The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053954	Bacillus cereus strain FDAARGOS_798 chromosome, complete genome	5381410	187192	205067	5381410	protease,transposase	Mycobacterium_phage(50.0%)	15	NA	NA
WP_172852266.1|187192_188623_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_141543160.1|188855_190286_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_172852456.1|190551_191982_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_172852458.1|192275_192755_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_172852460.1|193000_194407_+	MFS transporter	NA	A0A0M3UL24	Mycobacterium_phage	28.1	3.9e-32
WP_141528530.1|194684_196115_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_141528530.1|196351_197782_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_000536355.1|198116_199028_-	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000701557.1|199317_199917_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_000562836.1|200008_200839_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000428354.1|201005_201410_-	arsenate reductase (thioredoxin)	NA	A0A2H4PQT9	Staphylococcus_phage	72.2	5.5e-48
WP_000826532.1|201435_202476_-	ACR3 family arsenite efflux transporter	NA	NA	NA	NA	NA
WP_001270993.1|202494_202932_-	glyoxalase/bleomycin resistance/dioxygenase family protein	NA	NA	NA	NA	NA
WP_002103330.1|202992_203298_-	arsenical resistance operon transcriptional regulator ArsR	NA	NA	NA	NA	NA
WP_061663671.1|204410_205067_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
>prophage 2
NZ_CP053954	Bacillus cereus strain FDAARGOS_798 chromosome, complete genome	5381410	1495936	1503621	5381410		Staphylococcus_phage(16.67%)	10	NA	NA
WP_000221066.1|1495936_1496860_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.5	1.5e-45
WP_172852581.1|1496985_1497921_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	24.8	1.6e-21
WP_000018029.1|1497922_1498615_-	response regulator transcription factor	NA	B5LWA6	Feldmannia_species_virus	28.8	1.4e-06
WP_001293578.1|1498783_1498957_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001014310.1|1498957_1499152_+	YwbE family protein	NA	NA	NA	NA	NA
WP_098541173.1|1499190_1500390_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	41.2	8.0e-71
WP_000587818.1|1500684_1501008_+	heme oxygenase	NA	NA	NA	NA	NA
WP_001086122.1|1501080_1501845_-	class B sortase	NA	NA	NA	NA	NA
WP_000403761.1|1501877_1502648_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	28.6	7.6e-14
WP_098280954.1|1502637_1503621_-	iron ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.6	5.5e-17
>prophage 3
NZ_CP053954	Bacillus cereus strain FDAARGOS_798 chromosome, complete genome	5381410	1612102	1627968	5381410	protease,integrase,head,capsid	Bacillus_phage(30.77%)	24	1601759:1601773	1626224:1626238
1601759:1601773	attL	AGAAAAGTTCTTCAA	NA	NA	NA	NA
WP_042988818.1|1612102_1612363_-	hypothetical protein	NA	A0A0S2SXU9	Bacillus_phage	69.8	1.8e-28
WP_172852592.1|1612542_1612728_-	hypothetical protein	NA	A0A2H4J841	uncultured_Caudovirales_phage	94.9	4.9e-12
WP_172852593.1|1612724_1612970_-	hypothetical protein	NA	A0A1B1P7N2	Bacillus_phage	85.3	4.8e-31
WP_172852594.1|1613110_1613326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852595.1|1613605_1614373_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852596.1|1614537_1615725_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	46.2	3.8e-97
WP_172852597.1|1615753_1616524_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852598.1|1616615_1617575_-|capsid	phage major capsid protein	capsid	A0A2H4J9Y4	uncultured_Caudovirales_phage	43.0	6.9e-65
WP_172852599.1|1617601_1618204_-|head,protease	HK97 family phage prohead protease	head,protease	B4XYP5	Lactobacillus_phage	30.3	4.5e-14
WP_170968783.1|1618209_1618365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852600.1|1618720_1619005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852601.1|1619025_1619406_-	hypothetical protein	NA	A0A288WG73	Bacillus_phage	78.0	1.1e-50
WP_172852602.1|1619427_1619649_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852603.1|1619988_1622271_-	DNA primase	NA	A0A2H4JCU9	uncultured_Caudovirales_phage	41.5	5.5e-161
WP_172852604.1|1622373_1622766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001014689.1|1622779_1622926_-	hypothetical protein	NA	A0A1B2APZ0	Phage_Wrath	68.9	1.1e-09
WP_098432480.1|1623083_1623353_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098432482.1|1623402_1623597_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172852605.1|1623748_1624459_+	helix-turn-helix transcriptional regulator	NA	I2E8Y1	Clostridium_phage	35.8	2.4e-06
WP_172852606.1|1624481_1625702_+|integrase	site-specific integrase	integrase	A0A1Q1PVS7	Staphylococcus_phage	31.4	2.6e-40
WP_001063532.1|1626023_1626281_-	hypothetical protein	NA	A0A0S2SXU9	Bacillus_phage	65.4	2.0e-24
1626224:1626238	attR	AGAAAAGTTCTTCAA	NA	NA	NA	NA
WP_001288257.1|1626273_1626450_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044584905.1|1627006_1627789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002196925.1|1627797_1627968_+	hypothetical protein	NA	A0A2H4J549	uncultured_Caudovirales_phage	55.4	2.7e-09
>prophage 4
NZ_CP053954	Bacillus cereus strain FDAARGOS_798 chromosome, complete genome	5381410	2687720	2695668	5381410		uncultured_virus(33.33%)	6	NA	NA
WP_000917311.1|2687720_2688005_+	co-chaperone GroES	NA	A0A221S3C8	uncultured_virus	54.8	1.2e-20
WP_001029993.1|2688043_2689678_+	chaperonin GroEL	NA	A0A219YK78	uncultured_virus	58.0	1.5e-157
WP_162841983.1|2690081_2691623_+	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	31.7	8.9e-22
WP_000833096.1|2692008_2693334_+	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	29.4	4.1e-44
WP_000929880.1|2693477_2694179_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	9.5e-40
WP_000719210.1|2694162_2695668_+	aminopeptidase AmpS	NA	W8CYF6	Bacillus_phage	30.0	7.8e-31
>prophage 5
NZ_CP053954	Bacillus cereus strain FDAARGOS_798 chromosome, complete genome	5381410	2741291	2749667	5381410		Synechococcus_phage(50.0%)	8	NA	NA
WP_000625682.1|2741291_2742599_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	25.3	4.9e-21
WP_001170544.1|2742687_2743407_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	G8EYA2	Synechococcus_phage	44.3	4.0e-49
