The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053618	Achromobacter xylosoxidans strain GN008 chromosome, complete genome	6608203	1565831	1582879	6608203	tail	Burkholderia_virus(33.33%)	18	NA	NA
WP_006385703.1|1565831_1566650_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	49.3	1.4e-10
WP_053497395.1|1566668_1567598_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006385701.1|1567739_1568336_-|tail	tail assembly protein	tail	C7BGD3	Burkholderia_phage	53.0	1.9e-49
WP_024070527.1|1568332_1568569_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049055152.1|1568549_1568921_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173011249.1|1568926_1572430_-	host specificity protein J	NA	A4JX16	Burkholderia_virus	45.0	1.6e-260
WP_006385697.1|1572555_1573161_-|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	55.7	1.0e-50
WP_006385696.1|1573157_1573937_-	C40 family peptidase	NA	Q3HQU3	Burkholderia_phage	47.3	1.5e-65
WP_006385695.1|1573939_1574668_-|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	58.3	2.2e-71
WP_173010551.1|1574670_1576632_-|tail	tail fiber domain-containing protein	tail	A0A0K0KVF1	Prochlorococcus_phage	36.2	1.9e-13
WP_080684394.1|1576628_1576973_-|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	38.4	4.8e-21
WP_054448641.1|1576969_1578256_-|tail	phage tail tape measure protein	tail	A0A1W6JP49	Morganella_phage	30.3	2.2e-13
WP_006385691.1|1578313_1578604_-	DUF4035 domain-containing protein	NA	S4TND7	Salmonella_phage	50.0	9.1e-13
WP_024070536.1|1578603_1579077_-|tail	Phage tail assembly chaperone	tail	A4JX08	Burkholderia_virus	45.1	4.8e-27
WP_006385689.1|1579082_1579550_-	hypothetical protein	NA	NA	NA	NA	NA
WP_102949899.1|1579799_1580369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054448642.1|1580665_1581361_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_173010552.1|1581421_1582879_-	DUF1254 domain-containing protein	NA	M1IA53	Paramecium_bursaria_Chlorella_virus	35.4	1.5e-63
>prophage 2
NZ_CP053618	Achromobacter xylosoxidans strain GN008 chromosome, complete genome	6608203	4171644	4183031	6608203	tail,integrase	Burkholderia_phage(44.44%)	13	4166652:4166667	4182530:4182545
4166652:4166667	attL	GCTGCGGCCGGCGATG	NA	NA	NA	NA
WP_024068262.1|4171644_4172094_+	hypothetical protein	NA	A0A0N7IRF3	Acinetobacter_phage	36.5	1.1e-17
WP_173010862.1|4172271_4173945_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_026384173.1|4173937_4174537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006388474.1|4174546_4174846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054437471.1|4174865_4175876_+	hypothetical protein	NA	A9YX04	Burkholderia_phage	50.3	4.8e-77
WP_020924456.1|4176661_4177015_+	hypothetical protein	NA	A9YX11	Burkholderia_phage	66.7	6.1e-35
WP_173010863.1|4177011_4178193_+	hypothetical protein	NA	A9YX12	Burkholderia_phage	62.6	7.5e-130
WP_020924454.1|4178194_4178860_+	DUF2612 domain-containing protein	NA	A9YX13	Burkholderia_phage	60.2	2.8e-73
WP_173010864.1|4178874_4179822_+	hypothetical protein	NA	A0A0M3ULD8	Salmonella_phage	52.9	1.7e-15
WP_070780627.1|4180488_4180839_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_173010865.1|4180841_4181864_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JE37	uncultured_Caudovirales_phage	32.3	8.2e-24
WP_164497481.1|4182019_4182511_+	hypothetical protein	NA	A0A0U5LBV3	unidentified_phage	37.2	6.3e-14
WP_020924452.1|4182500_4183031_+	hypothetical protein	NA	A0A2H4JFP9	uncultured_Caudovirales_phage	58.0	1.8e-43
4182530:4182545	attR	GCTGCGGCCGGCGATG	NA	NA	NA	NA
>prophage 3
NZ_CP053618	Achromobacter xylosoxidans strain GN008 chromosome, complete genome	6608203	5035629	5043565	6608203	tRNA	Moraxella_phage(33.33%)	9	NA	NA
WP_006388149.1|5035629_5036217_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	36.8	1.2e-19
WP_006388150.1|5036250_5036625_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	27.8	1.9e-10
WP_006388151.1|5036822_5037845_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_054438380.1|5038223_5038580_+	VOC family protein	NA	NA	NA	NA	NA
WP_006388153.1|5038664_5039957_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	36.3	5.4e-65
WP_006388154.1|5040066_5041098_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.6	1.4e-92
WP_006388155.1|5041167_5041809_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_020927471.1|5041997_5042756_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	51.6	1.5e-67
WP_020927472.1|5042800_5043565_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.2	2.3e-31
