The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042878	Escherichia coli strain NMBU_W05E18 chromosome, complete genome	5299922	84652	132741	5299922	holin,transposase	Stx2-converting_phage(44.44%)	41	NA	NA
WP_001550332.1|84652_86191_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	9.3e-298
WP_001075495.1|86972_87704_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000558152.1|88224_88677_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_000332862.1|89212_90148_+	pseudouridine kinase	NA	NA	NA	NA	NA
WP_001290195.1|90140_91076_+	pseudouridine-5'-phosphate glycosidase	NA	NA	NA	NA	NA
WP_001328687.1|91159_92410_+	NupC/NupG family nucleoside CNT transporter	NA	NA	NA	NA	NA
WP_000370278.1|92428_93523_-	sugar kinase	NA	NA	NA	NA	NA
WP_001126810.1|94868_95435_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_000991598.1|95692_96265_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000958091.1|96333_96570_+	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_173009491.1|96840_98172_-	D-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_000556028.1|98189_99527_-	D-serine transporter DsdX	NA	NA	NA	NA	NA
WP_000433594.1|99744_100689_+	DNA-binding transcriptional regulator DsdC	NA	NA	NA	NA	NA
WP_000481835.1|101338_101668_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000095890.1|101683_102085_-	multidrug efflux SMR transporter	NA	NA	NA	NA	NA
WP_000139438.1|102117_102783_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000564322.1|102794_103415_-	phosphate propanoyltransferase	NA	NA	NA	NA	NA
WP_001086629.1|103411_103876_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_001275637.1|103887_104835_-|holin	choline TMA-lyase-activating enzyme	holin	NA	NA	NA	NA
WP_000035053.1|104886_108273_-|holin	choline trimethylamine-lyase	holin	A0A1S6UAD4	Serratia_phage	45.0	9.7e-05
WP_001288713.1|108299_109454_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_000599365.1|109469_109727_-	EutN/CcmL family microcompartment protein	NA	NA	NA	NA	NA
WP_000570988.1|109753_111340_-	acetaldehyde dehydrogenase (acetylating)	NA	NA	NA	NA	NA
WP_001206281.1|111393_111672_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_000502010.1|111686_111971_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_000502009.1|111988_112267_-	BMC domain-containing protein	NA	NA	NA	NA	NA
WP_001217009.1|112786_113305_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001270145.1|113304_114123_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001551880.1|114145_114724_-	TetR family transcriptional regulator	NA	A0A0R6PIB6	Moraxella_phage	31.3	1.4e-09
WP_001189111.1|115581_117090_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_001521630.1|118975_120154_+	pyridoxal phosphate-dependent aminotransferase	NA	NA	NA	NA	NA
WP_001063848.1|120146_121598_+	Na+/H+ antiporter NhaC	NA	NA	NA	NA	NA
WP_001328257.1|123059_123989_+	DNA (cytosine-5-)-methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	38.1	1.4e-51
WP_000301136.1|123969_124926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001328259.1|126114_126285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551876.1|126522_126735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000381395.1|126761_128333_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|128352_128700_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_032147602.1|128699_129377_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	2.5e-21
WP_001551873.1|130150_131482_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_000952372.1|131568_132741_+|transposase	IS21-like element IS21 family transposase	transposase	U5N3F9	Enterobacteria_phage	99.5	3.5e-228
>prophage 2
NZ_CP042878	Escherichia coli strain NMBU_W05E18 chromosome, complete genome	5299922	934742	965119	5299922	protease,transposase	Stx2-converting_phage(50.0%)	21	NA	NA
