The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053951	Bacillus cereus strain FDAARGOS_799 chromosome, complete genome	5381556	441114	480008	5381556	protease,transposase	Trichoplusia_ni_ascovirus(50.0%)	35	NA	NA
WP_000600470.1|441114_441999_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001064057.1|442620_444066_+	L,D-transpeptidase family protein	NA	NA	NA	NA	NA
WP_001104104.1|444408_444624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000441008.1|444918_445080_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001986336.1|445498_445885_+	DUF1259 domain-containing protein	NA	NA	NA	NA	NA
WP_001120970.1|446536_446869_+	DUF1904 family protein	NA	NA	NA	NA	NA
WP_001145286.1|446970_447363_-	VOC family protein	NA	NA	NA	NA	NA
WP_065703691.1|447474_449784_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_061654903.1|450050_451256_+	M20 family metallopeptidase	NA	NA	NA	NA	NA
WP_001178562.1|451425_451866_-	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_016111604.1|452033_452798_+	SDR family oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	32.0	1.1e-20
WP_087948649.1|453080_453677_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087964929.1|453739_454882_+	MFS transporter	NA	NA	NA	NA	NA
WP_172852462.1|456087_458049_+|protease	M6 family metalloprotease domain-containing protein	protease	NA	NA	NA	NA
WP_087948651.1|458557_458764_+	hypothetical protein	NA	NA	NA	NA	NA
WP_103652772.1|458864_459092_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087948652.1|459330_460521_-	MFS transporter	NA	NA	NA	NA	NA
WP_002062846.1|460741_461329_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_061654899.1|461903_462470_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_087948653.1|462529_464386_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_141528530.1|464554_465985_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000135751.1|466390_466777_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001075128.1|467200_467638_+	DUF1232 domain-containing protein	NA	NA	NA	NA	NA
WP_050821975.1|467851_468397_-	dihydrofolate reductase family protein	NA	NA	NA	NA	NA
WP_001076310.1|468744_469254_+	DinB family protein	NA	NA	NA	NA	NA
WP_097813898.1|469459_470890_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_061663671.1|471292_471949_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_002103330.1|473061_473367_+	arsenical resistance operon transcriptional regulator ArsR	NA	NA	NA	NA	NA
WP_001270993.1|473427_473865_+	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_000826532.1|473883_474924_+	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_000428354.1|474949_475354_+	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	72.2	5.5e-48
WP_000562836.1|475520_476351_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000701557.1|476442_477042_+	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_000536355.1|477331_478243_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_141528530.1|478577_480008_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP053951	Bacillus cereus strain FDAARGOS_799 chromosome, complete genome	5381556	1009826	1015063	5381556		Bacillus_phage(50.0%)	9	NA	NA
WP_001163828.1|1009826_1010501_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.7	2.8e-28
WP_000411453.1|1010513_1011044_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000372690.1|1011161_1011671_-	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	36.0	1.4e-16
WP_172853024.1|1011798_1012680_+	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_002061469.1|1012817_1013018_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	90.9	1.0e-15
WP_172853023.1|1013082_1013295_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000097509.1|1013314_1014115_-	C1 family peptidase	NA	A0A2K9L1Z4	Tupanvirus	37.2	1.0e-37
WP_000369348.1|1014479_1014611_-	DUF3983 domain-containing protein	NA	A0A1B1P7V8	Bacillus_phage	79.1	2.9e-11
WP_001139345.1|1014847_1015063_+	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	83.8	3.4e-25
>prophage 3
NZ_CP053951	Bacillus cereus strain FDAARGOS_799 chromosome, complete genome	5381556	1049641	1076176	5381556	coat,terminase,holin,head,tail	Bacillus_phage(95.0%)	27	NA	NA
WP_065484273.1|1049641_1050121_-|coat	spore coat protein CotF	coat	NA	NA	NA	NA
WP_172853017.1|1050620_1051379_+	YqcI/YcgG family protein	NA	NA	NA	NA	NA
WP_172853016.1|1051470_1052097_+	LysE family transporter	NA	NA	NA	NA	NA