>prophage 4
NZ_CP053618	Achromobacter xylosoxidans strain GN008 chromosome, complete genome	6608203	6218792	6293539	6608203	head,portal,protease,integrase,tail,capsid,terminase	uncultured_Caudovirales_phage(21.21%)	97	6247405:6247436	6295799:6295830
WP_006386181.1|6218792_6220091_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	54.1	1.7e-130
WP_006386182.1|6220192_6220846_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.7	2.2e-54
WP_006386183.1|6220850_6222161_-	trigger factor	NA	NA	NA	NA	NA
WP_006386184.1|6222329_6223085_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_006386185.1|6223347_6223893_+	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	32.7	1.3e-20
WP_006225311.1|6223991_6224198_-	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	59.7	1.4e-15
WP_172999574.1|6224490_6225054_-	DUF924 family protein	NA	A0A1V0SIY0	Klosneuvirus	41.2	3.1e-17
WP_006220190.1|6225278_6225482_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.6	7.3e-17
WP_006386188.1|6225851_6226172_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006386189.1|6226262_6226661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006386190.1|6226783_6227071_+	DUF2513 domain-containing protein	NA	NA	NA	NA	NA
WP_173011185.1|6227164_6227437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020928333.1|6227536_6227932_-	endoribonuclease L-PSP	NA	NA	NA	NA	NA
WP_173011186.1|6227958_6229107_-	DSD1 family PLP-dependent enzyme	NA	NA	NA	NA	NA
WP_173011187.1|6229253_6230171_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_020928335.1|6230353_6230752_-	RidA family protein	NA	NA	NA	NA	NA
WP_026384511.1|6230819_6232010_-	MFS transporter	NA	NA	NA	NA	NA
WP_006386197.1|6232143_6232725_+	TetR family transcriptional regulator	NA	NA	NA	NA	NA
WP_006386198.1|6232848_6233376_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020928338.1|6233446_6233752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_006386200.1|6233775_6234084_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006386201.1|6234150_6235008_-	3-deoxy-8-phosphooctulonate synthase	NA	E3T537	Cafeteria_roenbergensis_virus	41.7	1.1e-50
WP_020928339.1|6235244_6236204_+	HD domain-containing protein	NA	NA	NA	NA	NA
WP_020928340.1|6236227_6237445_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024069446.1|6237488_6238199_-	aquaporin Z	NA	A0A1B1ISL4	uncultured_Mediterranean_phage	50.0	1.2e-05
WP_006386205.1|6238341_6238923_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_024069447.1|6238924_6240481_-	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_024069448.1|6240477_6242157_-	glycerol-3-phosphate dehydrogenase/oxidase	NA	NA	NA	NA	NA
WP_006386208.1|6242153_6243692_-	glycerol kinase	NA	NA	NA	NA	NA
WP_006386209.1|6243706_6245164_-	MFS transporter	NA	NA	NA	NA	NA
WP_020928345.1|6245416_6245776_+	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_054447773.1|6245880_6246240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_054447772.1|6246252_6246765_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108914266.1|6246866_6247142_-	hypothetical protein	NA	NA	NA	NA	NA
6247405:6247436	attL	TGGTGCGAAGGAGGGGACTCGAACCCCTACAC	NA	NA	NA	NA
WP_045953215.1|6248850_6249108_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045953594.1|6249383_6249611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045953216.1|6249861_6250899_+	ParA family protein	NA	NA	NA	NA	NA
WP_020928352.1|6251394_6251661_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020928353.1|6251663_6252155_-	hypothetical protein	NA	I6NSS1	Burkholderia_phage	58.0	9.9e-44
WP_020928354.1|6252158_6252602_-	hypothetical protein	NA	A0A0U5LBV3	unidentified_phage	41.4	4.3e-14
WP_045953217.1|6252696_6253362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045953218.1|6253361_6253652_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020928355.1|6253653_6256821_-	host specificity protein J	NA	Q6JIL2	Burkholderia_virus	46.4	1.8e-266
WP_045953220.1|6256817_6257429_-|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	55.9	2.7e-54
WP_045953221.1|6257432_6258206_-	C40 family peptidase	NA	A4JX14	Burkholderia_virus	51.7	5.0e-66
WP_045953222.1|6258208_6258937_-|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	57.0	2.3e-68
WP_052719203.1|6258940_6259480_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045953223.1|6260738_6261080_-|tail	phage tail protein	tail	Q6UAW6	Klebsiella_phage	54.5	7.4e-30
WP_045953224.1|6261076_6264052_-|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	32.6	1.3e-93
