The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP048103	Kroppenstedtia eburnea strain DSM 45196 chromosome, complete genome	3564999	24170	76063	3564999	tail,holin,integrase	Bacillus_phage(18.18%)	64	23386:23407	76890:76911
23386:23407	attL	TCATACCCATAGGGCACAAGTC	NA	NA	NA	NA
WP_076523642.1|24170_24983_+	metal ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	36.0	9.1e-18
WP_009710607.1|24979_25843_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_009710608.1|25846_26287_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_040388243.1|26317_26758_+	nucleoside deaminase	NA	S4VYT2	Pandoravirus	37.6	1.0e-07
WP_076523641.1|27002_28160_-|integrase	site-specific integrase	integrase	A0A1B0T6A8	Bacillus_phage	42.1	3.6e-76
WP_076523639.1|28203_28827_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A8WEK1	Clostridium_phage	31.0	7.0e-10
WP_076523637.1|28919_29243_-	helix-turn-helix transcriptional regulator	NA	A0A0A8WE28	Clostridium_phage	40.7	4.9e-15
WP_076523635.1|29417_29639_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_084189848.1|29661_29955_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_076523633.1|30477_30792_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076523631.1|30875_31865_+	winged helix-turn-helix domain-containing protein	NA	D2XR43	Bacillus_phage	70.4	7.3e-54
WP_084189847.1|31782_32649_+	ATP-binding protein	NA	A0A0A0YRV1	Pseudomonas_phage	37.0	2.0e-10
WP_076523629.1|32713_32923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076523628.1|32926_33142_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076523626.1|33157_33766_+	dUTP diphosphatase	NA	R9TQ23	Paenibacillus_phage	45.5	5.4e-39
WP_076523625.1|33765_34011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076523623.1|34070_34283_+	hypothetical protein	NA	A0A2P1CEV8	Mycobacterium_phage	49.2	2.2e-08
WP_076523621.1|35108_35408_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143457033.1|35515_35755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159439665.1|36320_36473_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076523613.1|36456_37023_+	sigma-70 family RNA polymerase sigma factor	NA	A0A0E3D9C3	Bacillus_phage	28.4	9.2e-09
WP_076523612.1|37141_37648_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076523610.1|37798_38233_+	DUF488 domain-containing protein	NA	A0A1B3AYW8	Gordonia_phage	35.0	1.1e-14
WP_076523609.1|38219_39044_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076523607.1|39279_39975_+	site-specific DNA-methyltransferase	NA	Q775B4	Bordetella_phage	37.2	4.9e-28
WP_076523605.1|40327_41038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_084189845.1|41051_41720_+	class D sortase	NA	NA	NA	NA	NA
WP_076523603.1|41742_42018_+	HU family DNA-binding protein	NA	A0A0H3UZA0	Geobacillus_virus	53.9	1.1e-18
WP_076523601.1|42082_42673_+	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_076523599.1|42740_43226_+	hypothetical protein	NA	G3MB11	Bacillus_virus	38.9	1.1e-07
WP_159439664.1|43684_44548_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1S5SEW7	Streptococcus_phage	29.8	1.4e-08
WP_076523595.1|44604_44922_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076523593.1|44918_45722_+	conjugal transfer protein	NA	NA	NA	NA	NA
WP_076523591.1|45735_46032_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076523589.1|46038_46518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076523586.1|46558_49195_+	ATP-binding protein	NA	NA	NA	NA	NA
WP_076523583.1|49212_49659_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076523581.1|49655_51617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076523579.1|51613_52231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_143457032.1|52277_53246_+	CHAP domain-containing protein	NA	A0A1X9SGZ2	Bradyrhizobium_phage	39.2	6.6e-15
WP_172998880.1|53539_53917_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076523573.1|53950_56449_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076523571.1|56638_57925_+	replication-relaxation family protein	NA	NA	NA	NA	NA