WP_172853015.1|1052149_1053493_-	amino acid permease	NA	NA	NA	NA	NA
WP_170962689.1|1053507_1053660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000069660.1|1053888_1054101_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	68.3	1.6e-14
WP_172853014.1|1054376_1054859_+	YndM family protein	NA	NA	NA	NA	NA
WP_172853013.1|1054891_1055407_-	DUF3231 family protein	NA	NA	NA	NA	NA
WP_172853012.1|1055683_1055896_-	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	66.2	6.4e-16
WP_172853011.1|1056350_1057160_-	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	90.0	5.8e-150
WP_172853010.1|1057178_1057586_-|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	88.6	7.4e-61
WP_000390479.1|1057660_1057885_-	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	89.2	8.5e-27
WP_172853009.1|1058012_1058390_-	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	64.0	6.0e-41
WP_172853008.1|1058406_1062714_-	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	63.3	0.0e+00
WP_172853007.1|1062710_1064192_-|tail	phage tail family protein	tail	A0A0S2MV63	Bacillus_phage	87.8	4.5e-265
WP_000375621.1|1067115_1067322_-	hypothetical protein	NA	A0A0S2MV68	Bacillus_phage	98.5	2.1e-32
WP_172853006.1|1067426_1067855_-	hypothetical protein	NA	A0A0S2MV94	Bacillus_phage	94.4	1.1e-67
WP_071730458.1|1067901_1068495_-	hypothetical protein	NA	A0A0S2MV81	Bacillus_phage	97.0	1.3e-106
WP_098430317.1|1068509_1068872_-	hypothetical protein	NA	A0A0A7AQF9	Bacillus_phage	92.5	1.5e-60
WP_097879993.1|1068877_1069285_-	HK97 gp10 family phage protein	NA	A0A0A7AQU9	Bacillus_phage	94.8	3.4e-66
WP_172853005.1|1069259_1069607_-|head,tail	head-tail adaptor protein	head,tail	A0A0S2MVD7	Bacillus_phage	90.4	5.2e-55
WP_098284890.1|1069603_1069912_-	hypothetical protein	NA	A0A0A7AQX9	Bacillus_phage	92.2	6.4e-49
WP_071730467.1|1069955_1070801_-	hypothetical protein	NA	A0A0S2MVF8	Bacillus_phage	96.8	1.2e-150
WP_172853004.1|1070909_1071620_-	DUF4355 domain-containing protein	NA	A0A0A7AQU8	Bacillus_phage	69.9	2.4e-70
WP_172853003.1|1071692_1072460_-|head	phage head protein	head	A0A0S2MVF0	Bacillus_phage	94.1	2.7e-136
WP_172853002.1|1073979_1075251_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1L2JY46	Aeribacillus_phage	84.2	2.2e-220
WP_172853001.1|1075237_1076176_-|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	83.5	1.6e-114
>prophage 4
NZ_CP053951	Bacillus cereus strain FDAARGOS_799 chromosome, complete genome	5381556	1093920	1106807	5381556	integrase	Bacillus_phage(61.54%)	21	1095736:1095750	1114551:1114565
WP_172852985.1|1093920_1094337_-	DUF1064 domain-containing protein	NA	A0A0U4ISA7	Bacillus_phage	51.5	8.2e-31
WP_172853099.1|1094915_1095230_-	hypothetical protein	NA	A0A0A7AQW3	Bacillus_phage	48.5	4.3e-24
WP_172852984.1|1095377_1095860_-	YpiB family protein	NA	NA	NA	NA	NA
1095736:1095750	attL	GTTACAAATCTTAAA	NA	NA	NA	NA
WP_149216304.1|1095840_1096029_-	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	52.5	1.5e-13
WP_172853098.1|1096034_1096727_-	ATP-binding protein	NA	S6B1M2	Thermus_phage	51.9	3.0e-62
WP_172852983.1|1096797_1097655_-	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	56.1	1.6e-73
WP_172852407.1|1097656_1097833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852982.1|1097825_1098632_-	recombination protein RecT	NA	S6AVW6	Thermus_phage	65.4	4.1e-95
WP_172852981.1|1098621_1098870_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852980.1|1098883_1099828_-	YqaJ viral recombinase family protein	NA	A6XMH8	Bacillus_virus	53.0	2.6e-85
WP_172852979.1|1099828_1100329_-	HNH endonuclease	NA	A0A2H4J6F5	uncultured_Caudovirales_phage	37.1	5.1e-19
WP_172852978.1|1100405_1100600_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852977.1|1100600_1100921_-	hypothetical protein	NA	I3WU08	Bacillus_phage	59.2	3.2e-27
WP_172852976.1|1101065_1101341_-	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	75.3	4.1e-31
WP_128974839.1|1101419_1101620_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_098023290.1|1101862_1102231_+	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	39.0	2.4e-10
WP_164876569.1|1102541_1102688_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852975.1|1102684_1103863_-	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	57.1	4.5e-127
WP_149216295.1|1104682_1104892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852974.1|1104935_1105400_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852973.1|1105697_1106807_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U3U8Y8	Bacillus_phage	78.8	8.3e-147
