NA	NA	NA	NA
WP_003085447.1|4916691_4917594_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
4917772:4917798	attL	AGGGTTCGATTCCCTTCGCCCGCTCCA	NA	NA	NA	NA
WP_093945212.1|4917923_4918556_+	DUF4145 domain-containing protein	NA	NA	NA	NA	NA
WP_093945213.1|4919476_4919689_+	HEAT repeat domain-containing protein	NA	NA	NA	NA	NA
WP_093945214.1|4919685_4920750_-|portal	phage portal protein	portal	A0A2H4J922	uncultured_Caudovirales_phage	76.6	8.8e-146
WP_023090140.1|4920746_4922504_-|terminase	terminase ATPase subunit family protein	terminase	Q9ZXM5	Pseudomonas_virus	80.7	3.9e-284
WP_093945215.1|4922658_4923480_+|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	59.3	6.9e-82
WP_023090142.1|4923521_4924535_+|capsid	phage major capsid protein, P2 family	capsid	A0A2H4JCR7	uncultured_Caudovirales_phage	68.8	1.2e-128
WP_093945216.1|4924537_4925236_+|terminase	terminase	terminase	Q9ZXM2	Pseudomonas_virus	66.8	2.2e-73
WP_023090144.1|4925340_4925805_+|head	head completion/stabilization protein	head	A0A2H4JCS4	uncultured_Caudovirales_phage	57.1	7.4e-41
WP_023090145.1|4925804_4926014_+|tail	tail protein X	tail	A0A2H4J946	uncultured_Caudovirales_phage	75.4	2.8e-24
WP_031764420.1|4926089_4926404_+|holin	phage holin, lambda family	holin	A0A2H4JFM8	uncultured_Caudovirales_phage	61.5	1.5e-29
WP_023097972.1|4926400_4927240_+	DUF3380 domain-containing protein	NA	A0A2H4JGJ9	uncultured_Caudovirales_phage	58.6	9.5e-79
WP_093945217.1|4927236_4927695_+	DUF2570 domain-containing protein	NA	Q9ZXL5	Pseudomonas_virus	51.7	1.2e-27
WP_093945218.1|4927788_4928316_+|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	65.6	6.9e-51
WP_093945219.1|4928308_4928758_+	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	67.3	2.6e-46
WP_093945220.1|4928831_4929398_+|plate	phage baseplate assembly protein V	plate	Q9ZXL0	Pseudomonas_virus	64.2	2.8e-50
WP_023090152.1|4929394_4929748_+	GPW/gp25 family protein	NA	A0A2H4JE52	uncultured_Caudovirales_phage	71.9	5.0e-37
WP_093945221.1|4929744_4930659_+|plate	baseplate assembly protein	plate	Q9ZXK8	Pseudomonas_virus	84.0	3.2e-136
WP_034063860.1|4930655_4931273_+|tail	phage tail protein I	tail	A0A2H4JAU2	uncultured_Caudovirales_phage	75.3	7.7e-86
WP_093945222.1|4933096_4933531_+|tail	tail fiber assembly protein	tail	Q9ZXK5	Pseudomonas_virus	51.4	1.1e-30
WP_093945223.1|4933628_4934801_+|tail	phage tail sheath protein	tail	A0A2H4JCP8	uncultured_Caudovirales_phage	85.9	1.2e-193
WP_023090158.1|4934850_4935366_+|tail	phage major tail tube protein	tail	A0A2H4J916	uncultured_Caudovirales_phage	76.6	6.3e-73
WP_093945224.1|4935407_4936490_-	FRG domain-containing protein	NA	NA	NA	NA	NA
WP_023090160.1|4936697_4937024_+|tail	phage tail assembly protein	tail	Q9ZXK2	Pseudomonas_virus	57.4	9.6e-27
WP_023090161.1|4937032_4937155_+|tail	GpE family phage tail protein	tail	A0A2H4JFK5	uncultured_Caudovirales_phage	56.4	2.0e-06
WP_172792889.1|4937144_4939733_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	34.8	2.5e-117
WP_023090163.1|4939738_4940182_+|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	84.8	1.1e-65
WP_093945226.1|4940178_4941444_+	phage late control D family protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	73.7	1.4e-179
WP_133432879.1|4941590_4942160_-	hypothetical protein	NA	S5FXQ0	Shigella_phage	39.8	5.8e-19
WP_161791495.1|4942164_4943160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172792904.1|4943534_4943954_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_093945229.1|4944039_4944270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023090168.1|4944299_4944806_+	hypothetical protein	NA	Q9ZXJ2	Pseudomonas_virus	57.8	2.5e-42
WP_016852047.1|4944802_4945081_+	ogr/Delta-like zinc finger family protein	NA	Q9ZXJ1	Pseudomonas_virus	47.3	5.5e-15
WP_093945230.1|4945077_4945437_+	hypothetical protein	NA	A0A2H4J947	uncultured_Caudovirales_phage	44.6	8.7e-13
WP_023097989.1|4945504_4945738_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093945231.1|4945756_4948474_+	toprim domain-containing protein	NA	Q9ZXI8	Pseudomonas_virus	52.8	3.5e-279
WP_162836546.1|4948527_4948674_+	hypothetical protein	NA	NA	NA	NA	NA
WP_031764433.1|4948697_4949021_+	hypothetical protein	NA	Q9ZXI7	Pseudomonas_virus	64.6	5.4e-30
WP_034040100.1|4949659_4950037_+	ASCH domain-containing protein	NA	A0A291AUQ6	Sinorhizobium_phage	47.2	1.6e-30
WP_093945232.1|4950033_4951260_+	phosphoadenosine phosphosulfate reductase family protein	NA	R9TRT5	Rhizobium_phage	71.3	5.7e-173
WP_171948631.1|4951269_4951446_+	hypothetical protein	NA	NA	NA	NA	NA
WP_093945233.1|4951442_4952084_+	hypothetical protein	NA	Q5QF31	Pseudomonas_virus	92.5	3.3e-116
WP_093945234.1|4952080_4952320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003098423.1|4952508_4952712_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_093945236.1|4952718_4953921_-|integrase	integrase family protein	integrase	A0A248SL35	Klebsiella_phage	30.9	3.8e-36
WP_073675491.1|4954255_4954480_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023090792.1|4954463_4955459_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	52.9	2.8e-93
WP_003115206.1|4955458_4956751_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	94.2	2.8e-247
WP_070581748.1|4957009_4958272_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	57.8	1.1e-118
WP_003159569.1|4958273_4958624_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	41.1	5.5e-20
WP_003163344.1|4958633_4959242_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019725828.1|4959885_4960104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003124954.1|4960117_4960369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024918438.1|4960489_4960924_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	95.1	2.2e-58
WP_023088865.1|4961439_4961730_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	99.0	6.7e-56
4969201:4969227	attR	AGGGTTCGATTCCCTTCGCCCGCTCCA	NA	NA	NA	NA
