The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP047609	Escherichia coli strain NMBU_ W06E18 chromosome, complete genome	5248629	54930	119723	5248629	protease,transposase,plate,tRNA	Bacillus_phage(40.0%)	52	NA	NA
WP_001520514.1|54930_56355_+|protease	serine endoprotease DegP	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.8	2.5e-26
WP_000929439.1|56509_57667_+	DNA-binding transcriptional regulator CdaR	NA	NA	NA	NA	NA
WP_000272188.1|57720_58107_-	DUF3461 family protein	NA	NA	NA	NA	NA
WP_001186656.1|58420_59245_-	2,3,4,5-tetrahydropyridine-2,6-dicarboxylate N-succinyltransferase	NA	NA	NA	NA	NA
WP_021523000.1|59275_61948_-	bifunctional uridylyltransferase/uridylyl-removing protein GlnD	NA	NA	NA	NA	NA
WP_001018194.1|62009_62804_-	type I methionyl aminopeptidase	NA	NA	NA	NA	NA
WP_000246882.1|63171_63897_+	30S ribosomal protein S2	NA	NA	NA	NA	NA
WP_000818114.1|64154_65006_+	elongation factor Ts	NA	NA	NA	NA	NA
WP_000224573.1|65152_65878_+	UMP kinase	NA	NA	NA	NA	NA
WP_000622418.1|66169_66727_+	ribosome recycling factor	NA	NA	NA	NA	NA
WP_001589702.1|66818_68015_+	1-deoxy-D-xylulose-5-phosphate reductoisomerase	NA	NA	NA	NA	NA
WP_001520518.1|68203_68962_+	(2E,6E)-farnesyl-diphosphate-specific ditrans,polycis-undecaprenyl-diphosphate synthase	NA	R9W0U9	Flavobacterium_phage	44.4	7.7e-27
WP_020233386.1|68974_69832_+	phosphatidate cytidylyltransferase	NA	NA	NA	NA	NA
WP_001520521.1|69843_71196_+|protease	sigma E protease regulator RseP	protease	NA	NA	NA	NA
WP_001240896.1|71225_73658_+	outer membrane protein assembly factor BamA	NA	NA	NA	NA	NA
WP_000758956.1|73779_74265_+	molecular chaperone Skp	NA	NA	NA	NA	NA
WP_001139282.1|74268_75294_+	UDP-3-O-(3-hydroxymyristoyl)glucosamine N-acyltransferase	NA	NA	NA	NA	NA
WP_000210739.1|75398_75854_+	3-hydroxyacyl-ACP dehydratase FabZ	NA	NA	NA	NA	NA
WP_000565966.1|75857_76646_+	acyl-ACP--UDP-N-acetylglucosamine O-acyltransferase	NA	NA	NA	NA	NA
WP_000139675.1|76645_77794_+	lipid-A-disaccharide synthase	NA	NA	NA	NA	NA
WP_000569434.1|77790_78387_+	ribonuclease HII	NA	V5LS49	Emiliania_huxleyi_virus	40.0	2.3e-26
WP_001520523.1|78423_81906_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.0	1.7e-209
WP_000055748.1|81918_82878_+	acetyl-CoA carboxylase carboxyl transferase subunit alpha	NA	NA	NA	NA	NA
WP_001020973.1|82975_85117_+	lysine decarboxylase LdcC	NA	NA	NA	NA	NA
WP_000901098.1|85173_85563_+	VOC family protein	NA	NA	NA	NA	NA
WP_001520525.1|85627_86926_+|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_000062315.1|86974_87235_-	Rho-binding antiterminator	NA	NA	NA	NA	NA
WP_000417058.1|87221_87422_-	YaeP family protein	NA	NA	NA	NA	NA
WP_001185283.1|87587_88133_+	YaeQ family protein	NA	NA	NA	NA	NA
WP_000635534.1|88129_88552_+|tRNA	aminoacyl-tRNA hydrolase	tRNA	NA	NA	NA	NA
WP_001520527.1|88565_89276_+	envelope stress response activation lipoprotein NlpE	NA	NA	NA	NA	NA
WP_100222095.1|90359_91708_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	52.4	1.0e-74
WP_001695489.1|91861_93046_-	MFS transporter AraJ	NA	NA	NA	NA	NA
WP_172986626.1|93171_96315_-	exonuclease subunit SbcC	NA	G3MAB6	Bacillus_virus	26.9	5.8e-12
WP_001521994.1|96311_97514_-	exonuclease subunit SbcD	NA	R4JGS2	Bacillus_phage	32.4	2.4e-06
WP_000113933.1|97703_98393_+	phosphate response regulator transcription factor PhoB	NA	W8CYM9	Bacillus_phage	38.0	4.4e-37
WP_000893603.1|98450_99746_+	phosphate regulon sensor histidine kinase PhoR	NA	W8CYF6	Bacillus_phage	30.8	1.3e-26
WP_001086163.1|100098_100884_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001521857.1|101032_101500_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000908071.1|101509_102424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000002621.1|102467_102950_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001087587.1|102973_104326_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_122452236.1|104336_107771_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_001240537.1|107879_109292_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_000088867.1|109296_110040_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_172986627.1|110036_112892_-	AAA family ATPase	NA	A0A1C3S747	Escherichia_phage	29.3	8.6e-79
WP_001521863.1|112900_113662_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_000246418.1|113666_114998_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_001080149.1|115000_115525_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_001550643.1|115521_116802_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_000348804.1|116826_117909_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001521865.1|117872_119723_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
>prophage 2
NZ_CP047609	Escherichia coli strain NMBU_ W06E18 chromosome, complete genome	5248629	814622	912914	5248629	holin,terminase,integrase,capsid,head,lysis,tRNA,tail,portal,protease,plate	Escherichia_phage(38.98%)	90	827809:827824	865880:865895
WP_000520781.1|814622_814943_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_000934041.1|814973_817250_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_001040187.1|817955_818174_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_001241678.1|818458_819163_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_172986630.1|819204_820926_-	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.2	2.2e-21
WP_001043595.1|820926_822693_-	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	7.0e-23
WP_001522752.1|822815_823781_-	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_000228473.1|824325_824820_+	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_001522753.1|824954_829022_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
827809:827824	attL	AAGTTATTCCTGGCAA	NA	NA	NA	NA
WP_001522754.1|829180_829792_+	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_000067755.1|829802_831146_+	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	40.8	2.1e-80
WP_000886683.1|831236_832529_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000850305.1|832767_835212_+	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	5.0e-221
WP_000213098.1|835222_835840_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000534633.1|835841_836705_+	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_001522756.1|836740_837367_-	hydrolase	NA	NA	NA	NA	NA
WP_000109288.1|837681_838830_+	MFS transporter	NA	NA	NA	NA	NA
WP_000918505.1|839039_840470_+	amino acid permease	NA	NA	NA	NA	NA
WP_000067977.1|840679_841477_-	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.6	1.3e-21
WP_000023391.1|841508_842504_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	99.7	7.1e-190
WP_000072552.1|842597_842909_-	helix-turn-helix transcriptional regulator	NA	Q1JS25	Enterobacteria_phage	100.0	4.3e-53
WP_000022051.1|843013_843370_+	hypothetical protein	NA	A0A0F7LDH4	Escherichia_phage	100.0	1.1e-63
WP_001005162.1|843380_843551_+	hypothetical protein	NA	S4TNZ7	Salmonella_phage	100.0	6.1e-25
WP_000217677.1|843547_844048_+	hypothetical protein	NA	A0A0F7LBQ6	Escherichia_phage	100.0	4.5e-92
WP_000557703.1|844112_844337_+	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_001277957.1|844336_844639_+	DUF5405 family protein	NA	A0A0F7LDT6	Escherichia_phage	99.0	2.2e-46
WP_023148842.1|844638_844863_+	TraR/DksA family transcriptional regulator	NA	A0A0F7LDI3	Escherichia_phage	98.6	5.0e-35
WP_000027664.1|844859_845135_+	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	3.8e-45
WP_023148841.1|845124_847413_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	97.2	0.0e+00
WP_001754918.1|847829_847985_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016239054.1|848021_848342_+	helix-turn-helix transcriptional regulator	NA	E5E3S9	Burkholderia_phage	38.7	5.9e-13
WP_023148839.1|848307_849258_+	RNA-directed DNA polymerase	NA	E5E3S8	Burkholderia_phage	40.8	4.6e-37
WP_023148838.1|849366_850731_-	FRG domain-containing protein	NA	Q9AZ51	Lactococcus_phage	34.1	6.7e-05
WP_048219351.1|851243_852278_-|portal	phage portal protein	portal	Q858W8	Yersinia_virus	99.4	7.1e-201
