The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053617	Achromobacter xylosoxidans strain GN050 chromosome, complete genome	6452474	1166620	1224917	6452474	tRNA,portal,plate,integrase,holin,head,capsid,terminase,tail	Burkholderia_phage(21.43%)	58	1187163:1187189	1233687:1233713
WP_172999732.1|1166620_1167664_+|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_172999733.1|1167975_1171323_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_172999734.1|1171345_1174537_-	response regulator	NA	A0A1V0SGX0	Hokovirus	39.7	8.5e-35
WP_006387688.1|1174678_1175953_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_172999735.1|1175949_1178727_-	response regulator	NA	Q8QKV7	Ectocarpus_siliculosus_virus	29.2	3.7e-34
WP_026385065.1|1179275_1179683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026385066.1|1179756_1180095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_047991434.1|1180382_1181108_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_026385068.1|1181104_1182142_+	c-type cytochrome	NA	NA	NA	NA	NA
WP_172999736.1|1182193_1183168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045953287.1|1183164_1183326_+	cbb3-type cytochrome oxidase assembly protein CcoS	NA	NA	NA	NA	NA
WP_047991436.1|1183402_1184869_+	cytochrome-c oxidase, cbb3-type subunit I	NA	NA	NA	NA	NA
WP_172999737.1|1184879_1185569_+	cytochrome-c oxidase, cbb3-type subunit II	NA	NA	NA	NA	NA
WP_080945047.1|1185568_1185745_+	cytochrome oxidase	NA	NA	NA	NA	NA
WP_150100863.1|1185741_1186695_+	cytochrome-c oxidase, cbb3-type subunit III	NA	NA	NA	NA	NA
WP_058207469.1|1186705_1188196_+	cytochrome c oxidase accessory protein CcoG	NA	NA	NA	NA	NA
1187163:1187189	attL	ACCGCGTCGCCCGCATCCGCCTGGACG	NA	NA	NA	NA
WP_081398519.1|1188248_1188452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172999738.1|1188809_1190363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172999739.1|1190592_1190880_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172999740.1|1190962_1191988_-|portal	phage portal protein	portal	E5E3X1	Burkholderia_phage	64.8	4.7e-128
WP_172999741.1|1191984_1193739_-|terminase	terminase ATPase subunit family protein	terminase	A4JWQ1	Burkholderia_virus	67.2	5.6e-230
WP_172999742.1|1193879_1194743_+|capsid	GPO family capsid scaffolding protein	capsid	E5FFI7	Burkholderia_phage	45.7	1.7e-51
WP_172999743.1|1194787_1195795_+|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	61.2	2.6e-115
WP_172999744.1|1195797_1196493_+	hypothetical protein	NA	A0A2H4J948	uncultured_Caudovirales_phage	41.3	7.5e-37
WP_172999745.1|1196585_1197056_+|head	head completion/stabilization protein	head	A4PE32	Ralstonia_virus	52.9	9.5e-36
WP_006390738.1|1197055_1197262_+|tail	tail protein X	tail	A0A2H4J946	uncultured_Caudovirales_phage	59.1	1.1e-15
WP_172999746.1|1197267_1197630_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172999747.1|1197626_1197926_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_172999748.1|1197918_1198728_+	DUF3380 domain-containing protein	NA	E5FFI0	Burkholderia_phage	56.3	4.3e-76
WP_172999749.1|1198724_1199147_+	hypothetical protein	NA	E5G6N2	Salmonella_phage	38.5	1.5e-08
WP_172999750.1|1199245_1199749_+|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	52.5	1.4e-32
WP_172999751.1|1199741_1200203_+	phage virion morphogenesis protein	NA	E5FFH6	Burkholderia_phage	50.0	8.5e-29
WP_172999752.1|1200264_1200900_+|plate	phage baseplate assembly protein V	plate	A0A077K9S0	Ralstonia_phage	52.2	2.2e-51
WP_068980947.1|1200911_1201253_+	GPW/gp25 family protein	NA	E5E3V5	Burkholderia_phage	53.2	1.4e-17
WP_172999753.1|1201254_1202172_+|plate	baseplate J/gp47 family protein	plate	A0A077K9X9	Ralstonia_phage	55.6	1.3e-76
WP_173001466.1|1202155_1202794_+|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	56.4	7.1e-50
WP_172999754.1|1204196_1204442_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172999755.1|1204590_1205772_+|tail	phage tail sheath protein	tail	A0A077K9Y4	Ralstonia_phage	65.2	2.3e-147
WP_172999756.1|1205829_1206345_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	55.8	5.0e-46
WP_172999757.1|1206367_1206727_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	42.9	1.6e-14
WP_172999758.1|1206735_1206852_+|tail	GpE family phage tail protein	tail	E5FFG6	Burkholderia_phage	75.8	8.6e-07
WP_172999759.1|1206855_1209594_+|tail	phage tail tape measure protein	tail	A0A2H4JE61	uncultured_Caudovirales_phage	42.4	1.5e-173
WP_172999760.1|1209606_1210062_+|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	52.0	6.2e-32
WP_104010690.1|1210061_1211147_+	late control protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	49.8	6.8e-85