1114551:1114565	attR	TTTAAGATTTGTAAC	NA	NA	NA	NA
>prophage 5
NZ_CP053951	Bacillus cereus strain FDAARGOS_799 chromosome, complete genome	5381556	1727708	1735860	5381556		Bacillus_phage(66.67%)	7	NA	NA
WP_001258503.1|1727708_1728581_-	aminoglycoside 6-adenylyltransferase	NA	A0A1X9I6F2	Streptococcus_phage	45.5	5.6e-66
WP_000818985.1|1728871_1729591_-	3-ketoacyl-ACP reductase	NA	W8CYX9	Bacillus_phage	100.0	5.9e-61
WP_172852889.1|1729880_1730954_-	two-component sensor histidine kinase	NA	W8CYF6	Bacillus_phage	97.2	4.4e-185
WP_000612414.1|1730950_1731628_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	99.1	1.1e-122
WP_065704339.1|1731714_1733475_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	98.2	1.8e-273
WP_001194306.1|1733715_1734480_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000755525.1|1734579_1735860_-	C40 family peptidase	NA	A0A1V0DZX6	Clostridioides_phage	31.5	3.4e-11
>prophage 6
NZ_CP053951	Bacillus cereus strain FDAARGOS_799 chromosome, complete genome	5381556	1893910	1903296	5381556		Brevibacillus_phage(100.0%)	9	NA	NA
WP_000278596.1|1893910_1894501_+	helix-turn-helix domain-containing protein	NA	A0A0K2CNS5	Brevibacillus_phage	44.3	7.8e-27
WP_001005179.1|1894560_1895331_+	ATP-binding protein	NA	A0A0K2CNX1	Brevibacillus_phage	48.4	2.0e-62
WP_098507689.1|1895810_1897103_+	DNA helicase	NA	A0A0K2CP24	Brevibacillus_phage	57.9	7.9e-141
WP_098507688.1|1897127_1898204_+	toprim domain-containing protein	NA	A0A0K2CNW6	Brevibacillus_phage	54.0	1.4e-103
WP_001090550.1|1898231_1898789_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CPD2	Brevibacillus_phage	41.1	2.4e-25
WP_053514165.1|1899251_1899911_+	hypothetical protein	NA	A0A0K2CPH8	Brevibacillus_phage	56.4	8.1e-57
WP_098507687.1|1899997_1901392_+	DNA polymerase I	NA	A0A0K2CP19	Brevibacillus_phage	45.6	9.2e-103
WP_000781409.1|1902015_1902420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000177372.1|1902588_1903296_+	DNA polymerase I	NA	A0A0K2CNW2	Brevibacillus_phage	53.5	7.3e-64
>prophage 7
NZ_CP053951	Bacillus cereus strain FDAARGOS_799 chromosome, complete genome	5381556	1911416	1925982	5381556		Brevibacillus_phage(55.56%)	12	NA	NA
WP_053514173.1|1911416_1912241_-	hypothetical protein	NA	A7KV11	Bacillus_phage	70.5	2.5e-79
WP_000998964.1|1912260_1912560_-	hypothetical protein	NA	A0A0K2CPL0	Brevibacillus_phage	59.3	5.0e-22
WP_097999166.1|1912576_1913584_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A127AWA8	Bacillus_phage	50.0	1.6e-11
WP_000655296.1|1913783_1914161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001125914.1|1914160_1914529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098507682.1|1915099_1919455_-	DNRLRE domain-containing protein	NA	A0A127AWB0	Bacillus_phage	27.5	6.4e-25
WP_172852863.1|1919497_1922392_-	halomucin	NA	A0A0K2CPP4	Brevibacillus_phage	30.4	2.2e-13
WP_000602965.1|1922376_1922988_-	hypothetical protein	NA	A0A127AW14	Bacillus_phage	51.6	2.2e-48
WP_001111329.1|1923028_1923520_-	hypothetical protein	NA	A0A0K2CNZ3	Brevibacillus_phage	54.5	2.0e-36
WP_098507680.1|1923595_1924039_-	hypothetical protein	NA	A0A0K2CPK2	Brevibacillus_phage	40.6	3.0e-23
WP_172852862.1|1924117_1924849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098507678.1|1924860_1925982_-	hypothetical protein	NA	A0A0K2CPP1	Brevibacillus_phage	37.3	7.3e-66
>prophage 8
NZ_CP053951	Bacillus cereus strain FDAARGOS_799 chromosome, complete genome	5381556	1938895	1955746	5381556	tail	Brevibacillus_phage(100.0%)	11	NA	NA
WP_172852858.1|1938895_1941481_-	hypothetical protein	NA	A0A0K2CPJ7	Brevibacillus_phage	44.2	1.6e-31
WP_000007798.1|1941496_1941937_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852857.1|1941951_1942668_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852856.1|1942746_1945938_-	M23 family metallopeptidase	NA	A0A0K2CNY2	Brevibacillus_phage	50.0	3.7e-06
WP_061663908.1|1945950_1947024_-	hypothetical protein	NA	A0A0K2CP35	Brevibacillus_phage	40.3	5.3e-74
WP_000068593.1|1947026_1947644_-	S-layer homology domain-containing protein	NA	A0A0K2CPJ2	Brevibacillus_phage	60.7	1.4e-71
WP_172852855.1|1947702_1953036_-|tail	phage tail tape measure protein	tail	A0A0K2CPN3	Brevibacillus_phage	26.6	3.0e-141
WP_000743719.1|1953108_1953351_-	hypothetical protein	NA	A0A0K2CP74	Brevibacillus_phage	55.0	2.1e-18