WP_000156861.1|852277_854050_-|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCK3	Escherichia_phage	99.8	0.0e+00
WP_001085952.1|854223_855078_+|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	99.3	8.6e-136
WP_023148837.1|855132_856206_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	7.4e-201
WP_001605750.1|856209_856953_+|terminase	terminase endonuclease subunit	terminase	A0A0F7LBP7	Escherichia_phage	98.0	1.9e-123
WP_033559479.1|857052_857562_+|head	head completion/stabilization protein	head	U5N0S3	Enterobacteria_phage	98.8	7.3e-90
WP_000846409.1|857561_857765_+|tail	tail protein X	tail	A0A0F7LCN2	Escherichia_phage	100.0	3.0e-31
WP_000123123.1|857768_858050_+|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_023148834.1|858049_858547_+	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	99.4	1.2e-92
WP_000736597.1|858561_858987_+	hypothetical protein	NA	A0A0F7LBP4	Escherichia_phage	95.0	4.7e-58
WP_032152948.1|858974_859400_+|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	96.5	1.4e-65
WP_001440152.1|859371_859545_+	hypothetical protein	NA	Q7Y4E1	Escherichia_virus	96.5	2.3e-24
WP_001774102.1|859507_859975_+|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.1	9.7e-81
WP_023148832.1|859967_860420_+	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	99.3	2.4e-76
WP_023148831.1|860522_861596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_033560515.1|861682_862312_+|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	96.6	1.1e-108
WP_000127164.1|862308_862656_+	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_001121453.1|862660_863569_+|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_001285325.1|863561_864092_+|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_023148827.1|864102_866127_+|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	71.9	6.5e-299
865880:865895	attR	AAGTTATTCCTGGCAA	NA	NA	NA	NA
WP_023148826.1|866128_866656_+|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	8.3e-89
WP_023148825.1|866946_868173_+	DUF4263 domain-containing protein	NA	Q858S8	Enterobacteria_phage	99.4	1.1e-181
WP_020233495.1|868459_869650_+|tail	phage tail sheath protein	tail	A0A0F7LBW9	Escherichia_phage	99.2	9.0e-224
WP_001251408.1|869662_870181_+|tail	phage major tail tube protein	tail	A0A0F7LDZ1	Escherichia_phage	100.0	1.4e-93
WP_001031303.1|870237_870513_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	100.0	5.7e-41
WP_000785970.1|870545_870665_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	100.0	1.0e-15
WP_021523174.1|870657_873105_+|tail	phage tail tape measure protein	tail	M1T2S3	Escherichia_phage	95.7	0.0e+00
WP_001565024.1|873119_873599_+|tail	phage tail protein	tail	O64315	Escherichia_phage	98.1	9.6e-84
WP_033559748.1|873598_874762_+	phage late control D family protein	NA	U5N3V4	Enterobacteria_phage	99.5	8.3e-206
WP_000468308.1|874844_875063_+	prophage transcriptional regulator OgrK	NA	A0A0F7LDQ9	Escherichia_phage	100.0	4.7e-38
WP_001292809.1|875382_877665_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.4	1.3e-162
WP_000642546.1|877719_878577_-	formate transporter FocA	NA	NA	NA	NA	NA
WP_001328457.1|878982_880743_-	YcaO-like family protein	NA	NA	NA	NA	NA
WP_000642852.1|880872_881565_+	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_000057149.1|881763_882852_+	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_001522761.1|882922_884206_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_001313710.1|884375_885140_+	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_001522762.1|885312_885996_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_000140327.1|886106_887780_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000167336.1|887939_888224_+	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_021523053.1|888430_890695_+	ComEC family protein	NA	NA	NA	NA	NA
WP_000551270.1|890731_892480_+	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_000570527.1|892476_893463_+	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_001522765.1|893499_894732_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000350058.1|894783_894966_+	protein YcaR	NA	NA	NA	NA	NA
WP_021523054.1|894962_895709_+	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000436922.1|895862_896756_+	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_001522767.1|896732_897512_-	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_001298300.1|897647_898433_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_001288850.1|898429_899752_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_001295931.1|899732_900437_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_021523055.1|900436_904897_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_020232980.1|905157_907005_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_001295932.1|907185_907734_+	YcbK family protein	NA	A0A0K1LKR7	Rhodobacter_phage	33.7	7.0e-06
WP_001109449.1|907760_908408_+	hydroxyacylglutathione hydrolase GloC	NA	NA	NA	NA	NA
WP_000462687.1|908458_909649_-	aspartate transaminase	NA	NA	NA	NA	NA
WP_000117881.1|911513_912914_-|tRNA	asparagine--tRNA ligase	tRNA	A0A2K9V902	Bandra_megavirus	36.1	5.3e-82
>prophage 3
NZ_CP047609	Escherichia coli strain NMBU_ W06E18 chromosome, complete genome	5248629	1084031	1160229	5248629	holin,terminase,integrase,head,capsid,transposase,lysis,tRNA,tail,portal	Escherichia_phage(36.21%)	88	1085159:1085174	1129867:1129882
WP_000526135.1|1084031_1084490_+|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001300895.1|1084611_1085574_-	L,D-transpeptidase LdtC	NA	NA	NA	NA	NA
1085159:1085174	attL	GTCAGCGTGTCACCAC	NA	NA	NA	NA
WP_024166502.1|1085717_1089164_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
WP_001522877.1|1089291_1090365_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_000284714.1|1090625_1091825_+	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_001033689.1|1091817_1092519_+	lipoprotein-releasing ABC transporter ATP-binding protein LolD	NA	G9BWD6	Planktothrix_phage	39.8	5.4e-35
WP_001251363.1|1092518_1093763_+	lipoprotein-releasing ABC transporter permease subunit LolE	NA	NA	NA	NA	NA
WP_000291248.1|1093791_1094703_+	N-acetylglucosamine kinase	NA	NA	NA	NA	NA
WP_000952736.1|1094718_1095540_+	NAD-dependent protein deacylase	NA	A0A2I7S9Y2	Vibrio_phage	35.6	5.6e-23
WP_000720604.1|1095676_1096462_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522885.1|1096458_1096920_-	DUF3592 domain-containing protein	NA	NA	NA	NA	NA
WP_000759309.1|1096977_1098024_-	spermidine/putrescine ABC transporter substrate-binding protein PotD	NA	NA	NA	NA	NA
WP_000580316.1|1098020_1098815_-	spermidine/putrescine ABC transporter permease PotC	NA	NA	NA	NA	NA
WP_000074983.1|1098981_1100100_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.2	7.7e-84
WP_000003742.1|1100068_1100338_-	excisionase	NA	NA	NA	NA	NA
WP_001542183.1|1100399_1102856_-	exonuclease	NA	V5UQJ3	Shigella_phage	42.6	2.5e-103
WP_001093951.1|1102933_1103137_-	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000450218.1|1103133_1103322_-	cell division inhibitor	NA	NA	NA	NA	NA
WP_000935596.1|1103332_1104187_-	Rha family phage regulatory protein	NA	A0A0P0ZE80	Stx2-converting_phage	63.2	3.6e-65
WP_000394557.1|1104717_1105092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000379564.1|1105103_1105256_-	DUF1391 family protein	NA	NA	NA	NA	NA
WP_000787428.1|1105462_1105870_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	49.6	9.8e-29
WP_000912294.1|1105946_1106174_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705383.1|1106157_1106709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020541.1|1106680_1107721_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_001309414.1|1107632_1108175_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450706.1|1108208_1108979_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	1.1e-86
WP_001141099.1|1108994_1109387_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|1109383_1109680_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209475.1|1109676_1110138_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_000403791.1|1110115_1110472_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	98.3	1.1e-57