WP_172999761.1|1211158_1211449_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172999762.1|1211579_1211894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172999763.1|1211922_1212327_-	helix-turn-helix transcriptional regulator	NA	A4JWR8	Burkholderia_virus	50.0	1.0e-14
WP_070761341.1|1212630_1212918_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_159070769.1|1212907_1213294_+	hypothetical protein	NA	NA	NA	NA	NA
WP_070761337.1|1213380_1213614_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172999764.1|1213858_1214119_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_172999765.1|1214120_1216949_+	toprim domain-containing protein	NA	A4PE69	Ralstonia_virus	47.7	9.2e-243
WP_172999766.1|1217530_1218814_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	B7SYF8	Stenotrophomonas_phage	44.0	1.9e-86
WP_006387677.1|1219169_1220435_-	aspartate kinase	NA	NA	NA	NA	NA
WP_172999767.1|1220651_1221734_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_024069860.1|1221795_1222761_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_006386554.1|1222797_1223442_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_172999768.1|1223462_1224917_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	29.5	1.0e-35
1233687:1233713	attR	ACCGCGTCGCCCGCATCCGCCTGGACG	NA	NA	NA	NA
>prophage 2
NZ_CP053617	Achromobacter xylosoxidans strain GN050 chromosome, complete genome	6452474	2353689	2438723	6452474	coat,tail,integrase	Burkholderia_virus(23.81%)	79	2353500:2353554	2369462:2369516
2353500:2353554	attL	GACTCAAAATCCCCCGCCGCAAGGCGTGCCGGTTCGATTCCGGCCCCGGGCACCA	NA	NA	NA	NA
WP_173000022.1|2353689_2354817_+|integrase	site-specific integrase	integrase	A0A1L7DQ84	Ralstonia_phage	36.6	8.1e-49
WP_173000023.1|2354878_2355505_+	hypothetical protein	NA	NA	NA	NA	NA
WP_130357495.1|2355700_2356567_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080564224.1|2356664_2356964_-	hypothetical protein	NA	NA	NA	NA	NA
WP_035182024.1|2357375_2358080_-	metallophosphoesterase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	49.4	1.9e-56
WP_035182023.1|2358503_2358773_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173000024.1|2358769_2359780_+	hypothetical protein	NA	NA	NA	NA	NA
WP_033457332.1|2359776_2360316_+	plasmid mobilization relaxosome protein MobC	NA	NA	NA	NA	NA
WP_006385715.1|2360312_2361308_+	relaxase/mobilization nuclease domain-containing protein	NA	NA	NA	NA	NA
WP_006385714.1|2361312_2361591_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173000025.1|2361847_2362573_+	P-type DNA transfer protein VirB5	NA	NA	NA	NA	NA
WP_006385712.1|2362583_2363030_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006385711.1|2363026_2363287_+	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_006385710.1|2363288_2364341_+	type IV secretion system protein	NA	NA	NA	NA	NA
WP_050807714.1|2364992_2365226_+	antitoxin VbhA family protein	NA	NA	NA	NA	NA
WP_102773540.1|2365473_2369277_+	SIR2 family protein	NA	NA	NA	NA	NA
WP_054446746.1|2369571_2369874_-	putative addiction module antidote protein	NA	A4JWV1	Burkholderia_virus	47.1	1.7e-14
2369462:2369516	attR	GACTCAAAATCCCCCGCCGCAAGGCGTGCCGGTTCGATTCCGGCCCCGGGCACCA	NA	NA	NA	NA
WP_173001488.1|2369870_2370179_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	A0A141GEX6	Brucella_phage	51.0	3.0e-22
WP_173000026.1|2370544_2371147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173000027.1|2371193_2371541_-	YXWGXW repeat-containing protein	NA	NA	NA	NA	NA
WP_006385707.1|2371832_2372849_+	amino acid ABC transporter substrate-binding protein	NA	A0A1B1IT51	uncultured_Mediterranean_phage	39.0	5.0e-66
WP_082387743.1|2372995_2373982_-	DUF3578 domain-containing protein	NA	NA	NA	NA	NA
WP_006385706.1|2374219_2374501_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_173000028.1|2374848_2375784_+	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_173000029.1|2375836_2377036_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_006385703.1|2377066_2377885_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	49.3	1.4e-10
WP_024070526.1|2377903_2378833_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006385701.1|2378974_2379571_-|tail	tail assembly protein	tail	C7BGD3	Burkholderia_phage	53.0	1.9e-49
WP_024070527.1|2379567_2379804_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173000030.1|2379784_2380156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173001489.1|2380161_2383665_-	host specificity protein J	NA	A4JX16	Burkholderia_virus	45.2	1.9e-261
WP_006385697.1|2383790_2384396_-|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	55.7	1.0e-50
WP_006385696.1|2384392_2385172_-	C40 family peptidase	NA	Q3HQU3	Burkholderia_phage	47.3	1.5e-65