WP_173009498.1|934742_936281_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	93.9	4.6e-281
WP_000624647.1|937408_937759_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	61.2	2.7e-35
WP_000435657.1|937755_938181_-	IS66 family insertion sequence hypothetical protein	NA	Q6H9S5	Enterobacteria_phage	73.2	5.2e-33
WP_001149834.1|938842_939760_+	N-acetylneuraminate lyase	NA	NA	NA	NA	NA
WP_000629094.1|939793_940669_+	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_173009499.1|940717_942190_+	MFS transporter	NA	Q6JIH2	Burkholderia_virus	26.6	1.1e-08
WP_000948500.1|942193_943024_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001296386.1|943069_943780_+	N-acetylneuraminic acid channel protein	NA	NA	NA	NA	NA
WP_126778512.1|943792_944902_+	N-acetylneuraminate epimerase	NA	NA	NA	NA	NA
WP_001328061.1|944951_945887_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001282578.1|945922_946657_-	transcriptional regulator NanR	NA	NA	NA	NA	NA
WP_000381395.1|947300_948872_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|948891_949239_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_032147602.1|949238_949916_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	2.5e-21
WP_088895425.1|950263_951491_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_001296383.1|953582_953825_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322947.1|953912_954104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001529396.1|954115_954484_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|954487_954703_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001254932.1|959483_960635_-|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001034083.1|961231_965119_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	39.0	1.2e-227
>prophage 3
NZ_CP042878	Escherichia coli strain NMBU_W05E18 chromosome, complete genome	5299922	975475	1029524	5299922	integrase,lysis,protease,transposase,tRNA	Shigella_phage(40.0%)	47	994983:994997	1003575:1003589
WP_128969768.1|975475_976704_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	95.0	5.9e-170
WP_001296373.1|977412_977841_-	DUF417 family protein	NA	NA	NA	NA	NA
WP_000109148.1|977880_978441_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001110186.1|978482_978743_-	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_001513409.1|980576_980690_+|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_001189111.1|982193_983702_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.8	3.6e-44
WP_115203520.1|984439_985667_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	97.3	5.2e-174
WP_001389262.1|986164_986386_-	P fimbrial regulatory protein KS71A	NA	NA	NA	NA	NA
WP_126778525.1|989163_989667_+	P fimbrial tip protein PapF	NA	NA	NA	NA	NA
WP_000758675.1|989710_990133_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000332660.1|990117_990717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001447126.1|992187_992739_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000147018.1|994432_995476_-	hypothetical protein	NA	NA	NA	NA	NA
994983:994997	attL	GCGCCAGTGCGTAAC	NA	NA	NA	NA
WP_001218869.1|995731_996997_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	38.1	2.1e-77
WP_000234523.1|997375_998083_-	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_089564255.1|998475_1000611_+	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_001360964.1|1000659_1001916_-	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000760323.1|1002117_1003197_-	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_000091700.1|1003261_1003537_-	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001564025.1|1003564_1004617_-	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