WP_000278823.1|2743399_2743654_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000666787.1|2743650_2744334_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_172852692.1|2744317_2746537_+	phosphoribosylformylglycinamidine synthase II	NA	A6N228	Microbacterium_phage	41.3	5.1e-164
WP_000879032.1|2746521_2747937_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	35.2	4.3e-55
WP_001262439.1|2748042_2749083_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A0E3F760	Synechococcus_phage	45.9	1.2e-67
WP_000088589.1|2749079_2749667_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	37.4	9.1e-28
>prophage 6
NZ_CP053954	Bacillus cereus strain FDAARGOS_798 chromosome, complete genome	5381410	4102022	4118873	5381410	tail	Brevibacillus_phage(100.0%)	11	NA	NA
WP_002062978.1|4102022_4102541_+	hypothetical protein	NA	A0A0K2CP30	Brevibacillus_phage	45.8	4.4e-26
WP_000077128.1|4102540_4103629_+	hypothetical protein	NA	A0A0K2CNX7	Brevibacillus_phage	55.8	1.2e-94
WP_000004089.1|4103860_4104331_+	hypothetical protein	NA	A0A0K2CPC8	Brevibacillus_phage	52.9	1.4e-34
WP_000743719.1|4104417_4104660_+	hypothetical protein	NA	A0A0K2CP74	Brevibacillus_phage	55.0	2.1e-18
WP_172852855.1|4104732_4110066_+|tail	phage tail tape measure protein	tail	A0A0K2CPN3	Brevibacillus_phage	26.6	3.0e-141
WP_000068593.1|4110124_4110742_+	S-layer homology domain-containing protein	NA	A0A0K2CPJ2	Brevibacillus_phage	60.7	1.4e-71
WP_061663908.1|4110744_4111818_+	hypothetical protein	NA	A0A0K2CP35	Brevibacillus_phage	40.3	5.3e-74
WP_172852856.1|4111830_4115022_+	M23 family metallopeptidase	NA	A0A0K2CNY2	Brevibacillus_phage	50.0	3.7e-06
WP_172852857.1|4115100_4115817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000007798.1|4115831_4116272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852858.1|4116287_4118873_+	hypothetical protein	NA	A0A0K2CPJ7	Brevibacillus_phage	44.2	1.6e-31
>prophage 7
NZ_CP053954	Bacillus cereus strain FDAARGOS_798 chromosome, complete genome	5381410	4131786	4146352	5381410		Brevibacillus_phage(55.56%)	12	NA	NA
WP_098507678.1|4131786_4132908_+	hypothetical protein	NA	A0A0K2CPP1	Brevibacillus_phage	37.3	7.3e-66
WP_172852862.1|4132919_4133651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098507680.1|4133729_4134173_+	hypothetical protein	NA	A0A0K2CPK2	Brevibacillus_phage	40.6	3.0e-23
WP_001111329.1|4134248_4134740_+	hypothetical protein	NA	A0A0K2CNZ3	Brevibacillus_phage	54.5	2.0e-36
WP_000602965.1|4134780_4135392_+	hypothetical protein	NA	A0A127AW14	Bacillus_phage	51.6	2.2e-48
WP_172852863.1|4135376_4138271_+	halomucin	NA	A0A0K2CPP4	Brevibacillus_phage	30.4	2.2e-13
WP_098507682.1|4138313_4142669_+	DNRLRE domain-containing protein	NA	A0A127AWB0	Bacillus_phage	27.5	6.4e-25
WP_001125914.1|4143239_4143608_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000655296.1|4143607_4143985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_097999166.1|4144184_4145192_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A127AWA8	Bacillus_phage	50.0	1.6e-11
WP_000998964.1|4145208_4145508_+	hypothetical protein	NA	A0A0K2CPL0	Brevibacillus_phage	59.3	5.0e-22
WP_053514173.1|4145527_4146352_+	hypothetical protein	NA	A7KV11	Bacillus_phage	70.5	2.5e-79
>prophage 8
NZ_CP053954	Bacillus cereus strain FDAARGOS_798 chromosome, complete genome	5381410	4154472	4163858	5381410		Brevibacillus_phage(100.0%)	9	NA	NA
WP_000177372.1|4154472_4155180_-	DNA polymerase I	NA	A0A0K2CNW2	Brevibacillus_phage	53.5	7.3e-64
WP_000781409.1|4155348_4155753_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098507687.1|4156376_4157771_-	DNA polymerase I	NA	A0A0K2CP19	Brevibacillus_phage	45.6	9.2e-103
WP_053514165.1|4157857_4158517_-	hypothetical protein	NA	A0A0K2CPH8	Brevibacillus_phage	56.4	8.1e-57
WP_001090550.1|4158979_4159537_-	sigma-70 family RNA polymerase sigma factor	NA	A0A0K2CPD2	Brevibacillus_phage	41.1	2.4e-25
WP_098507688.1|4159564_4160641_-	toprim domain-containing protein	NA	A0A0K2CNW6	Brevibacillus_phage	54.0	1.4e-103
WP_098507689.1|4160665_4161958_-	DNA helicase	NA	A0A0K2CP24	Brevibacillus_phage	57.9	7.9e-141
WP_001005179.1|4162437_4163208_-	ATP-binding protein	NA	A0A0K2CNX1	Brevibacillus_phage	48.4	2.0e-62
WP_000278596.1|4163267_4163858_-	helix-turn-helix domain-containing protein	NA	A0A0K2CNS5	Brevibacillus_phage	44.3	7.8e-27
>prophage 9
NZ_CP053954	Bacillus cereus strain FDAARGOS_798 chromosome, complete genome	5381410	4948616	5003880	5381410	head,tail,terminase,integrase,bacteriocin,holin	Bacillus_phage(80.56%)	66	4939479:4939495	4967361:4967377
4939479:4939495	attL	ATTCAAGGTGACTGGAC	NA	NA	NA	NA
WP_001071364.1|4948616_4948937_+|bacteriocin	heterocycloanthracin/sonorensin family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_002063155.1|4949426_4949912_+	hypothetical protein	NA	NA	NA	NA	NA
WP_088069144.1|4950221_4950923_+	DUF3962 domain-containing protein	NA	NA	NA	NA	NA
WP_172852973.1|4950961_4952071_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0U3U8Y8	Bacillus_phage	78.8	8.3e-147
WP_172852974.1|4952368_4952833_+	hypothetical protein	NA	NA	NA	NA	NA
WP_149216295.1|4952876_4953086_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852975.1|4953905_4955084_+	hypothetical protein	NA	A0A1B1P895	Bacillus_phage	57.1	4.5e-127
WP_164876569.1|4955080_4955227_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098023290.1|4955537_4955906_-	helix-turn-helix transcriptional regulator	NA	A0A2H4J6F9	uncultured_Caudovirales_phage	39.0	2.4e-10
WP_128974839.1|4956148_4956349_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172852976.1|4956427_4956703_+	helix-turn-helix domain-containing protein	NA	A0A0U3ULL9	Bacillus_phage	75.3	4.1e-31
WP_172852977.1|4956847_4957168_+	hypothetical protein	NA	I3WU08	Bacillus_phage	59.2	3.2e-27
WP_172852978.1|4957168_4957363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852979.1|4957439_4957940_+	HNH endonuclease	NA	A0A2H4J6F5	uncultured_Caudovirales_phage	37.1	5.1e-19
WP_172852980.1|4957940_4958885_+	YqaJ viral recombinase family protein	NA	A6XMH8	Bacillus_virus	53.0	2.6e-85
WP_172852981.1|4958898_4959147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852982.1|4959136_4959943_+	recombination protein RecT	NA	S6AVW6	Thermus_phage	65.4	4.1e-95