WP_000004089.1|1953437_1953908_-	hypothetical protein	NA	A0A0K2CPC8	Brevibacillus_phage	52.9	1.4e-34
WP_000077128.1|1954139_1955228_-	hypothetical protein	NA	A0A0K2CNX7	Brevibacillus_phage	55.8	1.2e-94
WP_002062978.1|1955227_1955746_-	hypothetical protein	NA	A0A0K2CP30	Brevibacillus_phage	45.8	4.4e-26
>prophage 9
NZ_CP053951	Bacillus cereus strain FDAARGOS_799 chromosome, complete genome	5381556	3308248	3316624	5381556		Synechococcus_phage(50.0%)	8	NA	NA
WP_000088589.1|3308248_3308836_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
WP_001262439.1|3308832_3309873_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000879032.1|3309978_3311394_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.2	4.3e-55
WP_172852692.1|3311378_3313598_-	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.3	5.1e-164
WP_000666787.1|3313581_3314265_-	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_000278823.1|3314261_3314516_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_001170544.1|3314508_3315228_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000625682.1|3315316_3316624_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
>prophage 10
NZ_CP053951	Bacillus cereus strain FDAARGOS_799 chromosome, complete genome	5381556	3362247	3370195	5381556		Bacillus_phage(33.33%)	6	NA	NA
WP_000719210.1|3362247_3363753_-	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	30.0	7.8e-31
WP_000929880.1|3363736_3364438_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	9.5e-40
WP_000833096.1|3364581_3365907_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	4.1e-44
WP_162841983.1|3366292_3367834_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.9e-22
WP_001029993.1|3368237_3369872_-	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
WP_000917311.1|3369910_3370195_-	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
>prophage 11
NZ_CP053951	Bacillus cereus strain FDAARGOS_799 chromosome, complete genome	5381556	4429947	4445813	5381556	protease,integrase,capsid,head	uncultured_Caudovirales_phage(30.77%)	24	4426520:4426534	4436802:4436816
4426520:4426534	attL	TGCAGAGATATTAAA	NA	NA	NA	NA
WP_002196925.1|4429947_4430118_-	hypothetical protein	NA	A0A2H4J549	uncultured_Caudovirales_phage	55.4	2.7e-09
WP_044584905.1|4430126_4430909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001288257.1|4431465_4431642_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001063532.1|4431634_4431892_+	hypothetical protein	NA	A0A0S2SXU9	Bacillus_phage	65.4	2.0e-24
WP_172852606.1|4432213_4433434_-|integrase	site-specific integrase	integrase	A0A1Q1PVS7	Staphylococcus_phage	31.4	2.6e-40
WP_172852605.1|4433456_4434167_-	helix-turn-helix transcriptional regulator	NA	I2E8Y1	Clostridium_phage	35.8	2.4e-06
WP_098432482.1|4434318_4434513_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_098432480.1|4434562_4434832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001014689.1|4434989_4435136_+	hypothetical protein	NA	A0A1B2APZ0	Phage_Wrath	68.9	1.1e-09
WP_172852604.1|4435149_4435542_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852603.1|4435644_4437927_+	DNA primase	NA	A0A2H4JCU9	uncultured_Caudovirales_phage	41.5	5.5e-161
4436802:4436816	attR	TGCAGAGATATTAAA	NA	NA	NA	NA
WP_172852602.1|4438266_4438488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852601.1|4438509_4438890_+	hypothetical protein	NA	A0A288WG73	Bacillus_phage	78.0	1.1e-50
WP_172852600.1|4438910_4439195_+	hypothetical protein	NA	NA	NA	NA	NA
WP_170968783.1|4439550_4439706_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852599.1|4439711_4440314_+|head,protease	HK97 family phage prohead protease	head,protease	B4XYP5	Lactobacillus_phage	30.3	4.5e-14
WP_172852598.1|4440340_4441300_+|capsid	phage major capsid protein	capsid	A0A2H4J9Y4	uncultured_Caudovirales_phage	43.0	6.9e-65
WP_172852597.1|4441391_4442162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852596.1|4442190_4443378_+	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	46.2	3.8e-97
WP_172852595.1|4443542_4444310_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852594.1|4444589_4444805_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852593.1|4444945_4445191_+	hypothetical protein	NA	A0A1B1P7N2	Bacillus_phage	85.3	4.8e-31
WP_172852592.1|4445187_4445373_+	hypothetical protein	NA	A0A2H4J841	uncultured_Caudovirales_phage	94.9	4.9e-12
WP_042988818.1|4445552_4445813_+	hypothetical protein	NA	A0A0S2SXU9	Bacillus_phage	69.8	1.8e-28
>prophage 12