1003575:1003589	attR	GCGCCAGTGCGTAAC	NA	NA	NA	NA
WP_000786911.1|1004777_1005497_+|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001107566.1|1005496_1005823_+	YggL family protein	NA	NA	NA	NA	NA
WP_096857759.1|1006006_1006726_+	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
WP_000394125.1|1006901_1007948_+	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000745193.1|1008064_1009072_+	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000577032.1|1010428_1010932_-	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_001564022.1|1010976_1011963_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000239986.1|1012275_1013412_-	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_001174738.1|1013404_1013998_-	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_001277222.1|1014005_1014296_-	YggU family protein	NA	NA	NA	NA	NA
WP_001094831.1|1014292_1014859_-	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_000997793.1|1014876_1015581_-	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001361345.1|1015598_1016579_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000017106.1|1016791_1017208_-	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001339287.1|1017207_1017771_-	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000593278.1|1017879_1018830_-	glutathione synthase	NA	NA	NA	NA	NA
WP_001222509.1|1018842_1019574_-	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000286500.1|1019653_1020361_-	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_023908971.1|1020455_1020953_-|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001112301.1|1021029_1022424_-	galactose/proton symporter	NA	NA	NA	NA	NA
WP_001062128.1|1022859_1024014_-	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	63.2	4.0e-128
WP_001303650.1|1024317_1024533_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001297406.1|1024668_1024800_+	acid stress response protein YqgB	NA	NA	NA	NA	NA
WP_001295380.1|1024808_1026785_+	biosynthetic arginine decarboxylase	NA	NA	NA	NA	NA
WP_000758898.1|1026930_1027662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000105566.1|1027797_1028718_+	agmatinase	NA	NA	NA	NA	NA
WP_001297457.1|1028765_1029524_-|protease	metalloprotease LoiP	protease	NA	NA	NA	NA
>prophage 4
NZ_CP042878	Escherichia coli strain NMBU_W05E18 chromosome, complete genome	5299922	1430790	1471138	5299922	tail,integrase,capsid,terminase,plate,holin	Salmonella_phage(51.22%)	51	1430528:1430545	1473541:1473558
1430528:1430545	attL	TTCACACATATCACAATT	NA	NA	NA	NA
WP_001138334.1|1430790_1432188_+|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_001291429.1|1432184_1432385_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_001551511.1|1432381_1433776_-	DEAD/DEAH box helicase	NA	Q3LZN8	Bacteriophage	73.5	1.0e-210
WP_001551510.1|1433838_1434756_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551509.1|1434771_1435056_-	VRR-NUC domain-containing protein	NA	B6SD64	Bacteriophage	68.2	8.3e-27
WP_001551508.1|1435055_1435250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551506.1|1435485_1436247_-	nucleotide-binding protein	NA	NA	NA	NA	NA
WP_001551504.1|1436311_1438375_-	hypothetical protein	NA	Q775A3	Bordetella_phage	67.7	6.7e-275
WP_000551014.1|1438421_1439051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000769005.1|1439103_1439652_-	DUF2815 family protein	NA	Q775A5	Bordetella_phage	65.9	2.1e-66
WP_001551502.1|1439667_1440969_-	DUF2800 domain-containing protein	NA	B6SCX9	Bacteriophage	55.5	5.2e-132
WP_001551501.1|1440971_1441874_-	hypothetical protein	NA	Q3LZP9	Bacteriophage	54.4	6.1e-07
WP_000801676.1|1441870_1442020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551500.1|1442244_1442814_+	hypothetical protein	NA	K7P861	Enterobacteria_phage	52.7	3.2e-38