WP_172852407.1|4959935_4960112_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852983.1|4960113_4960971_+	DnaD domain protein	NA	A0A0S2MVA0	Bacillus_phage	56.1	1.6e-73
WP_172853098.1|4961041_4961734_+	ATP-binding protein	NA	S6B1M2	Thermus_phage	51.9	3.0e-62
WP_149216304.1|4961739_4961928_+	hypothetical protein	NA	A0A0U3K3J8	Bacillus_phage	52.5	1.5e-13
WP_172852984.1|4961908_4962391_+	YpiB family protein	NA	NA	NA	NA	NA
WP_172853099.1|4962538_4962853_+	hypothetical protein	NA	A0A0A7AQW3	Bacillus_phage	48.5	4.3e-24
WP_172852985.1|4963431_4963848_+	DUF1064 domain-containing protein	NA	A0A0U4ISA7	Bacillus_phage	51.5	8.2e-31
WP_172852986.1|4963862_4964573_+	2-methylcitrate dehydratase	NA	NA	NA	NA	NA
WP_172853100.1|4964666_4965536_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_172852987.1|4965545_4965935_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852988.1|4966160_4966691_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_065212698.1|4966980_4967175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852989.1|4968360_4968657_+	hypothetical protein	NA	A0A0M4REQ3	Bacillus_phage	76.8	1.5e-34
4967361:4967377	attR	ATTCAAGGTGACTGGAC	NA	NA	NA	NA
WP_172852990.1|4968863_4969154_-	DUF4183 domain-containing protein	NA	NA	NA	NA	NA
WP_172852991.1|4969703_4970111_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852992.1|4970553_4970841_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852993.1|4972227_4972494_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852994.1|4972603_4972894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852995.1|4973093_4973723_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_172852996.1|4973910_4974228_+	transglycosylase	NA	NA	NA	NA	NA
WP_172852409.1|4974244_4974433_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852997.1|4975046_4976342_+	collagen-like repeat preface domain-containing protein	NA	A0A2R8FCV3	Brazilian_cedratvirus	40.2	4.5e-19
WP_172852998.1|4976666_4977041_+	ArpU family transcriptional regulator	NA	Q9ZXB9	Bacillus_phage	39.7	3.0e-16
WP_098394576.1|4977661_4977868_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852999.1|4978234_4978441_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172853000.1|4979175_4979505_-	WGxxGxxG-CTERM domain-containing protein	NA	NA	NA	NA	NA
WP_088009814.1|4979851_4980367_+	DUF3231 family protein	NA	NA	NA	NA	NA
WP_172853001.1|4981592_4982531_+|terminase	terminase small subunit	terminase	A0A0S2MVB6	Bacillus_phage	83.5	1.6e-114
WP_172853002.1|4982517_4983789_+|terminase	PBSX family phage terminase large subunit	terminase	A0A1L2JY46	Aeribacillus_phage	84.2	2.2e-220
WP_172853003.1|4985308_4986076_+|head	phage head protein	head	A0A0S2MVF0	Bacillus_phage	94.1	2.7e-136
WP_172853004.1|4986148_4986859_+	DUF4355 domain-containing protein	NA	A0A0A7AQU8	Bacillus_phage	69.9	2.4e-70
WP_071730467.1|4986967_4987813_+	hypothetical protein	NA	A0A0S2MVF8	Bacillus_phage	96.8	1.2e-150
WP_098284890.1|4987856_4988165_+	hypothetical protein	NA	A0A0A7AQX9	Bacillus_phage	92.2	6.4e-49
WP_172853005.1|4988161_4988509_+|head,tail	head-tail adaptor protein	head,tail	A0A0S2MVD7	Bacillus_phage	90.4	5.2e-55
WP_097879993.1|4988483_4988891_+	HK97 gp10 family phage protein	NA	A0A0A7AQU9	Bacillus_phage	94.8	3.4e-66
WP_098430317.1|4988896_4989259_+	hypothetical protein	NA	A0A0A7AQF9	Bacillus_phage	92.5	1.5e-60
WP_071730458.1|4989273_4989867_+	hypothetical protein	NA	A0A0S2MV81	Bacillus_phage	97.0	1.3e-106
WP_172853006.1|4989913_4990342_+	hypothetical protein	NA	A0A0S2MV94	Bacillus_phage	94.4	1.1e-67
WP_000375621.1|4990446_4990653_+	hypothetical protein	NA	A0A0S2MV68	Bacillus_phage	98.5	2.1e-32
WP_172853007.1|4993576_4995058_+|tail	phage tail family protein	tail	A0A0S2MV63	Bacillus_phage	87.8	4.5e-265
WP_172853008.1|4995054_4999362_+	hypothetical protein	NA	A0A0S2MVB4	Bacillus_phage	63.3	0.0e+00
WP_172853009.1|4999378_4999756_+	hypothetical protein	NA	A0A0S2MVE0	Bacillus_phage	64.0	6.0e-41
WP_000390479.1|4999883_5000108_+	hypothetical protein	NA	A0A1B1P780	Bacillus_phage	89.2	8.5e-27
WP_172853010.1|5000182_5000590_+|holin	phage holin family protein	holin	A0A0S2MVC4	Bacillus_phage	88.6	7.4e-61
WP_172853011.1|5000608_5001418_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	90.0	5.8e-150
WP_172853012.1|5001872_5002085_+	alpha/beta-type small acid-soluble spore protein	NA	Q77YX0	Bacillus_phage	66.2	6.4e-16
WP_172853013.1|5002361_5002877_+	DUF3231 family protein	NA	NA	NA	NA	NA
WP_172853014.1|5002909_5003392_-	YndM family protein	NA	NA	NA	NA	NA
WP_000069660.1|5003667_5003880_+	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	68.3	1.6e-14
>prophage 10
NZ_CP053954	Bacillus cereus strain FDAARGOS_798 chromosome, complete genome	5381410	5042706	5047943	5381410		Bacillus_phage(50.0%)	9	NA	NA
WP_001139345.1|5042706_5042922_-	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	83.8	3.4e-25
WP_000369348.1|5043158_5043290_+	DUF3983 domain-containing protein	NA	A0A1B1P7V8	Bacillus_phage	79.1	2.9e-11
WP_000097509.1|5043654_5044455_+	C1 family peptidase	NA	A0A2K9L1Z4	Tupanvirus	37.2	1.0e-37
WP_172853023.1|5044474_5044687_+	hypothetical protein	NA	NA	NA	NA	NA
WP_002061469.1|5044751_5044952_+	N-acetylmuramoyl-L-alanine amidase	NA	D2XR33	Bacillus_phage	90.9	1.0e-15
WP_172853024.1|5045089_5045971_-	serine/threonine protein kinase	NA	NA	NA	NA	NA
WP_000372690.1|5046098_5046608_+	GrpB family protein	NA	A0A2K5B2B6	Erysipelothrix_phage	36.0	1.4e-16
WP_000411453.1|5046725_5047256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001163828.1|5047268_5047943_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	30.7	2.8e-28
>prophage 1
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	0	23550	480092		Clostridioides_phage(100.0%)	14	NA	NA
WP_172852148.1|3967_4906_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_172851998.1|4939_8266_-	ACP S-malonyltransferase	NA	NA	NA	NA	NA