WP_000137948.1|1110567_1110975_+	hypothetical protein	NA	A0A0N7KZJ2	Stx2-converting_phage	60.4	1.0e-22
WP_001229301.1|1110976_1111342_+	HNH endonuclease	NA	A0A2R2Z2X9	Escherichia_phage	99.2	1.9e-68
WP_000208092.1|1111338_1112325_+	hypothetical protein	NA	Q1MVF7	Enterobacteria_phage	41.5	1.8e-44
WP_000813254.1|1112883_1113039_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_001309416.1|1113255_1113507_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001309417.1|1113573_1113852_+	hypothetical protein	NA	I6PCV7	Cronobacter_phage	45.3	6.3e-11
WP_001265256.1|1113853_1114912_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.3	1.8e-90
WP_000140038.1|1114912_1115281_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.8	2.4e-34
WP_001064909.1|1115273_1115963_+	antiterminator	NA	I6PDF8	Cronobacter_phage	48.1	7.1e-56
WP_001309418.1|1116175_1116373_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	93.8	1.7e-26
WP_157835956.1|1116348_1116462_+	DUF3927 family protein	NA	NA	NA	NA	NA
WP_000871291.1|1116742_1117078_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	74.8	5.2e-44
WP_001309419.1|1117323_1117527_+	DUF1737 domain-containing protein	NA	H6WZJ9	Escherichia_phage	96.8	2.7e-27
WP_001309421.1|1117523_1117685_+	hypothetical protein	NA	Q08JA2	Stx2-converting_phage	89.1	1.6e-14
WP_000284506.1|1117834_1118050_+|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001037014.1|1118054_1118945_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.9	2.1e-108
WP_001092866.1|1118981_1119515_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_001446668.1|1119671_1119854_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001280932.1|1119868_1120000_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_032142285.1|1120002_1120470_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_000830178.1|1120780_1121107_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001322427.1|1121229_1121583_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235436.1|1122065_1122575_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001309424.1|1122546_1124475_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.4e-261
WP_000258993.1|1124458_1124665_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	55.4	3.0e-10
WP_001322425.1|1124661_1126254_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.1	4.9e-185
WP_001253888.1|1126243_1127749_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.1	1.0e-99
WP_000256814.1|1127785_1128133_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	59.1	6.8e-23
WP_029702099.1|1128190_1129219_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	4.1e-116
WP_000201530.1|1129270_1129645_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204533.1|1129637_1129991_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
1129867:1129882	attR	GTGGTGACACGCTGAC	NA	NA	NA	NA
WP_000975005.1|1130006_1130582_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	56.8	1.6e-48
WP_000683079.1|1130578_1130974_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235111.1|1130981_1131734_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	98.0	2.7e-133
WP_000479111.1|1131747_1132179_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	68.1	1.8e-41
WP_000533402.1|1132205_1132619_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082417.1|1132599_1135161_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	87.5	0.0e+00
WP_000847298.1|1135157_1135487_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001328631.1|1135486_1136185_+|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	97.0	3.2e-128
WP_000194723.1|1136195_1136939_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.0	5.0e-148
WP_032300536.1|1136884_1137517_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_000514726.1|1137860_1141553_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	86.0	0.0e+00
WP_000608644.1|1141788_1143051_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001233148.1|1144426_1145026_+	Ail/Lom family protein	NA	H6WZM8	Escherichia_phage	94.0	7.7e-107
WP_000216486.1|1145177_1148204_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0K2FIZ6	Escherichia_phage	54.6	1.4e-55
WP_000885577.1|1148203_1148788_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	94.8	6.6e-103
WP_000240999.1|1148842_1149511_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937481.1|1149567_1149834_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	81.8	1.5e-17
WP_000799406.1|1150065_1150929_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_172986636.1|1150912_1152049_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_001522887.1|1152298_1153525_+	peptidase T	NA	NA	NA	NA	NA
WP_000456506.1|1153573_1154695_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|1154770_1156231_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|1156230_1156902_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|1157071_1158442_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|1158445_1159087_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_000004751.1|1159122_1160229_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP047609	Escherichia coli strain NMBU_ W06E18 chromosome, complete genome	5248629	1381590	1439783	5248629	holin,terminase,lysis,tRNA,tail	Escherichia_phage(50.0%)	68	NA	NA
WP_020233353.1|1381590_1382523_-	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	39.5	2.3e-17
WP_000387388.1|1383854_1384838_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_000123748.1|1385315_1386689_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_001523172.1|1386817_1387753_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000040839.1|1387804_1389040_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	99.5	3.8e-241
WP_000079604.1|1389041_1389257_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001302840.1|1389356_1389545_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_001443846.1|1389582_1389732_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.9	2.5e-22
WP_000166313.1|1389787_1390597_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	4.0e-106
WP_000105140.1|1390589_1393190_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.5	6.1e-249
WP_001344816.1|1393291_1393567_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	95.6	4.0e-42
WP_001352098.1|1393641_1393812_-	conserved protein, Rac prophage	NA	A0A0U2SHB5	Escherichia_phage	71.4	3.6e-17
WP_000560223.1|1393811_1394033_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001312793.1|1394474_1394963_+	superinfection exclusion protein B	NA	NA	NA	NA	NA
WP_001169151.1|1394959_1395115_-	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_001326317.1|1395125_1395305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000233319.1|1395547_1395967_-	helix-turn-helix domain-containing protein	NA	A0A2I6PIE7	Escherichia_phage	46.5	5.5e-19
WP_001072342.1|1396046_1396301_+	hypothetical protein	NA	A0A2I6PIE5	Escherichia_phage	61.6	1.3e-18
WP_000693803.1|1396297_1396720_+	hypothetical protein	NA	A0A0U2RXZ9	Escherichia_phage	92.9	1.3e-68
WP_001396581.1|1396797_1397586_+	hypothetical protein	NA	G9L6A8	Escherichia_phage	64.3	2.0e-41
WP_020233967.1|1397592_1398339_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	1.1e-110
WP_000450716.1|1398361_1399123_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	87.4	3.4e-115
WP_029702111.1|1399138_1399561_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	7.4e-64
WP_000137958.1|1399722_1400226_+	hypothetical protein	NA	Q9G078	Enterobacteria_phage	39.7	4.3e-18
WP_000200358.1|1400346_1401120_-	KilA-N domain-containing protein	NA	A0A1L2BWW1	Bacteriophage	42.6	9.6e-09
WP_001445775.1|1401642_1401768_+	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.2	4.0e-10
WP_001445776.1|1401850_1402192_-	DUF1971 domain-containing protein	NA	NA	NA	NA	NA
WP_000940344.1|1403059_1403659_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	92.0	2.9e-106