NZ_CP053951	Bacillus cereus strain FDAARGOS_799 chromosome, complete genome	5381556	4554294	4561979	5381556		uncultured_Caudovirales_phage(16.67%)	10	NA	NA
WP_098280954.1|4554294_4555278_+	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	5.5e-17
WP_000403761.1|4555267_4556038_+	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	7.6e-14
WP_001086122.1|4556070_4556835_+	class B sortase	NA	NA	NA	NA	NA
WP_000587818.1|4556907_4557231_-	heme oxygenase	NA	NA	NA	NA	NA
WP_098541173.1|4557525_4558725_+	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	8.0e-71
WP_001014310.1|4558763_4558958_-	YwbE family protein	NA	NA	NA	NA	NA
WP_001293578.1|4558958_4559132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000018029.1|4559300_4559993_+	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.4e-06
WP_172852581.1|4559994_4560930_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	1.6e-21
WP_000221066.1|4561055_4561979_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	1.5e-45
>prophage 1
NZ_CP053949	Bacillus cereus strain FDAARGOS_799 plasmid unnamed1, complete sequence	480092	335262	348175	480092		Bacillus_phage(91.67%)	16	NA	NA
WP_172852041.1|335262_335427_+	hypothetical protein	NA	A0A1B0T6B0	Bacillus_phage	65.4	9.4e-07
WP_086411729.1|335759_336203_-	DUF5065 family protein	NA	NA	NA	NA	NA
WP_172852042.1|336846_337422_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098281479.1|337742_338798_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0T6C8	Bacillus_phage	71.8	1.2e-150
WP_000570185.1|338794_339034_-	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	75.9	2.7e-26
WP_021728083.1|339033_339270_-	hemolysin XhlA family protein	NA	A0A288WG97	Bacillus_phage	88.9	6.1e-15
WP_098281478.1|339961_340846_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0S2MVR5	Bacillus_phage	51.8	1.6e-76
WP_098281477.1|341118_341940_-	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	43.8	1.2e-28
WP_061884948.1|342081_343050_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	41.7	4.5e-32
WP_000460733.1|343287_343674_-	hypothetical protein	NA	A0A288WG73	Bacillus_phage	69.8	2.6e-47
WP_172852043.1|344745_344982_-	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	58.2	6.3e-12
WP_000579788.1|345118_345547_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	51.4	9.3e-30
WP_098281474.1|345569_345998_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	55.1	2.8e-34
WP_098281473.1|346269_346797_-	ester cyclase	NA	NA	NA	NA	NA
WP_042889832.1|346956_347349_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_098281472.1|347353_348175_-	cytoplasmic protein	NA	F2NZ47	Diadromus_pulchellus_ascovirus	30.3	5.0e-24
>prophage 2
NZ_CP053949	Bacillus cereus strain FDAARGOS_799 plasmid unnamed1, complete sequence	480092	353647	433072	480092	transposase,protease	Bacillus_phage(35.29%)	60	NA	NA
WP_098281467.1|353647_354139_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_165613739.1|354518_354671_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098281466.1|355050_356046_-	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
WP_170962695.1|356086_356518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098402776.1|357334_358705_-	M23 family metallopeptidase	NA	D7RWE0	Brochothrix_phage	42.6	4.3e-20
WP_172852044.1|358914_360255_-	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	39.8	3.1e-15
WP_172852045.1|360317_361580_-	3D domain-containing protein	NA	M4HQ50	Bacillus_phage	44.8	3.5e-24
WP_061663378.1|361825_362095_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_098280861.1|362392_363487_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	49.6	4.0e-93
WP_170962688.1|363679_363841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098280862.1|364334_364754_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001167049.1|364823_365039_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	70.1	1.7e-19
WP_172852046.1|365205_366948_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.8	4.1e-07
WP_172852047.1|367936_368416_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_172852151.1|368569_368677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852048.1|369134_369545_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787540.1|369958_370372_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_065705218.1|370361_370769_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_172852049.1|371138_371486_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	37.8	1.3e-10