WP_172851999.1|8667_9342_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_172852000.1|9622_10330_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_172852001.1|11709_11988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098281600.1|12871_13150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852002.1|14136_14628_+	CDP-diacylglycerol--serine O-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_172852003.1|16908_17202_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172852004.1|18401_18815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852005.1|19354_19648_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_025690082.1|20446_20647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_166695587.1|21555_21714_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852149.1|21864_22590_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_172852006.1|22911_23550_-	NERD domain-containing protein	NA	A0A2R2ZH57	Clostridioides_phage	36.1	3.7e-22
>prophage 2
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	29488	31102	480092		Bacillus_phage(100.0%)	1	NA	NA
WP_172852150.1|29488_31102_-	S-layer homology domain-containing protein	NA	A0A1J0MS59	Bacillus_phage	54.9	5.1e-44
>prophage 3
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	36719	38741	480092		Lactococcus_phage(50.0%)	2	NA	NA
WP_098382198.1|36719_37697_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	C3U2M1	Lactococcus_phage	29.5	5.8e-27
WP_063549877.1|37808_38741_-	ornithine carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	27.8	1.6e-18
>prophage 4
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	42339	72370	480092		Tupanvirus(66.67%)	11	NA	NA
WP_097797323.1|42339_43665_-	DegT/DnrJ/EryC1/StrS family aminotransferase	NA	E5ES42	Bathycoccus_sp._RCC1105_virus	29.7	1.5e-30
WP_097797324.1|43763_44753_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_172852015.1|44886_45585_-	4'-phosphopantetheinyl transferase superfamily protein	NA	NA	NA	NA	NA
WP_098558716.1|45827_52364_-	non-ribosomal peptide synthetase	NA	A0A2K9KZV5	Tupanvirus	29.3	1.0e-180
WP_002001177.1|52606_53326_-	thioesterase	NA	NA	NA	NA	NA
WP_172852016.1|53381_57878_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	27.7	2.9e-81
WP_000031543.1|57859_58939_-	HAD-IIIC family phosphatase	NA	NA	NA	NA	NA
WP_098382204.1|58935_62019_-	cyclic peptide export ABC transporter	NA	A0A2P1JQM9	Mycobacterium_phage	28.1	3.7e-11
WP_172852017.1|62034_63111_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_172852018.1|63129_70818_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	26.2	1.6e-95
WP_098326486.1|70792_72370_-	amino acid adenylation domain-containing protein	NA	A0A2K9L3I8	Tupanvirus	32.5	8.9e-70
>prophage 5
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	81496	97263	480092		Tupanvirus(50.0%)	2	NA	NA
WP_172852020.1|81496_87220_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	27.5	1.0e-168
WP_172852021.1|87246_97263_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	35.2	7.9e-63
>prophage 6
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	106468	107809	480092	transposase	Bacillus_phage(100.0%)	1	NA	NA
WP_172852024.1|106468_107809_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	37.3	6.3e-32
>prophage 7
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	113122	115149	480092		Spodoptera_litura_multicapsid_nucleopolyhedrovirus(50.0%)	2	NA	NA
WP_088361292.1|113122_114325_-	glycosyl transferase	NA	B0LUM8	Spodoptera_litura_multicapsid_nucleopolyhedrovirus	28.0	5.1e-09
WP_000627284.1|114618_115149_+	GNAT family N-acetyltransferase	NA	G9BWD5	Planktothrix_phage	28.6	4.3e-08
>prophage 8
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	124288	139852	480092		Tupanvirus(25.0%)	7	NA	NA
WP_172852025.1|124288_131881_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	27.8	3.0e-163
WP_061663542.1|132246_133173_+	aldo/keto reductase	NA	NA	NA	NA	NA
WP_172852026.1|133657_135313_+	aspartate aminotransferase family protein	NA	M1HWX9	Paramecium_bursaria_Chlorella_virus	31.1	1.6e-05
WP_172852027.1|135422_136067_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098318373.1|136912_137323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098472376.1|137415_137613_-	helix-turn-helix transcriptional regulator	NA	A0A142LP09	Marinitoga_camini_virus	44.1	7.3e-06
WP_098879987.1|138604_139852_-	DNA (cytosine-5-)-methyltransferase	NA	Q7Y4B5	Escherichia_virus	36.3	2.8e-50
>prophage 9
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	147162	154532	480092		Tupanvirus(50.0%)	3	NA	NA
WP_172852029.1|147162_148575_-	AAA family ATPase	NA	A0A2K9L1W7	Tupanvirus	27.2	1.5e-07
WP_172851995.1|148625_148811_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852030.1|151445_154532_-	UvrD-helicase domain-containing protein	NA	A0A068EQC7	Bacillus_phage	27.5	9.7e-20
>prophage 10
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	163720	166190	480092	transposase	Paenibacillus_phage(50.0%)	3	NA	NA
WP_087874946.1|163720_164880_-|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.0	2.5e-37
WP_000709205.1|164994_165120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852033.1|165116_166190_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	42.0	1.1e-71
>prophage 11
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	173159	177626	480092		Bacillus_phage(50.0%)	7	NA	NA
WP_001043942.1|173159_173432_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	67.8	2.8e-24
WP_002001785.1|173609_173849_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000713970.1|173871_174666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102956951.1|174855_175014_-	Phr family secreted Rap phosphatase inhibitor	NA	NA	NA	NA	NA
WP_172852037.1|175013_176105_-	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	50.1	2.3e-96
WP_097797373.1|176689_177202_+	damage repair protein	NA	O64031	Bacillus_phage	45.6	3.7e-33
WP_001158653.1|177251_177626_+	hypothetical protein	NA	D2XQ01	Bacillus_virus	46.6	1.9e-26
>prophage 12
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	188710	190537	480092		Hokovirus(100.0%)	1	NA	NA
WP_172852039.1|188710_190537_-	asparagine synthase (glutamine-hydrolyzing)	NA	A0A1V0SGM7	Hokovirus	27.3	2.4e-34
>prophage 13
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	197872	201705	480092		Bacillus_phage(66.67%)	3	NA	NA
WP_098281487.1|197872_199042_-	serine hydrolase	NA	A0A1D8EXR7	Mycobacterium_phage	29.0	7.2e-24
WP_098281482.1|199601_200999_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	28.0	1.6e-25
WP_098281481.1|200988_201705_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.7	1.1e-35