WP_000228032.1|1403658_1403949_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	88.5	7.4e-47
WP_000640106.1|1403945_1404488_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	76.3	5.8e-77
WP_001208722.1|1404709_1405279_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328752.1|1405247_1405550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000781775.1|1405626_1405968_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	90.1	6.2e-53
WP_023153991.1|1405971_1406448_+	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	95.6	5.0e-85
WP_001228696.1|1406664_1406850_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	98.2	2.8e-15
WP_001097895.1|1407046_1408504_+	Trk system potassium uptake protein TrkG	NA	NA	NA	NA	NA
WP_001291105.1|1408641_1409433_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_020233805.1|1409425_1410358_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.1e-83
WP_000613571.1|1410293_1410545_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000089448.1|1410548_1411643_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.5	4.5e-113
WP_000625348.1|1411623_1412925_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_000763701.1|1412927_1414334_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.0	3.0e-186
WP_001363932.1|1414317_1415430_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_029702112.1|1415534_1416299_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	64.2	9.0e-84
WP_020233804.1|1416397_1417537_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	9.7e-159
WP_000908084.1|1417579_1417756_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000634214.1|1417759_1418155_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000524260.1|1418154_1418538_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001029815.1|1418538_1418919_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	1.1e-18
WP_000673077.1|1418915_1419308_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001328756.1|1419334_1420297_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	8.4e-55
WP_122452218.1|1420447_1420807_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032139919.1|1420914_1421115_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023153989.1|1421278_1424512_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	33.0	7.4e-103
WP_000024051.1|1424504_1424843_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152432.1|1424842_1425541_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	93.5	1.1e-125
WP_032153655.1|1425546_1426290_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	9.5e-147
WP_049286672.1|1426226_1426829_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_021523093.1|1426889_1430369_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_001542091.1|1430436_1431036_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_032152843.1|1431100_1433500_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
WP_000654154.1|1433496_1433778_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.2e-17
WP_000235967.1|1433787_1434492_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_001405873.1|1434502_1434796_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000836768.1|1435931_1436165_-	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_120795384.1|1436233_1436347_-	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_029701979.1|1436950_1438234_+	MHS family MFS transporter	NA	NA	NA	NA	NA
WP_000527786.1|1438322_1439783_+	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.7	5.1e-43
>prophage 5
NZ_CP047609	Escherichia coli strain NMBU_ W06E18 chromosome, complete genome	5248629	1586850	1694117	5248629	terminase,head,capsid,transposase,lysis,tail,portal	Enterobacteria_phage(40.74%)	112	NA	NA
WP_000526135.1|1586850_1587309_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001261003.1|1587486_1588155_-	DUF3313 domain-containing protein	NA	NA	NA	NA	NA
WP_000586719.1|1588457_1589051_-	tellurite resistance methyltransferase TehB	NA	NA	NA	NA	NA
WP_001296725.1|1589047_1590040_-	dicarboxylate transporter/tellurite-resistance protein TehA	NA	NA	NA	NA	NA
WP_001551086.1|1590163_1591144_+	LbetaH domain-containing protein	NA	NA	NA	NA	NA
WP_001523221.1|1591135_1591675_-	50S ribosomal protein L7/L12-serine acetyltransferase	NA	NA	NA	NA	NA
WP_001296778.1|1591737_1591962_-	YdcH family protein	NA	NA	NA	NA	NA
WP_048265110.1|1592101_1593757_-	glucan biosynthesis protein OpgD	NA	NA	NA	NA	NA
WP_001523218.1|1593981_1595325_-	VOC family protein	NA	NA	NA	NA	NA
WP_000414564.1|1595541_1596465_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001523216.1|1596502_1598143_-	methyl-accepting chemotaxis protein Trg	NA	NA	NA	NA	NA
WP_029702060.1|1598541_1598691_+	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_000731851.1|1598762_1598936_-	hypothetical protein	NA	A0A0R6PI25	Moraxella_phage	59.6	4.4e-07
WP_001390056.1|1599180_1599711_-	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
WP_000048645.1|1599899_1600901_+	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_000115969.1|1600942_1602382_-	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001027943.1|1602578_1603379_-	YdcF family protein	NA	NA	NA	NA	NA
WP_000343026.1|1603494_1603872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001314706.1|1603991_1604441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001523214.1|1604427_1604766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021517100.1|1605050_1608953_-	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.5	2.2e-53
WP_000048963.1|1609153_1609759_+	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_020233384.1|1609812_1611129_-	phosphatase PAP2/dual specificity phosphatase family protein	NA	NA	NA	NA	NA
WP_021523075.1|1611118_1612876_-	bifunctional alpha/beta hydrolase/class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000177498.1|1613787_1614393_-	CDP-alcohol phosphatidyltransferase family protein	NA	NA	NA	NA	NA
WP_001523206.1|1614563_1616870_-	DUF2773 domain-containing bactofilin	NA	NA	NA	NA	NA
WP_021523074.1|1616933_1617794_-	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_059321765.1|1618001_1620410_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_001523200.1|1624483_1624807_-	YdbL family protein	NA	NA	NA	NA	NA
WP_172986643.1|1624814_1625000_-	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_020233705.1|1624996_1627636_-	YdbH family protein	NA	NA	NA	NA	NA
WP_000762229.1|1627843_1628833_+	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001523197.1|1628943_1629366_+	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_001295715.1|1629362_1629629_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_021517097.1|1629902_1633427_+	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_000837924.1|1633793_1634927_+	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	8.3e-118
WP_001295593.1|1635067_1635502_+	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000286865.1|1636086_1637001_+	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_029702064.1|1637000_1637828_+	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
WP_001101728.1|1637824_1638682_+	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000968125.1|1638678_1639536_+	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_000354607.1|1640008_1640803_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001405873.1|1641348_1641642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001314683.1|1641684_1642725_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.9	2.9e-125
WP_000654155.1|1642734_1643016_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
WP_042099016.1|1643015_1645391_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	69.0	1.8e-167
WP_001542091.1|1645455_1646055_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	91.5	9.8e-102
WP_021523093.1|1646122_1649602_-	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.6	0.0e+00
WP_049286672.1|1649662_1650265_-|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	85.6	8.1e-88
WP_032153655.1|1650201_1650945_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.7	9.5e-147