WP_001551499.1|1443189_1443864_-	helix-turn-helix transcriptional regulator	NA	B6SCU0	Bacteriophage	51.1	1.8e-59
WP_000016208.1|1444005_1444206_+	transcriptional regulator	NA	K7RWG7	Bacteriophage	50.0	1.0e-07
WP_001551498.1|1444209_1446471_+	bifunctional DNA primase/polymerase	NA	NA	NA	NA	NA
WP_000034494.1|1446786_1447077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551497.1|1447102_1447525_+	hypothetical protein	NA	Q8W638	Enterobacteria_phage	65.0	8.0e-42
WP_000781776.1|1448057_1448399_+|holin	phage holin, lambda family	holin	Q8SBE1	Shigella_phage	91.9	2.8e-53
WP_001194119.1|1448402_1448879_+	glycoside hydrolase family protein	NA	Q8SBE0	Shigella_phage	96.2	2.1e-86
WP_001551496.1|1448862_1449387_+	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	67.7	2.6e-42
WP_000162796.1|1449448_1450021_+|terminase	terminase small subunit	terminase	A0A2H4J480	uncultured_Caudovirales_phage	69.6	1.4e-60
WP_001551495.1|1450023_1451646_+	hypothetical protein	NA	A0A0M5M1R6	Salmonella_phage	95.6	0.0e+00
WP_001551494.1|1451645_1453112_+	DUF1073 domain-containing protein	NA	A0A0M4S6U1	Salmonella_phage	92.0	6.0e-262
WP_136759112.1|1453002_1453737_+|capsid	minor capsid protein	capsid	A0A0M4REK0	Salmonella_phage	85.1	5.2e-97
WP_001551492.1|1453751_1454972_+	DUF2213 domain-containing protein	NA	A0A0M4R5A6	Salmonella_phage	88.0	9.3e-200
WP_001066732.1|1454975_1455482_+	hypothetical protein	NA	A0A0M4QWZ6	Salmonella_phage	79.9	3.7e-70
WP_001551491.1|1455493_1456435_+	DUF2184 domain-containing protein	NA	A0A0M3ULD3	Salmonella_phage	86.6	1.6e-154
WP_001551489.1|1456663_1457071_+	DUF4054 domain-containing protein	NA	A0A0M5M3S2	Salmonella_phage	94.8	1.5e-69
WP_001551487.1|1457067_1457622_+	hypothetical protein	NA	A0A0M4S631	Salmonella_phage	83.7	7.4e-80
WP_001551486.1|1457608_1457998_+	hypothetical protein	NA	A0A0M3ULK0	Salmonella_phage	95.3	3.3e-66
WP_001349562.1|1457972_1458536_+	hypothetical protein	NA	A0A0M4R331	Salmonella_phage	76.3	3.4e-80
WP_001551485.1|1458539_1459685_+	DUF3383 domain-containing protein	NA	A0A2H4J8G4	uncultured_Caudovirales_phage	73.5	5.2e-160
WP_000109249.1|1459695_1460136_+	DUF3277 family protein	NA	A0A2H4J619	uncultured_Caudovirales_phage	75.3	7.0e-57
WP_000393954.1|1460139_1460592_+	hypothetical protein	NA	A0A0M4S6U8	Salmonella_phage	72.7	4.7e-56
WP_001551484.1|1460769_1462755_+	hypothetical protein	NA	A0A0M4REK7	Salmonella_phage	53.3	3.8e-174
WP_001298404.1|1462754_1463342_+	hypothetical protein	NA	A0A0M3ULD5	Salmonella_phage	88.0	3.4e-83
WP_000155119.1|1463341_1463644_+	hypothetical protein	NA	A0A0M4R5B7	Salmonella_phage	92.0	2.2e-49
WP_001551483.1|1463646_1464711_+	hypothetical protein	NA	A0A0M4QX01	Salmonella_phage	81.1	4.2e-156
WP_001551482.1|1464710_1465046_+	hypothetical protein	NA	A0A0M4RTY3	Salmonella_phage	71.2	1.7e-23
WP_001551481.1|1465042_1465555_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551480.1|1465615_1466368_+	hypothetical protein	NA	A0A0M5M1K7	Salmonella_phage	65.5	8.5e-87
WP_001270631.1|1466367_1466721_+	hypothetical protein	NA	A0A0M4R339	Salmonella_phage	88.9	1.5e-54
WP_001551479.1|1466720_1467920_+|plate	baseplate J/gp47 family protein	plate	A0A0M4RD32	Salmonella_phage	83.6	4.9e-185
WP_000049943.1|1467916_1468597_+	DUF2612 domain-containing protein	NA	A0A0M5M1K4	Salmonella_phage	78.8	1.5e-103
WP_001551478.1|1468596_1469391_+	hypothetical protein	NA	K7PH60	Enterobacterial_phage	91.0	6.9e-79
WP_024192484.1|1469390_1469984_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	64.9	7.0e-60
WP_001174919.1|1469955_1470396_-|tail	tail fiber assembly protein	tail	A0A0F7LDZ0	Escherichia_phage	66.7	1.5e-51
WP_077634188.1|1470398_1470797_-|tail	phage tail protein	tail	A0A0F7LBW5	Escherichia_phage	37.3	8.1e-12