>prophage 14
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	205112	302922	480092	transposase,protease	Bacillus_phage(60.0%)	80	NA	NA
WP_172852041.1|205112_205277_+	hypothetical protein	NA	A0A1B0T6B0	Bacillus_phage	65.4	9.4e-07
WP_086411729.1|205609_206053_-	DUF5065 family protein	NA	NA	NA	NA	NA
WP_172852042.1|206696_207272_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098281479.1|207592_208648_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A1B0T6C8	Bacillus_phage	71.8	1.2e-150
WP_000570185.1|208644_208884_-	hypothetical protein	NA	A0A0A7AR38	Bacillus_phage	75.9	2.7e-26
WP_021728083.1|208883_209120_-	hemolysin XhlA family protein	NA	A0A288WG97	Bacillus_phage	88.9	6.1e-15
WP_098281478.1|209811_210696_-	N-acetylmuramoyl-L-alanine amidase family protein	NA	A0A0S2MVR5	Bacillus_phage	51.8	1.6e-76
WP_098281477.1|210968_211790_-	M23 family metallopeptidase	NA	A0A218KCJ1	Bacillus_phage	43.8	1.2e-28
WP_061884948.1|211931_212900_-	lysozyme family protein	NA	A0A223LKM8	Bacillus_phage	41.7	4.5e-32
WP_000460733.1|213137_213524_-	hypothetical protein	NA	A0A288WG73	Bacillus_phage	69.8	2.6e-47
WP_172852043.1|214595_214832_-	helix-turn-helix transcriptional regulator	NA	W8CYU0	Bacillus_phage	58.2	6.3e-12
WP_000579788.1|214968_215397_+	helix-turn-helix transcriptional regulator	NA	Q786F1	Bacillus_phage	51.4	9.3e-30
WP_098281474.1|215419_215848_+	ImmA/IrrE family metallo-endopeptidase	NA	Q9T201	Bacillus_phage	55.1	2.8e-34
WP_098281473.1|216119_216647_-	ester cyclase	NA	NA	NA	NA	NA
WP_042889832.1|216806_217199_-	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_098281472.1|217203_218025_-	cytoplasmic protein	NA	F2NZ47	Diadromus_pulchellus_ascovirus	30.3	5.0e-24
WP_098281471.1|218197_218818_-	DsbA family protein	NA	NA	NA	NA	NA
WP_098281470.1|219524_220838_-	HlyD family efflux transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_098281469.1|220830_223050_-	peptidase domain-containing ABC transporter	NA	W8CYL7	Bacillus_phage	29.5	1.0e-47
WP_098281468.1|223214_223415_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098281467.1|223497_223989_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_165613739.1|224368_224521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098281466.1|224900_225896_-	DUF4065 domain-containing protein	NA	NA	NA	NA	NA
WP_170962695.1|225936_226368_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098402776.1|227184_228555_-	M23 family metallopeptidase	NA	D7RWE0	Brochothrix_phage	42.6	4.3e-20
WP_172852044.1|228764_230105_-	C40 family peptidase	NA	A0A0A8WF62	Clostridium_phage	39.8	3.1e-15
WP_172852045.1|230167_231430_-	3D domain-containing protein	NA	M4HQ50	Bacillus_phage	44.8	3.5e-24
WP_061663378.1|231675_231945_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_098280861.1|232242_233337_+	tetratricopeptide repeat protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	49.6	4.0e-93
WP_170962688.1|233529_233691_-	hypothetical protein	NA	NA	NA	NA	NA
WP_098280862.1|234184_234604_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001167049.1|234673_234889_-	alpha/beta-type small acid-soluble spore protein	NA	A0A1P8CX76	Bacillus_phage	70.1	1.7e-19
WP_172852046.1|235055_236798_-	HAMP domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	39.8	4.1e-07
WP_172852047.1|237786_238266_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_172852151.1|238419_238527_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852048.1|238984_239395_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000787540.1|239808_240222_-	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_065705218.1|240211_240619_-	nucleotidyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_172852049.1|240988_241336_-	YxeA family protein	NA	A0A0K2CYS5	Paenibacillus_phage	37.8	1.3e-10
WP_172852050.1|241764_241953_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172852051.1|242247_244938_-	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	23.7	3.7e-39
WP_172852052.1|245337_246666_-	magnesium transporter	NA	NA	NA	NA	NA
WP_172852053.1|246927_247395_+	RsfA family transcriptional regulator	NA	NA	NA	NA	NA
WP_172852054.1|247556_249254_-	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_172852055.1|251404_253114_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000798819.1|255403_255814_-	HEPN domain-containing protein	NA	NA	NA	NA	NA
WP_172852056.1|257548_258316_-	PH domain-containing protein	NA	I3VYV9	Thermoanaerobacterium_phage	27.5	1.0e-10
WP_000633813.1|258509_258794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002164669.1|259612_259900_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852152.1|260115_261027_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852057.1|266279_267557_-	replication-relaxation family protein	NA	NA	NA	NA	NA
WP_001006726.1|269271_269694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852058.1|269698_271153_+	cell division protein FtsZ	NA	NA	NA	NA	NA
WP_172852059.1|271187_271928_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172852060.1|275474_275612_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_172851997.1|276351_276501_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852153.1|279298_279763_+	redoxin domain-containing protein	NA	NA	NA	NA	NA
WP_172852061.1|279776_280223_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852062.1|280726_281170_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167319656.1|281166_281601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852063.1|282842_284663_+	ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.8	5.7e-20
WP_172852154.1|286909_287839_-|transposase	IS3 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	43.0	9.1e-38
WP_172852064.1|287760_288069_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_172852065.1|288703_288814_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_172852066.1|289009_289432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852155.1|289814_290093_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172852067.1|290306_290462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852068.1|290735_290861_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_172852069.1|291606_291903_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852070.1|293293_293776_-	thioredoxin family protein	NA	NA	NA	NA	NA