WP_172852050.1|371914_372103_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172852051.1|372397_375088_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	23.7	3.7e-39
WP_172852052.1|375487_376816_-	magnesium transporter	NA	NA	NA	NA	NA
WP_172852053.1|377077_377545_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_172852054.1|377706_379404_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_172852055.1|381554_383264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798819.1|385553_385964_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_172852056.1|387698_388466_-	PH domain-containing protein	NA	I3VYV9	Thermoanaerobacterium_phage	27.5	1.0e-10
WP_000633813.1|388659_388944_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002164669.1|389762_390050_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852152.1|390265_391177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852057.1|396429_397707_-	replication-relaxation family protein	NA	NA	NA	NA	NA
WP_001006726.1|399421_399844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852058.1|399848_401303_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_172852059.1|401337_402078_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172852060.1|405624_405762_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_172851997.1|406501_406651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852153.1|409448_409913_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_172852061.1|409926_410373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852062.1|410876_411320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167319656.1|411316_411751_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852063.1|412992_414813_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.8	5.7e-20
WP_172852154.1|417059_417989_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	43.0	9.1e-38
WP_172852064.1|417910_418219_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_172852065.1|418853_418964_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_172852066.1|419159_419582_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852155.1|419964_420243_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172852067.1|420456_420612_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852068.1|420885_421011_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_172852069.1|421756_422053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852070.1|423443_423926_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_153594324.1|424581_425241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852071.1|425686_425917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852072.1|426106_426481_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	51.3	1.2e-28
WP_172852073.1|426528_426870_-	YolD-like family protein	NA	A0A1Q1PW34	Staphylococcus_phage	31.4	6.1e-08
WP_172852074.1|426866_428132_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.3	1.2e-101
WP_130067921.1|428975_429116_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_001281108.1|429247_429943_+	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	1.3e-36
WP_172852075.1|429932_431087_+	vancomycin resistance histidine kinase VanS	NA	W8CYF6	Bacillus_phage	24.1	3.2e-16
WP_172852156.1|431544_431760_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_172852076.1|431953_433072_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.7	6.1e-174
>prophage 1
NZ_CP053950	Bacillus cereus strain FDAARGOS_799 plasmid unnamed2, complete sequence	328123	4184	63879	328123	transposase	Streptococcus_phage(18.18%)	57	NA	NA
WP_172852232.1|4184_4502_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_172852233.1|4531_4981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852234.1|5211_5352_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852235.1|5542_5728_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_172852236.1|6215_7100_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	33.2	4.1e-32
WP_172852237.1|7143_7851_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	9.3e-43
WP_172852387.1|8001_9888_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_172852238.1|9904_10666_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	4.2e-33
WP_172852239.1|10722_11763_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_131252118.1|11860_12229_-	YxeA family protein	NA	NA	NA	NA	NA