WP_006385695.1|2385174_2385903_-|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	58.3	2.2e-71
WP_173000031.1|2385905_2387867_-|tail	tail fiber domain-containing protein	tail	A0A0K0KVF1	Prochlorococcus_phage	36.2	8.7e-14
WP_080684394.1|2387863_2388208_-|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	38.4	4.8e-21
WP_054448641.1|2388204_2389491_-|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	30.3	2.2e-13
WP_173000032.1|2389548_2389839_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	50.0	1.2e-12
WP_054497360.1|2389838_2390312_-|tail	phage tail protein	tail	A4JX08	Burkholderia_virus	44.4	1.8e-26
WP_006385689.1|2390317_2390785_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102949899.1|2391034_2391604_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104413547.1|2391978_2392596_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_173000033.1|2392648_2394106_-	DUF1254 domain-containing protein	NA	M1IA53	Paramecium_bursaria_Chlorella_virus	35.4	6.8e-64
WP_006385685.1|2394293_2394842_-	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_173000034.1|2394838_2395078_-	DUF3596 domain-containing protein	NA	A0A1W6JTA0	Pseudomonas_phage	54.3	5.9e-10
WP_047991980.1|2395223_2395604_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_035199508.1|2395659_2396853_-	MFS transporter	NA	NA	NA	NA	NA
WP_173000035.1|2396994_2398416_-	HAMP domain-containing histidine kinase	NA	NA	NA	NA	NA
WP_173000036.1|2398481_2399120_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_026382524.1|2399412_2399970_+	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_173000037.1|2400172_2403274_+	WG repeat-containing protein	NA	NA	NA	NA	NA
WP_173000038.1|2403270_2406147_+	WG repeat-containing protein	NA	NA	NA	NA	NA
WP_054470649.1|2406190_2407051_-	isocitrate lyase/phosphoenolpyruvate mutase family protein	NA	NA	NA	NA	NA
WP_035199499.1|2407155_2408034_+	LysR family transcriptional regulator	NA	A0A2P0ZL89	Lactobacillus_phage	21.7	2.3e-06
WP_006385675.1|2408118_2408934_-	siderophore-interacting protein	NA	NA	NA	NA	NA
WP_080684395.1|2408960_2409440_-	PadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173000039.1|2409905_2410823_-	DMT family transporter	NA	NA	NA	NA	NA
WP_026382529.1|2410902_2411757_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_173000040.1|2411935_2413381_+	MFS transporter	NA	NA	NA	NA	NA
WP_173000041.1|2413395_2414202_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_024070549.1|2414220_2415369_-	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_173000042.1|2415589_2417017_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_173000043.1|2417056_2418139_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_054439073.1|2418161_2419250_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.6	6.2e-30
WP_054482505.1|2419254_2421030_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_006386243.1|2421066_2421969_+	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_024070553.1|2422020_2422848_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_006386241.1|2423052_2423820_-	phytanoyl-CoA dioxygenase family protein	NA	NA	NA	NA	NA
WP_006386240.1|2423932_2425054_-	AI-2E family transporter	NA	NA	NA	NA	NA
WP_020926131.1|2425232_2426297_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006386238.1|2426694_2427885_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_173000044.1|2427921_2431137_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	23.4	2.4e-05
WP_173000045.1|2431205_2432693_+	efflux transporter outer membrane subunit	NA	NA	NA	NA	NA
WP_053074792.1|2432801_2433761_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_173000046.1|2433772_2436241_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_047992125.1|2436248_2437022_-	molecular chaperone	NA	NA	NA	NA	NA
WP_080969345.1|2437033_2437585_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_053074795.1|2437578_2438103_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_047991996.1|2438153_2438723_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 3
NZ_CP053617	Achromobacter xylosoxidans strain GN050 chromosome, complete genome	6452474	4847551	4902499	6452474	tRNA,protease,plate,transposase,tail	Burkholderia_phage(35.29%)	57	NA	NA
WP_020924482.1|4847551_4849012_+|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_054437279.1|4849281_4850355_+	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	47.0	6.1e-78
WP_006388442.1|4850453_4851863_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_006388443.1|4852129_4853629_+	FAD-binding protein	NA	NA	NA	NA	NA