WP_153594324.1|294431_295091_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852071.1|295536_295767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852072.1|295956_296331_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	51.3	1.2e-28
WP_172852073.1|296378_296720_-	YolD-like family protein	NA	A0A1Q1PW34	Staphylococcus_phage	31.4	6.1e-08
WP_172852074.1|296716_297982_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.3	1.2e-101
WP_130067921.1|298825_298966_-|transposase	Tn3 family transposase	transposase	NA	NA	NA	NA
WP_001281108.1|299097_299793_+	VanA-type vancomycin resistance DNA-binding response regulator VanR	NA	W8CYM9	Bacillus_phage	37.7	1.3e-36
WP_172852075.1|299782_300937_+	vancomycin resistance histidine kinase VanS	NA	W8CYF6	Bacillus_phage	24.1	3.2e-16
WP_172852156.1|301394_301610_+	D-alanyl-D-alanine carboxypeptidase	NA	NA	NA	NA	NA
WP_172852076.1|301803_302922_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.7	6.1e-174
>prophage 15
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	309444	310614	480092		Mycobacterium_phage(100.0%)	1	NA	NA
WP_172852080.1|309444_310614_+	beta-lactamase family protein	NA	X2KYU1	Mycobacterium_phage	30.3	6.5e-17
>prophage 16
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	314511	328320	480092	transposase	Erysipelothrix_phage(16.67%)	8	NA	NA
WP_172852084.1|314511_315780_+	MFS transporter	NA	A0A2K5B2B5	Erysipelothrix_phage	26.9	1.7e-15
WP_172852157.1|316427_316661_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852085.1|317214_317757_+	stress protein	NA	NA	NA	NA	NA
WP_172852158.1|318665_319832_+	beta-lactamase family protein	NA	G1DB24	Mycobacterium_phage	28.6	4.6e-23
WP_172852159.1|320295_322380_+	beta-lactamase family protein	NA	A0A1V0SLG8	Klosneuvirus	23.4	1.9e-06
WP_172852086.1|323118_324237_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	81.7	1.0e-173
WP_172852087.1|325768_326719_-	class A beta-lactamase	NA	A0A1B0VBP7	Salmonella_phage	44.1	1.9e-54
WP_172852088.1|327549_328320_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.5	4.3e-33
>prophage 17
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	334785	344097	480092		Bacillus_phage(33.33%)	8	NA	NA
WP_172852093.1|334785_335472_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.0	1.0e-41
WP_172852094.1|335468_336545_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	29.2	3.2e-18
WP_172852095.1|336826_337588_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.7	4.1e-36
WP_172852096.1|337604_339467_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_172852097.1|339740_340724_+	FAD-binding protein	NA	S4VRT3	Pandoravirus	27.6	1.0e-15
WP_172852098.1|341493_342198_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_172852099.1|342197_343184_+	sensor histidine kinase	NA	A0A1V0SGX0	Hokovirus	24.9	6.7e-07
WP_172852100.1|343308_344097_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	40.4	1.4e-31
>prophage 18
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	354535	355708	480092	integrase	Lactobacillus_prophage(100.0%)	1	344574:344592	355804:355822
344574:344592	attL	TATTTTTATTTATTTCCCT	NA	NA	NA	NA
WP_172852107.1|354535_355708_+|integrase	site-specific integrase	integrase	Q6SEG4	Lactobacillus_prophage	26.9	9.8e-05
WP_172852107.1|354535_355708_+|integrase	site-specific integrase	integrase	Q6SEG4	Lactobacillus_prophage	26.9	9.8e-05
355804:355822	attR	AGGGAAATAAATAAAAATA	NA	NA	NA	NA
>prophage 19
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	359557	361285	480092		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_172852110.1|359557_361285_+	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	64.1	1.5e-09
>prophage 20
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	369074	370799	480092		Yellowstone_lake_phycodnavirus(100.0%)	1	NA	NA
WP_172852115.1|369074_370799_+	alpha-keto acid decarboxylase family protein	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	23.4	2.4e-20
>prophage 21
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	385010	385997	480092		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_172852125.1|385010_385997_+	choloylglycine hydrolase family protein	NA	A7IWP6	Paramecium_bursaria_Chlorella_virus	29.2	1.1e-30
>prophage 22
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	389398	389602	480092		Lactococcus_phage(100.0%)	1	NA	NA
WP_000410775.1|389398_389602_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	63.6	1.5e-17
>prophage 23
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	400373	404930	480092		Brevibacillus_phage(50.0%)	2	NA	NA
WP_172852133.1|400373_401447_-	tyrosine recombinase XerS	NA	A0A0K2CP59	Brevibacillus_phage	24.8	3.9e-08
WP_172852134.1|402683_404930_-	peptidase domain-containing ABC transporter	NA	F2Y2R6	Organic_Lake_phycodnavirus	34.1	3.4e-22
>prophage 24
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	410543	414370	480092		Bacillus_phage(50.0%)	5	NA	NA
WP_098280505.1|410543_411257_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	41.2	7.4e-40
WP_172852136.1|411586_411937_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000830528.1|411959_412691_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_172852137.1|412703_413456_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_172852163.1|413452_414370_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	43.3	1.7e-44
>prophage 25
NZ_CP053952	Bacillus cereus strain FDAARGOS_798 plasmid unnamed1, complete sequence	480092	423321	478024	480092		Paenibacillus_phage(100.0%)	6	NA	NA
WP_172852141.1|423321_432279_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	31.3	3.1e-42
WP_172852142.1|432271_437119_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	30.0	1.7e-34
WP_172852143.1|437115_450867_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	32.8	1.1e-35
WP_172852144.1|450863_460640_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	29.8	1.1e-35
WP_172852145.1|460632_475005_-	SDR family NAD(P)-dependent oxidoreductase	NA	D0R7J2	Paenibacillus_phage	30.4	5.7e-38
WP_172852146.1|474997_478024_-	polyketide synthase dehydratase domain-containing protein	NA	D0R7J2	Paenibacillus_phage	33.1	5.6e-36
>prophage 1