WP_172852240.1|12892_13069_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852241.1|13304_13418_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_172852237.1|13497_14205_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	9.3e-43
WP_172852242.1|14682_15480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852243.1|15932_17006_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	42.0	6.3e-75
WP_000976103.1|17002_17158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852389.1|17375_17894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852391.1|18158_18425_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016078679.1|18813_19107_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172852244.1|19192_19627_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_172852245.1|19669_19957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852246.1|20034_20235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852247.1|20286_20931_-	thermonuclease family protein	NA	A0A2P1JU10	Anoxybacillus_phage	31.0	4.1e-05
WP_172852248.1|22288_22999_-	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_172852249.1|23228_25076_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_172852250.1|25065_25827_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	3.8e-26
WP_172852251.1|25942_26938_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_172852252.1|26934_27627_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.6	2.7e-23
WP_172852253.1|28173_29589_-	peptidase M56	NA	NA	NA	NA	NA
WP_172852254.1|29591_29990_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_172852255.1|30350_31190_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_172852256.1|31628_32633_-	VanZ family protein	NA	NA	NA	NA	NA
WP_172852165.1|32789_33032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852257.1|34169_35600_-|transposase	IS4-like element ISBce10 family transposase	transposase	NA	NA	NA	NA
WP_000956453.1|35802_35997_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000040564.1|35996_36458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852258.1|37244_38672_-	beta-lactamase family protein	NA	A0A2P1JR59	Mycobacterium_phage	23.2	1.8e-08
WP_172852259.1|39129_39786_-	GAP family protein	NA	NA	NA	NA	NA
WP_172852260.1|39799_40558_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_113734020.1|41233_41785_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_172852261.1|42386_43031_-	YitT family protein	NA	NA	NA	NA	NA
WP_172852262.1|43393_44635_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_172852263.1|44760_46032_-	MFS transporter	NA	NA	NA	NA	NA
WP_172852264.1|46487_48110_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172852265.1|48556_49789_+	cytochrome P450	NA	A0A2I2L481	Orpheovirus	27.7	3.2e-06
WP_141528530.1|50150_51581_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_172852266.1|51854_53285_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_141528530.1|53857_55288_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_172852267.1|55606_55900_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172852268.1|55999_56410_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_001996145.1|56452_56740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088021417.1|56816_57017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852269.1|57068_57713_-	thermonuclease family protein	NA	A0A2P1JU10	Anoxybacillus_phage	38.6	7.0e-05
WP_172852270.1|58614_59499_-|transposase	PD-(D/E)XK nuclease family transposase	transposase	NA	NA	NA	NA
WP_172852271.1|59924_60965_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_172852272.1|61017_62430_+	tyrosine phenol-lyase	NA	NA	NA	NA	NA
WP_172852273.1|62982_63879_-|transposase	PD-(D/E)XK nuclease family transposase	transposase	NA	NA	NA	NA
>prophage 2
NZ_CP053950	Bacillus cereus strain FDAARGOS_799 plasmid unnamed2, complete sequence	328123	67706	78737	328123		Bacillus_phage(75.0%)	10	NA	NA
WP_172852275.1|67706_68480_+	DUF4393 domain-containing protein	NA	A0A0M4RU42	Bacillus_phage	56.1	2.0e-51
WP_172852276.1|68769_68916_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852277.1|69111_69312_-	hypothetical protein	NA	A0A0A7AQJ2	Bacillus_phage	98.5	6.2e-29
WP_116345108.1|70537_70876_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852278.1|70936_71323_-	ArpU family transcriptional regulator	NA	A0A1B1P853	Bacillus_phage	44.0	2.2e-22
WP_172852279.1|71461_72079_-	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	60.7	2.2e-48