WP_076523569.1|58176_58779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076523567.1|58756_59047_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_076523565.1|59864_60068_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_076523564.1|60258_60564_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076523562.1|60644_60851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076523560.1|60908_61883_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172998881.1|62086_62389_+	hypothetical protein	NA	NA	NA	NA	NA
WP_159439663.1|62827_63001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076523554.1|64021_64462_+	hypothetical protein	NA	A0A0K2CNQ1	Brevibacillus_phage	36.2	1.4e-09
WP_143457030.1|64613_64964_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_076523550.1|64990_65437_+	hypothetical protein	NA	A0A0F7L8S7	uncultured_marine_virus	29.1	7.5e-06
WP_076523548.1|65460_65829_+	hypothetical protein	NA	A0A0K2CZI8	Paenibacillus_phage	31.6	8.9e-05
WP_084189841.1|65825_66095_+|tail	phage tail assembly chaperone	tail	NA	NA	NA	NA
WP_076523544.1|66089_66416_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076523542.1|66500_66827_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076523540.1|66922_67249_-	hypothetical protein	NA	NA	NA	NA	NA
WP_076523539.1|67324_69019_+	hypothetical protein	NA	S5MBW5	Brevibacillus_phage	46.9	2.2e-18
WP_076523537.1|69015_72408_+|tail	phage tail family protein	tail	NA	NA	NA	NA
WP_076523535.1|72409_75403_+|tail	phage tail protein	tail	A0A0A1ELH9	Lactobacillus_phage	30.3	1.1e-28
WP_076523533.1|75399_75684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_076523531.1|75667_76063_+|holin	holin family protein	holin	D0R7H7	Paenibacillus_phage	54.2	6.8e-35
76890:76911	attR	TCATACCCATAGGGCACAAGTC	NA	NA	NA	NA
>prophage 2
NZ_CP048103	Kroppenstedtia eburnea strain DSM 45196 chromosome, complete genome	3564999	451257	461809	3564999		Cyanophage(25.0%)	9	NA	NA
WP_009711134.1|451257_452553_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.6	5.3e-20
WP_076525633.1|452717_453437_+	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	A0A1D7SJU7	Cyanophage	45.0	2.0e-48
WP_076525635.1|453429_453681_+	phosphoribosylformylglycinamidine synthase subunit PurS	NA	A0A0E3FJ99	Synechococcus_phage	36.2	1.8e-09
WP_009711137.1|453683_454367_+	phosphoribosylformylglycinamidine synthase subunit PurQ	NA	NA	NA	NA	NA
WP_143457149.1|454377_456642_+	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	43.0	4.3e-166
WP_076525637.1|456611_458048_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	33.5	4.2e-50
WP_076525639.1|458044_459079_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SR00	Cyanophage	43.2	1.9e-68
WP_076525641.1|459075_459666_+	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	39.8	1.1e-28
WP_076525643.1|460231_461809_+	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	50.3	6.8e-70
>prophage 3
NZ_CP048103	Kroppenstedtia eburnea strain DSM 45196 chromosome, complete genome	3564999	522568	530138	3564999		Staphylococcus_phage(50.0%)	7	NA	NA
WP_052529053.1|522568_523414_-	YitT family protein	NA	M1Q1P6	Streptococcus_phage	31.1	2.0e-36
WP_040388358.1|523585_524206_-	uridine kinase	NA	A0A1V0SAA3	Catovirus	40.7	9.6e-36
WP_076525697.1|524582_526160_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	58.0	1.0e-182
WP_009711214.1|526368_526743_+	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_076525699.1|526857_528426_-	protein kinase	NA	A0A1V0SDC3	Indivirus	28.2	2.9e-20
WP_076525701.1|528540_529143_-	methyltransferase domain-containing protein	NA	A0A2H4PQV0	Staphylococcus_phage	36.5	1.4e-26
WP_076525703.1|529139_530138_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	60.3	1.8e-44
>prophage 4
NZ_CP048103	Kroppenstedtia eburnea strain DSM 45196 chromosome, complete genome	3564999	682983	691587	3564999		Pseudomonas_phage(33.33%)	8	NA	NA
WP_076525921.1|682983_684135_-	hypothetical protein	NA	A0A125RNN9	Pseudomonas_phage	27.1	6.0e-07