WP_029702161.1|1650950_1651649_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_000847345.1|1651648_1651978_-|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	98.2	8.1e-58
WP_032153656.1|1651974_1654536_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	95.9	0.0e+00
WP_000459457.1|1654528_1654963_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000479153.1|1654944_1655367_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_001349920.1|1655382_1656123_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	100.0	7.8e-133
WP_000683128.1|1656130_1656526_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	99.2	6.5e-70
WP_000975070.1|1656522_1657101_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000752979.1|1657112_1657466_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	100.0	2.0e-62
WP_020233914.1|1657477_1657876_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	98.5	2.3e-62
WP_000063277.1|1657917_1658943_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_001708751.1|1658997_1659330_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	3.8e-55
WP_020233915.1|1659339_1660659_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	97.7	2.2e-231
WP_001356819.1|1660639_1662241_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.2	1.1e-309
WP_000198149.1|1662237_1662444_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027269.1|1662440_1664366_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453587.1|1664340_1664886_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_001368374.1|1665274_1665508_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_000373090.1|1665565_1665976_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.4	2.5e-56
WP_001019606.1|1666127_1666301_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|1666472_1666628_-	hypothetical protein	NA	NA	NA	NA	NA
WP_120795388.1|1666707_1666773_-	Qin prophage; protein YnfR	NA	NA	NA	NA	NA
WP_071524604.1|1666775_1666964_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|1666974_1667187_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_001071769.1|1667549_1668047_-	DUF2514 domain-containing protein	NA	A0A291LBG9	Klebsiella_phage	29.5	2.9e-06
WP_001092971.1|1668043_1668577_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	93.2	6.4e-97
WP_000189916.1|1668573_1668885_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|1668889_1669105_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000526135.1|1669661_1670120_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_000066484.1|1670570_1670786_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|1671086_1671299_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|1671353_1671443_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001047135.1|1671720_1672473_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.8	7.1e-134
WP_001265199.1|1672486_1673536_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.0	2.8e-112
WP_012304870.1|1673537_1673816_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000980994.1|1673882_1674134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|1674350_1674506_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|1674577_1674865_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|1674864_1675104_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|1675128_1675434_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|1675636_1675969_+	protein FlxA	NA	NA	NA	NA	NA
WP_000589005.1|1676405_1677719_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000915483.1|1678202_1679225_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_001265627.1|1679227_1679842_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021523102.1|1680050_1680716_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151242.1|1680918_1681317_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.9	7.7e-63
WP_000054487.1|1681357_1682323_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.8	2.6e-56
WP_000705355.1|1682303_1682825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000921596.1|1682808_1683036_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_000381212.1|1683116_1683524_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	7.2e-32
WP_000379575.1|1683692_1683848_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_000344950.1|1683849_1684425_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|1684911_1685100_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083276.1|1685096_1685288_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000048363.1|1685381_1687853_+	exonuclease	NA	A0A192Y6E0	Salmonella_phage	56.1	1.2e-57
WP_000005552.1|1687925_1688177_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_001339397.1|1688247_1688925_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	46.0	3.3e-21
WP_000624622.1|1688924_1689272_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_029392005.1|1689291_1690863_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.5	4.9e-169
WP_000526135.1|1691132_1691591_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001389342.1|1692911_1693040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000836037.1|1693097_1694117_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	4.3e-17
>prophage 6
NZ_CP047609	Escherichia coli strain NMBU_ W06E18 chromosome, complete genome	5248629	2185448	2192966	5248629		Escherichia_phage(42.86%)	7	NA	NA
WP_021523155.1|2185448_2185997_-	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	54.4	4.4e-48
WP_021523156.1|2186001_2186880_-	glucose-1-phosphate thymidylyltransferase RfbA	NA	A0A291LA53	Escherichia_phage	64.5	1.9e-106
WP_021523157.1|2186937_2187837_-	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.1	1.7e-28
WP_001515524.1|2187836_2188922_-	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	2.3e-101
WP_021523158.1|2189293_2190187_-	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_021523159.1|2190418_2191414_-	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.0	2.5e-09
WP_021523160.1|2191571_2192966_-	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	9.8e-20
>prophage 7
NZ_CP047609	Escherichia coli strain NMBU_ W06E18 chromosome, complete genome	5248629	2236931	2326779	5248629	holin,terminase,integrase,head,capsid,transposase,lysis,tRNA,tail,portal,protease,plate	Escherichia_phage(30.0%)	93	2270280:2270295	2315764:2315779
WP_157919894.1|2236931_2238788_-|tail	tail fiber domain-containing protein	tail	A0A0D4D9I5	Escherichia_phage	36.0	7.2e-103
WP_140436207.1|2238813_2239179_-	hypothetical protein	NA	A0A291LGD5	Salmonella_phage	46.5	1.0e-16
WP_172986647.1|2239156_2240404_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986648.1|2240419_2240809_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157919893.1|2241540_2241702_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986649.1|2242031_2243357_-|head,protease	HK97 family phage prohead protease	head,protease	R9TPU0	Vibrio_phage	25.7	9.6e-17
WP_137504030.1|2244844_2245390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_135566170.1|2245399_2245609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986678.1|2245580_2246141_-|terminase	phage terminase large subunit family protein	terminase	NA	NA	NA	NA
WP_077898445.1|2246285_2246750_-|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	32.4	3.2e-07
WP_123055505.1|2246721_2247204_-|terminase	phage terminase large subunit family protein	terminase	NA	NA	NA	NA
WP_052077011.1|2247246_2247660_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077940995.1|2248135_2248699_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172986650.1|2248851_2249523_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033802730.1|2249571_2249889_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986651.1|2252214_2252766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087503933.1|2252777_2253251_-	hypothetical protein	NA	A0A2H4PHE8	Dickeya_phage	34.3	8.4e-16