NZ_CP053953	Bacillus cereus strain FDAARGOS_798 plasmid unnamed2, complete sequence	328123	35493	84351	328123	integrase,protease,transposase	Bacillus_phage(54.55%)	44	67874:67896	90033:90055
WP_172852188.1|35493_36039_-|integrase	tyrosine-type recombinase/integrase	integrase	D2XR58	Bacillus_phage	43.9	5.9e-29
WP_172852189.1|36756_36900_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852190.1|38136_38880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852378.1|39128_39398_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	41.4	2.9e-13
WP_172852191.1|40173_40566_+	gamma-type small acid-soluble spore protein	NA	NA	NA	NA	NA
WP_172852192.1|42979_43366_+	ArpU family transcriptional regulator	NA	D2XQ27	Bacillus_virus	96.1	3.2e-61
WP_172852193.1|44740_45229_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852194.1|45612_45780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852195.1|46189_46462_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000376550.1|46590_46728_-	DUF3956 domain-containing protein	NA	NA	NA	NA	NA
WP_172852196.1|47217_47865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852379.1|48170_48902_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852197.1|48951_49275_+	hypothetical protein	NA	NA	NA	NA	NA
WP_167319661.1|50326_50446_+	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_172852198.1|50986_51184_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852199.1|51656_52217_-	recombinase family protein	NA	A0A219YB42	Aeromonas_phage	41.5	2.7e-29
WP_172852200.1|54223_54751_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_172852201.1|55366_55960_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172852202.1|55987_57238_+	MFS transporter	NA	NA	NA	NA	NA
WP_172852203.1|57708_58152_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852204.1|58865_59984_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172852381.1|60097_60751_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_172852205.1|60782_61706_+	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_172852206.1|62181_62688_-	DinB family protein	NA	NA	NA	NA	NA
WP_172852207.1|63409_64786_-	alpha/beta fold hydrolase	NA	NA	NA	NA	NA
WP_172852208.1|65141_65825_+	hypothetical protein	NA	A0A0A7AR45	Bacillus_phage	41.6	1.0e-38
WP_172852209.1|66379_66502_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_172852210.1|66938_67103_-	YjcZ family sporulation protein	NA	NA	NA	NA	NA
WP_000516897.1|67462_67786_-|transposase	transposase	transposase	NA	NA	NA	NA
67874:67896	attL	TAGGAAAGGATGGCGTTTTTTAT	NA	NA	NA	NA
WP_172852211.1|68307_69582_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_063549519.1|70049_70301_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063549517.1|70483_70933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852212.1|71225_71600_-	hypothetical protein	NA	D2XQ01	Bacillus_virus	47.1	2.9e-27
WP_172852213.1|71646_71955_-	YolD-like family protein	NA	NA	NA	NA	NA
WP_172852214.1|71983_73249_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	46.6	1.1e-102
WP_137050358.1|73530_74690_-|transposase	IS3-like element ISBth8 family transposase	transposase	A0A0C5AEA5	Paenibacillus_phage	42.5	1.9e-37
WP_172852215.1|75219_76095_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172852383.1|76242_77052_+	YitT family protein	NA	NA	NA	NA	NA
WP_172852216.1|77368_78685_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_001043945.1|79904_80177_-	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	70.0	3.3e-25
WP_172852384.1|80423_80618_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852217.1|82188_82515_-	helix-turn-helix transcriptional regulator	NA	A0A0A7AQV8	Bacillus_phage	50.0	1.4e-22
WP_172852218.1|82727_83771_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0E3T6D9	Bacillus_phage	23.1	4.9e-08
WP_172852219.1|84000_84351_+|transposase	transposase	transposase	NA	NA	NA	NA
90033:90055	attR	TAGGAAAGGATGGCGTTTTTTAT	NA	NA	NA	NA
>prophage 2
NZ_CP053953	Bacillus cereus strain FDAARGOS_798 plasmid unnamed2, complete sequence	328123	109937	218091	328123	integrase,transposase	Bacillus_phage(39.13%)	97	211748:211765	219753:219770
WP_172852232.1|109937_110255_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_172852233.1|110284_110734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852234.1|110964_111105_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852235.1|111295_111481_+	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_172852236.1|111968_112853_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	33.2	4.1e-32
WP_172852237.1|112896_113604_-|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	9.3e-43
WP_172852387.1|113754_115641_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_172852238.1|115657_116419_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.4	4.2e-33
WP_172852239.1|116475_117516_-	DUF418 domain-containing protein	NA	NA	NA	NA	NA
WP_131252118.1|117613_117982_-	YxeA family protein	NA	NA	NA	NA	NA
WP_172852240.1|118645_118822_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852241.1|119057_119171_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_172852237.1|119250_119958_+|transposase	IS6 family transposase	transposase	A0A1X9I6C6	Streptococcus_phage	41.7	9.3e-43
WP_172852242.1|120435_121233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852243.1|121685_122759_+	hypothetical protein	NA	A0A2H4J8G3	uncultured_Caudovirales_phage	42.0	6.3e-75
WP_000976103.1|122755_122911_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852389.1|123128_123647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852391.1|123911_124178_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016078679.1|124566_124860_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172852244.1|124945_125380_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_172852245.1|125422_125710_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852246.1|125787_125988_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852247.1|126039_126684_-	thermonuclease family protein	NA	A0A2P1JU10	Anoxybacillus_phage	31.0	4.1e-05
WP_172852248.1|128041_128752_-	conjugal transfer protein TraX	NA	NA	NA	NA	NA
WP_172852249.1|128981_130829_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_172852250.1|130818_131580_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.5	3.8e-26