WP_000904955.1|1470823_1471138_+	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	89.9	1.6e-39
1473541:1473558	attR	TTCACACATATCACAATT	NA	NA	NA	NA
>prophage 5
NZ_CP042878	Escherichia coli strain NMBU_W05E18 chromosome, complete genome	5299922	1938093	1947536	5299922		Enterobacteria_phage(85.71%)	10	NA	NA
WP_000569343.1|1938093_1939020_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	1.3e-23
WP_000783134.1|1939024_1939756_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1939736_1939844_-	protein YohO	NA	NA	NA	NA	NA
WP_001240398.1|1939903_1940635_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.0	2.8e-111
WP_001295431.1|1940856_1942542_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_001308766.1|1942538_1943258_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001551352.1|1943304_1943775_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	5.2e-82
WP_001295429.1|1943816_1944278_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	100.0	1.9e-76
WP_001551351.1|1944402_1946403_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	95.7	0.0e+00
WP_001551350.1|1946399_1947536_-	VWA domain-containing protein	NA	Q9EYF7	Enterobacteria_phage	97.4	5.0e-163
>prophage 6
NZ_CP042878	Escherichia coli strain NMBU_W05E18 chromosome, complete genome	5299922	2041242	2052742	5299922		Bacillus_phage(25.0%)	10	NA	NA
WP_001115975.1|2041242_2042637_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	31.9	2.4e-18
WP_000999474.1|2042794_2043790_+	SDR family oxidoreductase	NA	A0A1V0QG29	Shearwaterpox_virus	26.7	8.6e-10
WP_000183077.1|2044032_2044926_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000234390.1|2045235_2046255_+	UDP-glucose 4-epimerase GalE	NA	A0A2K9L1R4	Tupanvirus	48.3	3.7e-85
WP_000799972.1|2046273_2047290_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001140914.1|2047316_2048438_+	GDP-mannose 4,6-dehydratase	NA	M4QRT5	Synechococcus_phage	65.5	5.3e-133
WP_000043606.1|2048440_2049406_+	GDP-L-fucose synthase	NA	D1LW79	Prochlorococcus_phage	50.8	1.7e-87
WP_001421539.1|2049408_2049909_+	GDP-mannose mannosyl hydrolase	NA	NA	NA	NA	NA
WP_001286270.1|2049901_2051350_+	mannose-1-phosphate guanylyltransferase/mannose-6-phosphate isomerase	NA	A0A1V0SH58	Hokovirus	32.3	2.5e-58
WP_001551312.1|2051353_2052742_+	colanic acid biosynthesis phosphomannomutase CpsG	NA	A0A127AWJ1	Bacillus_phage	27.4	2.9e-32
>prophage 7
NZ_CP042878	Escherichia coli strain NMBU_W05E18 chromosome, complete genome	5299922	2076039	2124307	5299922	tail,integrase,transposase	Stx2-converting_phage(42.11%)	48	2074184:2074197	2100283:2100296
2074184:2074197	attL	TGTGGTGACGCAGG	NA	NA	NA	NA
WP_001007952.1|2076039_2077218_+|integrase	site-specific integrase	integrase	K7P7J2	Enterobacteria_phage	99.2	1.7e-230
WP_000132739.1|2077198_2077390_-	AlpA family phage regulatory protein	NA	A0A0P0ZBL0	Stx2-converting_phage	100.0	1.7e-31
WP_000627693.1|2077478_2077784_-	hypothetical protein	NA	U5P0J0	Shigella_phage	99.0	3.4e-50
WP_001242744.1|2077783_2078146_-	hypothetical protein	NA	U5P092	Shigella_phage	96.7	3.4e-65
WP_000008235.1|2078136_2078673_-	5'-deoxynucleotidase	NA	S5MW55	Escherichia_phage	98.9	8.2e-100
WP_000141754.1|2079186_2079474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000805577.1|2079694_2080288_+|tail	tail fiber assembly protein	tail	Q9MCR5	Enterobacteria_phage	63.1	7.3e-57
WP_000221969.1|2080406_2081486_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001421515.1|2082722_2083889_+	serine-type D-Ala-D-Ala carboxypeptidase DacD	NA	B6DZZ7	Stx2-converting_phage	98.5	6.1e-225
WP_001105393.1|2084007_2084481_+	DNA gyrase inhibitor SbmC	NA	NA	NA	NA	NA
WP_001200905.1|2084678_2085737_+	FUSC family protein	NA	NA	NA	NA	NA
WP_000450409.1|2085908_2086238_+	DUF496 family protein	NA	NA	NA	NA	NA