WP_172986652.1|2253335_2253476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087503934.1|2253640_2253832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986653.1|2253912_2255478_-	recombinase zinc beta ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_020233021.1|2256218_2258159_-	protein kinase YegI	NA	NA	NA	NA	NA
WP_000722355.1|2258356_2258818_+	YegJ family protein	NA	NA	NA	NA	NA
WP_020233022.1|2258882_2259644_-	protein-serine/threonine phosphatase PphC	NA	NA	NA	NA	NA
WP_001520817.1|2259640_2260300_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_010723109.1|2260520_2260580_-	type I toxin-antitoxin system toxin IbsA	NA	NA	NA	NA	NA
WP_001386899.1|2260852_2260909_-	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_100249716.1|2261180_2261237_-	type I toxin-antitoxin system Ibs family toxin	NA	NA	NA	NA	NA
WP_001520819.1|2261515_2262763_+	multidrug efflux RND transporter subunit MdtA	NA	NA	NA	NA	NA
WP_001197884.1|2262762_2265885_+	multidrug efflux RND transporter permease subunit MdtB	NA	NA	NA	NA	NA
WP_001520820.1|2265885_2268963_+	multidrug efflux RND transporter permease subunit MdtC	NA	NA	NA	NA	NA
WP_001520822.1|2268963_2270379_+	MFS transporter	NA	NA	NA	NA	NA
2270280:2270295	attL	GGCGTTTATCATCGCC	NA	NA	NA	NA
WP_020233091.1|2271534_2272350_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021523176.1|2273040_2273586_-	hypothetical protein	NA	Q858S7	Enterobacteria_phage	98.9	1.1e-96
WP_021523177.1|2273855_2274383_-|tail	tail fiber assembly protein	tail	A0A0C4UR05	Shigella_phage	92.6	4.9e-89
WP_021523178.1|2274384_2276406_-|tail	phage tail protein	tail	A0A0A7NV63	Enterobacteria_phage	64.5	2.7e-260
WP_001285325.1|2276416_2276947_-|tail	phage tail protein I	tail	U5N0U8	Enterobacteria_phage	100.0	2.3e-102
WP_001121453.1|2276939_2277848_-|plate	baseplate assembly protein	plate	U5N3T9	Enterobacteria_phage	99.7	4.4e-162
WP_000127164.1|2277852_2278200_-	GPW/gp25 family protein	NA	A0A0F7LDQ1	Escherichia_phage	100.0	1.3e-58
WP_020233499.1|2278196_2278832_-|plate	phage baseplate assembly protein V	plate	U5N3F0	Enterobacteria_phage	99.5	1.2e-113
WP_021523179.1|2278915_2279701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001001802.1|2279772_2280225_-	phage virion morphogenesis protein	NA	A0A0F7LDR6	Escherichia_phage	98.0	1.5e-75
WP_000917186.1|2280217_2280685_-|tail	phage tail protein	tail	Q7Y4E0	Escherichia_virus	98.7	2.5e-81
WP_072174950.1|2280647_2280821_-|lysis	phage lysis protein	lysis	Q7Y4E1	Escherichia_virus	91.2	9.8e-23
WP_001512906.1|2280792_2281218_-|lysis	LysB family phage lysis regulatory protein	lysis	Q858W0	Yersinia_virus	98.6	1.9e-67
WP_000736608.1|2281205_2281631_-	hypothetical protein	NA	U5N096	Enterobacteria_phage	95.7	2.3e-57
WP_001144101.1|2281645_2282143_-	glycoside hydrolase family 104 protein	NA	A0A0F7LBS0	Escherichia_phage	100.0	3.1e-93
WP_000123123.1|2282142_2282424_-|holin	phage holin family protein	holin	A0A0F7LA12	Escherichia_phage	100.0	1.3e-43
WP_000846399.1|2282427_2282631_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	100.0	4.0e-31
WP_000988636.1|2282630_2283140_-|head	head completion/stabilization protein	head	A0A0F7LDJ1	Escherichia_phage	100.0	8.6e-91
WP_000203455.1|2283239_2283983_-|terminase	terminase endonuclease subunit	terminase	A0A0F7LDU4	Escherichia_phage	99.2	3.0e-124
WP_020233501.1|2283986_2285060_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	99.2	2.5e-201
WP_020233502.1|2285118_2285973_-|capsid	GPO family capsid scaffolding protein	capsid	Q778Z1	Enterobacteria_phage	98.2	8.1e-134
WP_000156847.1|2286146_2287919_+|terminase	terminase ATPase subunit family protein	terminase	A0A0F7LCM8	Escherichia_phage	100.0	0.0e+00
WP_001533791.1|2287918_2288953_+|portal	phage portal protein	portal	A0A0F7LDI7	Escherichia_phage	99.7	2.7e-200
WP_029401227.1|2289339_2290764_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_029401228.1|2290760_2291753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_029401229.1|2291703_2292855_-	DNA cytosine methyltransferase	NA	M1PSQ0	Streptococcus_phage	31.2	1.4e-32
WP_029701698.1|2295190_2295466_-	DUF5405 family protein	NA	U5N3W1	Enterobacteria_phage	100.0	1.5e-44
WP_029701699.1|2295462_2295687_-	TraR/DksA family transcriptional regulator	NA	A0A0F7LDG9	Escherichia_phage	98.6	3.8e-35
WP_001754915.1|2295686_2295989_-	DUF5405 family protein	NA	A0A0F7LCL4	Escherichia_phage	100.0	3.5e-47
WP_000557703.1|2295988_2296213_-	DUF2732 family protein	NA	S4TP68	Salmonella_phage	100.0	4.7e-33
WP_029701701.1|2296276_2296777_-	hypothetical protein	NA	S4TTB7	Salmonella_phage	98.8	1.9e-90
WP_162852172.1|2296773_2296944_-	hypothetical protein	NA	S4TNZ7	Salmonella_phage	98.2	3.9e-24
WP_029701703.1|2296954_2297230_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	98.9	2.2e-48
WP_000020919.1|2297351_2297651_+	helix-turn-helix domain-containing protein	NA	Q1JS61	Enterobacteria_phage	100.0	2.4e-48
WP_000985261.1|2297766_2298780_+|integrase	site-specific integrase	integrase	Q83VS6	Escherichia_phage	99.1	4.1e-193
WP_001303579.1|2299056_2299374_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000807371.1|2299788_2300688_+	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.0	4.8e-12
WP_000178552.1|2300769_2301549_-	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_001520826.1|2301648_2302689_-	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000490663.1|2302736_2304092_-	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000823282.1|2304095_2304380_-	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000182900.1|2304410_2304863_-	PTS galactitol transporter subunit IIA	NA	NA	NA	NA	NA
WP_001308759.1|2306158_2307013_-	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000129551.1|2307242_2308295_-	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000858471.1|2308551_2309829_+	MFS transporter	NA	NA	NA	NA	NA
WP_001520828.1|2309825_2310830_+	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.7	4.4e-14
WP_001520829.1|2310826_2311792_+	kinase	NA	NA	NA	NA	NA
WP_000434044.1|2311765_2312512_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020233504.1|2312563_2313382_-	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	1.1e-23
WP_000822277.1|2313446_2314247_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001195594.1|2314243_2315032_-	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000019944.1|2315254_2315527_-	Ni(II)/Co(II)-binding transcriptional repressor RcnR	NA	NA	NA	NA	NA
WP_000134572.1|2315647_2316472_+	nickel/cobalt efflux protein RcnA	NA	NA	NA	NA	NA
2315764:2315779	attR	GGCGTTTATCATCGCC	NA	NA	NA	NA
WP_000153067.1|2316690_2317029_+	Ni(II)/Co(II) efflux transporter accessory subunit RcnB	NA	NA	NA	NA	NA
WP_000702203.1|2317110_2318145_-	putative fimbrial-like adhesin protein	NA	NA	NA	NA	NA
WP_001520833.1|2318160_2320641_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_000677340.1|2320656_2321331_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_000830468.1|2321411_2321954_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000526135.1|2322288_2322747_-|transposase	IS200/IS605 family transposase	transposase	NA	NA	NA	NA
WP_001328276.1|2322960_2323242_-	YehE family protein	NA	NA	NA	NA	NA
WP_001005448.1|2323504_2324614_-	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001520834.1|2324745_2326779_+|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.3	2.3e-54
>prophage 8
NZ_CP047609	Escherichia coli strain NMBU_ W06E18 chromosome, complete genome	5248629	2338218	2347661	5248629		Enterobacteria_phage(85.71%)	10	NA	NA
WP_001520842.1|2338218_2339355_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	2.5e-162
WP_021523183.1|2339351_2341352_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001295429.1|2341476_2341938_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001295430.1|2341979_2342450_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	100.0	1.8e-82
WP_000598641.1|2342496_2343216_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001309587.1|2343212_2344898_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_001240398.1|2345119_2345851_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|2345910_2346018_+	protein YohO	NA	NA	NA	NA	NA