WP_172852251.1|131695_132691_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_172852252.1|132687_133380_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	29.6	2.7e-23
WP_172852253.1|133926_135342_-	peptidase M56	NA	NA	NA	NA	NA
WP_172852254.1|135344_135743_-	BlaI/MecI/CopY family transcriptional regulator	NA	NA	NA	NA	NA
WP_172852255.1|136103_136943_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_172852256.1|137381_138386_-	VanZ family protein	NA	NA	NA	NA	NA
WP_172852165.1|138542_138785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852257.1|139922_141353_-|transposase	IS4-like element ISBce10 family transposase	transposase	NA	NA	NA	NA
WP_000956453.1|141555_141750_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000040564.1|141749_142211_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852258.1|142997_144425_-	beta-lactamase family protein	NA	A0A2P1JR59	Mycobacterium_phage	23.2	1.8e-08
WP_172852259.1|144882_145539_-	GAP family protein	NA	NA	NA	NA	NA
WP_172852260.1|145552_146311_-	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_113734020.1|146986_147538_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_172852261.1|148139_148784_-	YitT family protein	NA	NA	NA	NA	NA
WP_172852262.1|149146_150388_-	allantoate deiminase	NA	NA	NA	NA	NA
WP_172852263.1|150513_151785_-	MFS transporter	NA	NA	NA	NA	NA
WP_172852264.1|152240_153863_+	PucR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172852265.1|154309_155542_+	cytochrome P450	NA	A0A2I2L481	Orpheovirus	27.7	3.2e-06
WP_141528530.1|155903_157334_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_172852266.1|157607_159038_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_141528530.1|159610_161041_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_172852267.1|161359_161653_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172852268.1|161752_162163_-	disulfide bond formation protein B	NA	NA	NA	NA	NA
WP_001996145.1|162205_162493_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088021417.1|162569_162770_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852269.1|162821_163466_-	thermonuclease family protein	NA	A0A2P1JU10	Anoxybacillus_phage	38.6	7.0e-05
WP_172852270.1|164367_165252_-|transposase	PD-(D/E)XK nuclease family transposase	transposase	NA	NA	NA	NA
WP_172852271.1|165677_166718_+	methyltransferase domain-containing protein	NA	NA	NA	NA	NA
WP_172852272.1|166770_168183_+	tyrosine phenol-lyase	NA	NA	NA	NA	NA
WP_172852273.1|168735_169632_-|transposase	PD-(D/E)XK nuclease family transposase	transposase	NA	NA	NA	NA
WP_172852274.1|170608_171781_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852393.1|172038_172740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852275.1|173459_174233_+	DUF4393 domain-containing protein	NA	A0A0M4RU42	Bacillus_phage	56.1	2.0e-51
WP_172852276.1|174522_174669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852277.1|174864_175065_-	hypothetical protein	NA	A0A0A7AQJ2	Bacillus_phage	98.5	6.2e-29
WP_116345108.1|176290_176629_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852278.1|176689_177076_-	ArpU family transcriptional regulator	NA	A0A1B1P853	Bacillus_phage	44.0	2.2e-22
WP_172852279.1|177214_177832_-	Holliday junction resolvase RecU	NA	A0A2H4J3A4	uncultured_Caudovirales_phage	60.7	2.2e-48
WP_172852280.1|178813_179029_+	spore germination protein	NA	A0A2H4J3A3	uncultured_Caudovirales_phage	94.4	1.8e-29
WP_172852281.1|179596_179770_-	hypothetical protein	NA	I7J6W4	Bacillus_phage	51.9	7.6e-07
WP_172852282.1|180904_182734_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.5	9.4e-47
WP_172852283.1|182726_184490_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	26.9	7.0e-39
WP_172852284.1|184615_185239_-	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172852285.1|185644_186388_-	GTP pyrophosphokinase family protein	NA	F8K9M7	Nitrososphaera_phage	27.6	2.1e-08
WP_172852395.1|186884_186968_+	DUF3955 domain-containing protein	NA	NA	NA	NA	NA
WP_172852286.1|187189_187780_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_172852287.1|187993_189508_+	DHA2 family efflux MFS transporter permease subunit	NA	NA	NA	NA	NA
WP_172852288.1|189674_190937_+	cytochrome P450	NA	NA	NA	NA	NA
WP_172852289.1|191367_192513_-	metallophosphoesterase	NA	NA	NA	NA	NA
WP_153218695.1|195442_196039_-	TetR/AcrR family transcriptional regulator C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_172852290.1|196511_197282_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_172852291.1|197358_198870_+	DHA2 family efflux MFS transporter permease subunit	NA	A0A0M3UL24	Mycobacterium_phage	27.7	7.1e-24
WP_172852292.1|200034_200418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852293.1|200543_201128_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852396.1|201147_201726_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852294.1|201776_202412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852295.1|202411_203041_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852296.1|203359_204073_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_172852297.1|204176_204320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852298.1|204335_204749_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852299.1|205890_206358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172852300.1|206830_208525_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_002204018.1|208910_209108_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_172852301.1|209134_209461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852302.1|209526_209715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852303.1|210456_211575_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	S6AND0	Bacillus_phage	80.9	3.2e-170
211748:211765	attL	TTGAGGAAGGAGTCTTCT	NA	NA	NA	NA
WP_172852304.1|211988_212405_+	alpha-ketoglutarate permease	NA	NA	NA	NA	NA
WP_172852305.1|212696_212855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852306.1|214211_215921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172852307.1|217143_218091_+|integrase	site-specific integrase	integrase	A0A1B1P793	Bacillus_phage	30.7	2.3e-36
219753:219770	attR	AGAAGACTCCTTCCTCAA	NA	NA	NA	NA