WP_006387642.1|6264085_6264397_-	DUF1799 domain-containing protein	NA	NA	NA	NA	NA
WP_020928361.1|6264462_6264882_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020928362.1|6264957_6265893_-	hypothetical protein	NA	G8CLB2	Synechococcus_phage	40.9	3.8e-60
WP_020928363.1|6265925_6266129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006387638.1|6266155_6266578_-	hypothetical protein	NA	NA	NA	NA	NA
WP_006387637.1|6266574_6266877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020928365.1|6266882_6267887_-|capsid	major capsid protein	capsid	A0A2H4J890	uncultured_Caudovirales_phage	42.2	4.1e-68
WP_020928366.1|6267967_6268318_-|head	head decoration protein	head	A0A2H4JF15	uncultured_Caudovirales_phage	49.6	2.5e-17
WP_045953226.1|6268345_6269455_-|protease	Clp protease ClpP	protease	A0A2H4JDI2	uncultured_Caudovirales_phage	35.8	1.4e-45
WP_045953227.1|6269483_6270983_-|portal	phage portal protein	portal	A0A2H4JFL5	uncultured_Caudovirales_phage	50.1	1.9e-125
WP_020928369.1|6270979_6271186_-	hypothetical protein	NA	A0A2H4EUL1	Aeromonas_phage	42.6	4.5e-06
WP_080945041.1|6271233_6273228_-|terminase	phage terminase large subunit family protein	terminase	R9TMM4	Vibrio_phage	37.2	1.5e-114
WP_006387630.1|6273305_6273803_-|terminase	terminase small subunit	terminase	NA	NA	NA	NA
WP_045953229.1|6273799_6274585_-	hypothetical protein	NA	A0A1B0Z000	Pseudomonas_phage	39.7	1.5e-33
WP_144415881.1|6274925_6275657_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045953231.1|6275998_6276361_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020928373.1|6276353_6276557_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020928374.1|6276852_6277257_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020928376.1|6278269_6279010_-	phage antirepressor KilAC domain-containing protein	NA	A0A2H4IZE1	uncultured_Caudovirales_phage	44.0	5.9e-24
WP_020928377.1|6279006_6279297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045953232.1|6279293_6279704_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020928379.1|6279700_6280144_-	phage regulatory CII family protein	NA	Q3HQZ3	Burkholderia_phage	46.9	2.6e-27
WP_020928380.1|6280394_6280616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080944995.1|6280708_6280984_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_052719205.1|6281091_6281823_+	helix-turn-helix transcriptional regulator	NA	J7I4M9	Acinetobacter_phage	32.5	3.1e-25
WP_045953233.1|6282332_6282617_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020928382.1|6282648_6282813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045953234.1|6282822_6283185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020928384.1|6283264_6283555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020928385.1|6283590_6283959_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020928386.1|6283999_6284185_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045953236.1|6284186_6284390_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020928387.1|6284412_6284667_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020928388.1|6284696_6284927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_144415882.1|6285323_6285647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020928389.1|6285879_6286158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020928390.1|6286217_6286874_+	hypothetical protein	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	30.4	2.3e-11
WP_020928391.1|6286876_6287332_+	single-stranded DNA-binding protein	NA	F8TUL2	EBPR_podovirus	49.7	3.2e-36
WP_020928392.1|6287355_6287715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020928393.1|6287736_6288636_+	recombination-associated protein RdgC	NA	A0A218M310	Acidovorax_phage	38.3	1.3e-54
WP_020928394.1|6288651_6289446_+	hypothetical protein	NA	C7BGF1	Burkholderia_phage	63.8	6.5e-85
WP_045953237.1|6289442_6289649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173011188.1|6289645_6289984_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173011189.1|6290221_6290620_+	hypothetical protein	NA	NA	NA	NA	NA
WP_045953238.1|6290619_6290844_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158324534.1|6290840_6291011_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080945043.1|6291621_6292179_+	DUF550 domain-containing protein	NA	A0A1B0YZX5	Pseudomonas_phage	66.4	5.1e-36
WP_045953239.1|6292321_6293539_+|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	56.2	1.2e-117
6295799:6295830	attR	TGGTGCGAAGGAGGGGACTCGAACCCCTACAC	NA	NA	NA	NA