WP_000783145.1|2345998_2346730_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569374.1|2346734_2347661_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 9
NZ_CP047609	Escherichia coli strain NMBU_ W06E18 chromosome, complete genome	5248629	2410875	2420316	5248629		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000040703.1|2410875_2412012_+	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.1	3.6e-161
WP_033817093.1|2412008_2414009_+	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.3	0.0e+00
WP_001295429.1|2414133_2414595_+	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_000950404.1|2414634_2415105_-	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	2.0e-81
WP_000598641.1|2415151_2415871_-	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001309587.1|2415867_2417553_-	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.5	7.3e-304
WP_001240398.1|2417774_2418506_+	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001216963.1|2418565_2418673_+	protein YohO	NA	NA	NA	NA	NA
WP_000783145.1|2418653_2419385_-	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_000569374.1|2419389_2420316_-	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	4.8e-23
>prophage 10
NZ_CP047609	Escherichia coli strain NMBU_ W06E18 chromosome, complete genome	5248629	2890448	2959746	5248629	holin,terminase,integrase,head,coat,lysis,tRNA,portal	Enterobacteria_phage(59.38%)	89	2919362:2919384	2967485:2967507
WP_020233264.1|2890448_2890985_-|tRNA	tRNA adenosine(34) deaminase TadA	tRNA	NA	NA	NA	NA
WP_000190642.1|2891009_2891645_-	phosphatidylglycerophosphatase C	NA	NA	NA	NA	NA
WP_001013779.1|2891853_2892702_+	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001196285.1|2892757_2893018_+	4Fe-4S dicluster ferredoxin YfhL	NA	A0A1B1IWY9	uncultured_Mediterranean_phage	52.3	8.4e-18
WP_000128776.1|2893212_2893293_-	type I toxin-antitoxin system toxin ShoB	NA	NA	NA	NA	NA
WP_001521083.1|2893712_2894093_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_001314938.1|2894092_2894824_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_000399404.1|2894835_2895564_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_000020737.1|2895575_2896481_-	GTPase Era	NA	NA	NA	NA	NA
WP_001068343.1|2896477_2897158_-	ribonuclease III	NA	A0A2P0VNZ5	Tetraselmis_virus	39.6	5.6e-21
WP_000002542.1|2897430_2898405_-	signal peptidase I	NA	NA	NA	NA	NA
WP_001521085.1|2898420_2900220_-	elongation factor 4	NA	A0A2K9L6L3	Tupanvirus	41.9	4.2e-23
WP_000589053.1|2900417_2900897_-	SoxR-reducing system protein RseC	NA	NA	NA	NA	NA
WP_000812053.1|2900893_2901850_-	sigma-E factor regulatory protein RseB	NA	NA	NA	NA	NA
WP_001168459.1|2901849_2902500_-	anti-sigma-E factor RseA	NA	NA	NA	NA	NA
WP_001295364.1|2902532_2903108_-	RNA polymerase sigma factor RpoE	NA	NA	NA	NA	NA
WP_001303621.1|2903104_2903260_-	rpoE leader peptide RseD	NA	NA	NA	NA	NA
WP_001094401.1|2903515_2905138_+	L-aspartate oxidase	NA	NA	NA	NA	NA
WP_001295363.1|2905122_2905860_-|tRNA	tRNA (adenosine(37)-N6)-methyltransferase TrmM	tRNA	NA	NA	NA	NA
WP_000219193.1|2905991_2907326_+	ATP-dependent RNA helicase SrmB	NA	E3T5E1	Cafeteria_roenbergensis_virus	30.8	2.9e-45
WP_001521087.1|2907358_2908240_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001521088.1|2908342_2908930_+	cysteine/O-acetylserine transporter	NA	NA	NA	NA	NA
WP_000627804.1|2908991_2909375_-	autonomous glycyl radical cofactor GrcA	NA	A0A088FS37	Shigella_phage	70.9	4.7e-33
WP_001262721.1|2909679_2910369_+	uracil-DNA glycosylase	NA	A0A172DS90	Canid_alphaherpesvirus	48.8	9.3e-56
WP_001521090.1|2910416_2911454_-|tRNA	tRNA/rRNA methyltransferase	tRNA	NA	NA	NA	NA
WP_001098726.1|2911660_2912080_+	thioredoxin TrxC	NA	A0A0K2FIM3	Achromobacter_phage	38.5	2.8e-15
WP_001308860.1|2912148_2912847_+	DTW domain-containing protein	NA	NA	NA	NA	NA
WP_001520954.1|2915826_2917074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000776768.1|2917252_2918008_-	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_000368131.1|2918301_2919234_+	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	100.0	1.2e-167
2919362:2919384	attL	TTCGATTCCTGCAGGGGACACCA	NA	NA	NA	NA
WP_087503470.1|2919545_2920703_+|integrase	prophage integrase IntS	integrase	A5VW56	Enterobacteria_phage	99.2	3.7e-222
WP_016242483.1|2920819_2921476_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050596990.1|2921476_2922208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087503469.1|2922327_2924727_-|head	phage head-binding domain-containing protein	head	A5VW57	Enterobacteria_phage	90.6	8.0e-78
WP_087503468.1|2924891_2927285_-	lytic transglycosylase domain-containing protein	NA	Q716G2	Shigella_phage	96.8	0.0e+00
WP_087503467.1|2927285_2928617_-	phage DNA ejection protein	NA	A0A2D1GLX5	Escherichia_phage	98.2	5.5e-214
WP_087503466.1|2928626_2929319_-	DNA transfer protein	NA	G5DA80	Enterobacteria_phage	99.6	2.7e-111
WP_087503465.1|2929321_2929777_-	DUF2824 family protein	NA	A5VW67	Enterobacteria_phage	97.4	2.8e-85
WP_087503464.1|2929776_2930730_-	hypothetical protein	NA	Q716G6	Shigella_phage	84.9	5.4e-94
WP_085701391.1|2930729_2932148_-	packaged DNA stabilization protein gp10	NA	Q9AYZ4	Salmonella_phage	98.7	2.3e-274
WP_117041780.1|2932157_2932619_-|head	head DNA stabilization protein	head	A5VW70	Enterobacteria_phage	98.7	1.7e-82
WP_001389518.1|2932599_2932788_-	hypothetical protein	NA	A0A088CPR7	Enterobacteria_phage	100.0	2.9e-28
WP_005759997.1|2932829_2934089_-|coat	coat protein	coat	A5VW72	Enterobacteria_phage	94.3	2.3e-222
WP_117041781.1|2934107_2935001_-	scaffolding protein	NA	A0A088CPT0	Enterobacteria_phage	98.3	1.4e-128
WP_117041782.1|2935091_2937290_-|portal	portal protein	portal	A0A088CQ69	Enterobacteria_phage	99.3	0.0e+00
WP_000200766.1|2937291_2938707_-|terminase	PBSX family phage terminase large subunit	terminase	A5VW75	Enterobacteria_phage	99.8	1.2e-278
WP_000113732.1|2938703_2939144_-	hypothetical protein	NA	C7U0V7	Enterobacteria_phage	99.3	1.7e-79
WP_000807788.1|2939146_2939389_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	100.0	1.3e-36
WP_001028465.1|2939551_2940073_-	KilA-N domain-containing protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_021554252.1|2940276_2940714_-|lysis	lysis protein	lysis	K7P710	Enterobacteria_phage	95.2	6.1e-69
WP_000229389.1|2940710_2941187_-	glycoside hydrolase family protein	NA	A5VW81	Enterobacteria_phage	100.0	7.5e-89
WP_000783734.1|2941170_2941494_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_000027554.1|2942089_2942608_-	DUF1133 family protein	NA	Q716B8	Shigella_phage	99.4	5.9e-95
WP_000994516.1|2942604_2942793_-	protein ninH	NA	A5VW84	Enterobacteria_phage	100.0	5.5e-27
WP_001549462.1|2942789_2943152_-	RusA family crossover junction endodeoxyribonuclease	NA	K7PJW5	Enterobacteria_phage	97.5	6.6e-61
WP_023146907.1|2943152_2943677_-	HNH endonuclease	NA	K4F9R1	Cronobacter_phage	42.9	7.1e-32
WP_000002250.1|2943673_2943964_-	DUF1364 domain-containing protein	NA	Q9MCN9	Enterobacteria_phage	100.0	3.4e-52
WP_023146906.1|2943963_2944686_-	phage antirepressor KilAC domain-containing protein	NA	K7P7L0	Enterobacteria_phage	97.5	1.1e-128
WP_000566866.1|2944678_2944849_-	protein ninF	NA	K7PLU6	Enterobacteria_phage	100.0	2.5e-26
WP_024176095.1|2944845_2945028_-	NinE family protein	NA	Q8H9Z6	Enterobacteria_phage	98.3	1.3e-28
WP_023146905.1|2945024_2945552_-	phage N-6-adenine-methyltransferase	NA	A0A1I9LJP9	Stx_converting_phage	99.4	1.2e-100
WP_000736913.1|2945548_2945989_-	recombination protein NinB	NA	M1FPM8	Enterobacteria_phage	100.0	1.2e-80
WP_001749476.1|2946062_2947439_-	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	99.8	1.6e-253
WP_172986679.1|2947435_2948323_-	replication protein	NA	A5VW95	Enterobacteria_phage	98.3	1.1e-141
WP_001244621.1|2948385_2948658_-	hypothetical protein	NA	G9L679	Escherichia_phage	100.0	2.7e-43
WP_000251072.1|2948680_2948974_-	hypothetical protein	NA	A5VW96	Enterobacteria_phage	100.0	1.7e-46
WP_001194218.1|2949093_2949309_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	100.0	1.4e-31