WP_076525800.1|684149_685556_-	MBOAT family protein	NA	A0A125RNP0	Pseudomonas_phage	34.8	2.3e-61
WP_076525802.1|685588_686266_-	lysophospholipase	NA	NA	NA	NA	NA
WP_076525804.1|686281_686926_-	N-acetylmuramoyl-L-alanine amidase	NA	E5DV68	Deep-sea_thermophilic_phage	38.6	2.2e-22
WP_076525806.1|687110_688934_-	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.5	2.9e-32
WP_076525808.1|688930_689608_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	37.6	6.2e-36
WP_076525810.1|689794_690370_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_076525812.1|690786_691587_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	32.3	2.3e-21
>prophage 5
NZ_CP048103	Kroppenstedtia eburnea strain DSM 45196 chromosome, complete genome	3564999	962024	969608	3564999		Planktothrix_phage(16.67%)	10	NA	NA
WP_009711679.1|962024_963059_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.0	7.0e-15
WP_009711680.1|963055_964069_+	ATP-binding cassette domain-containing protein	NA	M1IB70	Acanthocystis_turfacea_Chlorella_virus	24.7	6.2e-08
WP_009711681.1|964349_964571_-	NifU family protein	NA	Q58MC7	Prochlorococcus_phage	48.6	8.5e-11
WP_076524433.1|964813_965740_+	cysteine synthase family protein	NA	A0A1X9I5F1	Streptococcus_phage	47.0	1.3e-73
WP_009711683.1|965743_966877_+	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	A0A0B5JD48	Pandoravirus	29.2	1.4e-19
WP_009711684.1|966897_967230_+	YuzD family protein	NA	NA	NA	NA	NA
WP_009711685.1|967314_967923_-	class D sortase	NA	NA	NA	NA	NA
WP_009711687.1|968184_968445_+	YuzB family protein	NA	NA	NA	NA	NA
WP_076524431.1|968891_969128_+	Spo0E family sporulation regulatory protein-aspartic acid phosphatase	NA	NA	NA	NA	NA
WP_076524430.1|969251_969608_+	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	45.2	1.6e-19
>prophage 6
NZ_CP048103	Kroppenstedtia eburnea strain DSM 45196 chromosome, complete genome	3564999	1213588	1223874	3564999		Saccharomonospora_phage(16.67%)	8	NA	NA
WP_076525178.1|1213588_1217071_+	DNA polymerase III subunit alpha	NA	Q8W6C3	Saccharomonospora_phage	37.9	7.7e-223
WP_009711955.1|1217107_1217626_+	phosphatidylglycerophosphatase A	NA	G3MBC5	Bacillus_virus	52.3	4.6e-39
WP_009711956.1|1217901_1218636_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_052528953.1|1218654_1219362_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_172998952.1|1219358_1220267_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	44.9	9.8e-45
WP_009711959.1|1220356_1221445_-	HAMP domain-containing histidine kinase	NA	A0A1B0VMK3	Pseudomonas_phage	25.0	1.5e-07
WP_009711960.1|1221441_1222164_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	36.0	8.9e-33
WP_084190079.1|1222548_1223874_+	glycerate kinase	NA	W6LM47	Streptococcus_phage	34.3	1.1e-39
>prophage 7
NZ_CP048103	Kroppenstedtia eburnea strain DSM 45196 chromosome, complete genome	3564999	1708440	1718856	3564999		Staphylococcus_phage(50.0%)	11	NA	NA
WP_052528600.1|1708440_1709517_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A1W6JQH9	Corynebacterium_phage	45.2	3.9e-16
WP_009708444.1|1709772_1710732_+	heme A synthase	NA	NA	NA	NA	NA
WP_040387873.1|1711135_1712236_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	32.5	1.6e-54
WP_009708447.1|1712254_1712896_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	36.7	5.7e-31
WP_076522837.1|1712882_1714082_+	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	53.3	3.3e-117
WP_040387874.1|1714463_1714958_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	60.7	2.8e-38
WP_009708450.1|1714974_1715766_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	31.7	1.4e-07
WP_052528602.1|1715734_1716388_+	SMC-Scp complex subunit ScpB	NA	A0A1B1IVT7	uncultured_Mediterranean_phage	32.7	5.2e-16
WP_159439645.1|1716494_1717184_+	DUF2953 domain-containing protein	NA	NA	NA	NA	NA
WP_009708453.1|1717156_1717609_+	sporulation protein YtfJ	NA	NA	NA	NA	NA
WP_009708454.1|1717722_1718856_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	30.7	2.0e-26