WP_024068247.1|4853641_4854745_+	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_173000932.1|4854750_4855980_+	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_006388446.1|4856074_4857514_-	NAD(P)(+) transhydrogenase (Re/Si-specific) subunit beta	NA	NA	NA	NA	NA
WP_006388447.1|4857510_4857828_-	NAD(P) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_024068250.1|4857832_4858951_-	Re/Si-specific NAD(P)(+) transhydrogenase subunit alpha	NA	NA	NA	NA	NA
WP_006388449.1|4859136_4860012_-	N-formylglutamate amidohydrolase	NA	NA	NA	NA	NA
WP_006388450.1|4860082_4861072_-	tripartite tricarboxylate transporter substrate binding protein BugE	NA	NA	NA	NA	NA
WP_006388451.1|4861263_4862184_+	transcriptional regulator GcvA	NA	Q6JIH3	Burkholderia_virus	31.5	3.1e-30
WP_006388452.1|4862196_4863315_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_173000933.1|4863437_4864256_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_006388454.1|4864317_4864929_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_006388455.1|4865090_4866467_+	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	47.7	2.0e-110
WP_006388456.1|4866523_4866982_+	cytochrome c	NA	NA	NA	NA	NA
WP_173000934.1|4867109_4867802_-	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_006388458.1|4867911_4868193_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006388459.1|4869027_4869387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006388461.1|4869565_4870078_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_173000935.1|4870241_4870946_+	DUF3053 family protein	NA	NA	NA	NA	NA
WP_006388463.1|4871103_4872225_+	AI-2E family transporter	NA	NA	NA	NA	NA
WP_173000936.1|4872393_4872615_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173000937.1|4872688_4874506_-	DUF4153 domain-containing protein	NA	NA	NA	NA	NA
WP_006388466.1|4874510_4875272_-	S24 family peptidase	NA	NA	NA	NA	NA
WP_006388467.1|4875581_4875839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_150101598.1|4876331_4876925_+	hypothetical protein	NA	A9YX29	Burkholderia_phage	46.1	2.9e-45
WP_173000938.1|4876935_4878411_+	DUF3383 domain-containing protein	NA	A0A0P0I492	Acinetobacter_phage	48.3	1.8e-112
WP_006388470.1|4878424_4878865_+	DUF3277 family protein	NA	A0A0P0IKY2	Acinetobacter_phage	54.1	3.1e-36
WP_024068262.1|4878868_4879318_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	36.5	1.1e-17
WP_173000939.1|4879495_4881169_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_107316010.1|4881161_4881761_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006388474.1|4881770_4882070_+	hypothetical protein	NA	NA	NA	NA	NA
WP_112957389.1|4882089_4883100_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	50.0	1.8e-76
WP_054499334.1|4883134_4883878_+	hypothetical protein	NA	A9YX06	Burkholderia_phage	63.5	4.3e-83
WP_020924456.1|4883886_4884240_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	66.7	6.1e-35
WP_054496612.1|4884236_4885418_+|plate	baseplate J/gp47 family protein	plate	A9YX12	Burkholderia_phage	62.8	3.4e-130
WP_024068268.1|4885419_4886085_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	60.6	9.6e-74
WP_054506904.1|4886099_4887068_+|tail	tail fiber protein	tail	A0A0M3ULD8	Salmonella_phage	54.1	6.0e-16
WP_053074863.1|4887080_4887518_+|tail	tail fiber assembly protein	tail	A0A2P1JUG3	Erwinia_phage	31.0	1.7e-07
WP_164497481.1|4887654_4888146_+	hypothetical protein	NA	A0A0U5LBV3	unidentified_phage	37.2	6.3e-14
WP_173000940.1|4888135_4888666_+	hypothetical protein	NA	A0A2H4JFP9	uncultured_Caudovirales_phage	56.8	4.5e-42
WP_054443028.1|4888646_4888919_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173000941.1|4889261_4890839_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_026384169.1|4890873_4891134_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173001512.1|4891305_4892214_+	aromatic amino acid DMT transporter YddG	NA	NA	NA	NA	NA
WP_006388489.1|4892232_4892424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053500134.1|4892671_4892926_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006388491.1|4893055_4893247_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049050697.1|4893406_4894318_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173000942.1|4894714_4896031_-	ergothioneine biosynthesis protein EgtB	NA	NA	NA	NA	NA
WP_054472044.1|4896068_4897046_-	L-histidine N(alpha)-methyltransferase	NA	NA	NA	NA	NA
WP_006388499.1|4897425_4897758_+	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_173000943.1|4897856_4899236_+	cardiolipin synthase B	NA	NA	NA	NA	NA
WP_173000944.1|4899267_4900938_-	FMN-binding glutamate synthase family protein	NA	NA	NA	NA	NA
WP_102964912.1|4901132_4902499_-|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	53.8	5.5e-76