WP_000028392.1|2949412_2950045_+	LexA family transcriptional regulator	NA	K7P850	Enterobacteria_phage	99.5	1.6e-118
WP_000618034.1|2950041_2950446_+	hypothetical protein	NA	Q716D7	Shigella_phage	96.2	2.1e-68
WP_077694523.1|2950695_2951076_+	antitermination protein	NA	A4KWR0	Enterobacteria_phage	99.1	5.3e-53
WP_000213975.1|2951154_2951355_+	Restriction inhibitor protein ral	NA	A0A0K2FJE6	Enterobacteria_phage	100.0	1.4e-33
WP_000972063.1|2951581_2951716_+	hypothetical protein	NA	K7PHK2	Enterobacteria_phage	100.0	3.1e-16
WP_001243355.1|2951700_2951853_+	host cell division inhibitory peptide Kil	NA	A5VWA5	Enterobacteria_phage	100.0	4.7e-21
WP_000604111.1|2951937_2952246_+	hypothetical protein	NA	K7PJM4	Enterobacteria_phage	100.0	1.1e-53
WP_032153682.1|2952242_2953154_+	recombinase RecT	NA	K7PKG9	Enterobacteria_phage	98.7	2.4e-168
WP_032153683.1|2953137_2953620_+	siphovirus Gp157 family protein	NA	K7P6T5	Enterobacteria_phage	97.5	6.1e-78
WP_000753555.1|2953631_2953946_+	hypothetical protein	NA	K7PLT4	Enterobacteria_phage	100.0	1.2e-50
WP_029701300.1|2953962_2954244_+	hypothetical protein	NA	K7P7M4	Enterobacteria_phage	96.8	2.8e-43
WP_032153684.1|2954240_2954408_+	DUF2737 family protein	NA	Q716F2	Shigella_phage	98.2	5.0e-24
WP_029701301.1|2954404_2954659_+	hypothetical protein	NA	A0A1V0E5L1	Salmonella_phage	95.2	3.2e-38
WP_029701302.1|2954645_2955338_+	ead/Ea22-like family protein	NA	A0A088CC42	Shigella_phage	55.4	1.2e-82
WP_000951706.1|2955339_2955549_+	hypothetical protein	NA	A0A077SL56	Escherichia_phage	100.0	4.2e-36
WP_029701304.1|2955545_2956337_+	DUF551 domain-containing protein	NA	A0A0H4IU61	Shigella_phage	51.8	1.0e-58
WP_029701309.1|2956329_2956614_+	RNA-binding protein	NA	A0A2D1GLL3	Escherichia_phage	94.7	9.4e-47
WP_000545716.1|2956685_2956853_+	hypothetical protein	NA	K7P728	Enterobacteria_phage	92.7	9.2e-26
WP_001163428.1|2956910_2957111_+	response regulator inhibitor TorI	NA	K7P7V0	Enterobacteria_phage	100.0	2.4e-33
WP_001535474.1|2957363_2958650_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	37.3	1.1e-65
WP_001535476.1|2958642_2959398_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000749077.1|2959554_2959746_+	AlpA family transcriptional regulator	NA	E5E3Y1	Burkholderia_phage	49.0	4.2e-06
2967485:2967507	attR	TTCGATTCCTGCAGGGGACACCA	NA	NA	NA	NA
>prophage 11
NZ_CP047609	Escherichia coli strain NMBU_ W06E18 chromosome, complete genome	5248629	3129456	3138225	5248629	integrase	Escherichia_phage(71.43%)	7	3122818:3122829	3131042:3131053
3122818:3122829	attL	TGAGCACTTGAA	NA	NA	NA	NA
WP_029701594.1|3129456_3130920_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0R6PHE0	Moraxella_phage	27.8	8.4e-22
WP_108433725.1|3131079_3133647_+	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.8	7.1e-32
3131042:3131053	attR	TGAGCACTTGAA	NA	NA	NA	NA
WP_001141345.1|3133752_3134409_+	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	47.0	5.0e-51
WP_001295181.1|3134459_3135227_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_000847993.1|3135422_3136331_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.1e-117
WP_001521147.1|3136327_3137590_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	61.4	1.3e-135
WP_001278994.1|3137586_3138225_+	aldolase	NA	A0A077SK32	Escherichia_phage	75.0	1.4e-82
>prophage 12
NZ_CP047609	Escherichia coli strain NMBU_ W06E18 chromosome, complete genome	5248629	4898721	4967141	5248629	protease,transposase,holin,tRNA	uncultured_Caudovirales_phage(17.65%)	55	NA	NA
WP_001162173.1|4898721_4900074_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232246.1|4900257_4900644_+	cytochrome b562	NA	NA	NA	NA	NA
WP_000212715.1|4900835_4901078_+	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	50.0	1.4e-14
WP_001105433.1|4901067_4901358_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	63.8	3.8e-27
WP_001009182.1|4901358_4901823_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	K4F9T1	Cronobacter_phage	57.1	8.5e-53
WP_000187798.1|4902007_4904146_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_021523332.1|4904539_4906195_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_021523333.1|4906244_4907666_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181324.1|4907784_4908732_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	7.9e-13
WP_001387276.1|4908916_4908970_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_000471850.1|4909110_4911807_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.3	3.4e-45
WP_000047539.1|4912012_4912399_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|4912471_4912933_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|4912945_4913881_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|4913884_4914019_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230281.1|4914299_4914695_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500687.1|4914825_4915539_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256681.1|4915609_4916203_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001326836.1|4916347_4916800_+	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_000036448.1|4916922_4918518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012907.1|4918573_4919578_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
WP_000002953.1|4919739_4920156_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059412.1|4920201_4920705_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016245205.1|4920897_4922094_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416387.1|4922149_4925005_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.3e-140
WP_000786399.1|4925004_4925448_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_029701911.1|4925801_4927313_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	3.0e-46
WP_000584114.1|4927579_4928680_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|4928679_4929762_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_021523335.1|4929922_4931425_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	43.9	1.4e-83
WP_001309159.1|4931502_4932501_-	DNA-binding transcriptional regulator IdnR	NA	NA	NA	NA	NA
WP_001128347.1|4932567_4933887_-	gnt-II system L-idonate transporter	NA	NA	NA	NA	NA
WP_000998695.1|4933949_4934714_-	gluconate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_001197411.1|4934737_4935769_-	L-idonate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000896738.1|4935985_4936549_+	gluconokinase	NA	NA	NA	NA	NA
WP_001318460.1|4936552_4937572_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.7	1.4e-44
WP_024166525.1|4942129_4943476_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000611568.1|4945312_4946431_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_000594405.1|4946473_4946599_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000254999.1|4946651_4946909_-	hypothetical protein	NA	NA	NA	NA	NA
WP_085948656.1|4947222_4948389_+|transposase	IS3-like element IS911 family transposase	transposase	Q716C2	Shigella_phage	99.3	1.8e-184
WP_000625671.1|4948324_4948738_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293436.1|4948800_4950798_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_085947616.1|4950951_4952108_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.6e-68
WP_000177057.1|4953041_4953299_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|4953855_4954623_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684855.1|4954623_4955580_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	2.4e-17
WP_000125187.1|4955576_4956575_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879164.1|4956571_4957474_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_000188262.1|4957518_4959843_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
WP_001068913.1|4959929_4960883_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|4960879_4961401_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|4963150_4963408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823243.1|4964158_4965517_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_000998019.1|4965755_4967141_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.3	3.4e-259