WP_172852280.1|73060_73276_+	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	94.4	1.8e-29
WP_172852281.1|73843_74017_-	hypothetical protein	NA	I7J6W4	Bacillus_phage	51.9	7.6e-07
WP_172852282.1|75151_76981_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.5	9.4e-47
WP_172852283.1|76973_78737_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	7.0e-39
>prophage 3
NZ_CP053950	Bacillus cereus strain FDAARGOS_799 plasmid unnamed2, complete sequence	328123	257863	306721	328123	protease,transposase,integrase	Bacillus_phage(54.55%)	45	290244:290266	312403:312425
WP_172852188.1|257863_258409_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	43.9	5.9e-29
WP_172852189.1|259126_259270_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852190.1|260506_261250_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852378.1|261498_261768_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	41.4	2.9e-13
WP_172852191.1|262543_262936_+	gamma-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_172852192.1|265349_265736_+	ArpU family transcriptional regulator	NA	D2XQ27	Bacillus_virus	96.1	3.2e-61
WP_172852193.1|267110_267599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852194.1|267982_268150_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852195.1|268559_268832_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376550.1|268960_269098_-	DUF3956 domain-containing protein	NA	NA	NA	NA	NA
WP_172852196.1|269587_270235_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852379.1|270540_271272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852197.1|271321_271645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167319661.1|272696_272816_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_172852198.1|273356_273554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852199.1|274026_274587_-	recombinase family protein	NA	A0A219YB42	Aeromonas_phage	41.5	2.7e-29
WP_172852200.1|276593_277121_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_172852201.1|277736_278330_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172852202.1|278357_279608_+	MFS transporter	NA	NA	NA	NA	NA
WP_172852203.1|280078_280522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852204.1|281235_282354_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172852381.1|282467_283121_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_172852205.1|283152_284076_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_172884842.1|284102_284300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852206.1|284551_285058_-	DinB family protein	NA	NA	NA	NA	NA
WP_172852207.1|285779_287156_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_172852208.1|287511_288195_+	hypothetical protein	NA	A0A0A7AR45	Bacillus_phage	41.6	1.0e-38
WP_172852209.1|288749_288872_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_172852210.1|289308_289473_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000516897.1|289832_290156_-|transposase	transposase	transposase	NA	NA	NA	NA
290244:290266	attL	TAGGAAAGGATGGCGTTTTTTAT	NA	NA	NA	NA
WP_172852211.1|290677_291952_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_063549519.1|292419_292671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063549517.1|292853_293303_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852212.1|293595_293970_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	47.1	2.9e-27
WP_172852213.1|294016_294325_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_172852214.1|294353_295619_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.6	1.1e-102
WP_137050358.1|295900_297060_-|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.5	1.9e-37
WP_172852215.1|297589_298465_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172852383.1|298612_299422_+	YitT family protein	NA	NA	NA	NA	NA
WP_172852216.1|299738_301055_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_001043945.1|302274_302547_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	70.0	3.3e-25
WP_172852384.1|302793_302988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852217.1|304558_304885_-	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV8	Bacillus_phage	50.0	1.4e-22
WP_172852218.1|305097_306141_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	23.1	4.9e-08
WP_172852219.1|306370_306721_+|transposase	transposase	transposase	NA	NA	NA	NA
312403:312425	attR	TAGGAAAGGATGGCGTTTTTTAT	NA	NA	NA	NA