WP_001016348.1|2086338_2086521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001161660.1|2087009_2087123_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000988599.1|2087135_2087330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001551305.1|2087788_2088157_-	type IV toxin-antitoxin system toxin CbtA	NA	NA	NA	NA	NA
WP_000692323.1|2088230_2088452_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.4e-10
WP_001551304.1|2088514_2088991_-	RadC family protein	NA	NA	NA	NA	NA
WP_016238749.1|2089006_2089492_-	antirestriction protein	NA	A0A2D0W9W4	Bordetella_phage	33.8	9.0e-13
WP_001234628.1|2089546_2090365_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	38.2	1.5e-44
WP_001119729.1|2090464_2090698_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000581504.1|2090776_2091232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173009504.1|2091307_2093824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173009505.1|2093944_2096791_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_000381395.1|2096871_2098443_-|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000624622.1|2098462_2098810_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_032147602.1|2098809_2099487_-|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	2.5e-21
WP_012139840.1|2099869_2100742_-	GTPase family protein	NA	NA	NA	NA	NA
2100283:2100296	attR	CCTGCGTCACCACA	NA	NA	NA	NA
WP_000250236.1|2100826_2101744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001329788.1|2102560_2102758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813456.1|2102929_2103532_-	hypothetical protein	NA	NA	NA	NA	NA
WP_012135909.1|2103626_2103905_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000840364.1|2103973_2104240_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000221530.1|2105357_2105927_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000270974.1|2106186_2106588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001221619.1|2106575_2106983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000656342.1|2109297_2110332_-	phosphotriesterase	NA	NA	NA	NA	NA
WP_000739816.1|2110334_2111300_-	DMT family transporter	NA	NA	NA	NA	NA
WP_001066368.1|2111353_2112112_-	hypothetical protein	NA	NA	NA	NA	NA
WP_088895425.1|2114596_2115825_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.3	1.3e-177
WP_000065644.1|2116292_2116427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001083460.1|2116416_2117649_+	phosphoadenosine phosphosulfate reductase	NA	A0A068F1U8	Mycobacterium_phage	33.8	8.3e-63
WP_000502872.1|2117633_2118278_+	ParB N-terminal domain-containing protein	NA	A0A0F7L444	uncultured_marine_virus	51.0	2.8e-54
WP_001333064.1|2118648_2119827_-	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001439105.1|2119853_2120795_-	TonB-dependent receptor plug domain-containing protein	NA	NA	NA	NA	NA
WP_001282151.1|2121985_2122375_+	IS66 family insertion sequence hypothetical protein	NA	B6DZU5	Stx2-converting_phage	99.2	7.8e-68
WP_000612591.1|2122371_2122719_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001550332.1|2122768_2124307_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	9.3e-298
>prophage 8
NZ_CP042878	Escherichia coli strain NMBU_W05E18 chromosome, complete genome	5299922	2253153	2344328	5299922	tail,integrase,capsid,lysis,portal,terminase,transposase,holin,head,tRNA	Enterobacteria_phage(52.94%)	107	2332403:2332462	2350214:2350981
WP_001025308.1|2253153_2254887_-|tRNA	arginine--tRNA ligase	tRNA	A0A2K9L6Z2	Tupanvirus	33.5	4.4e-86
WP_001551265.1|2255102_2255669_+	VOC family protein	NA	NA	NA	NA	NA
WP_001185732.1|2255682_2256429_+	copper homeostasis protein CutC	NA	NA	NA	NA	NA
WP_001551264.1|2256814_2257915_+	NapC/NirT family cytochrome c	NA	NA	NA	NA	NA
WP_001551263.1|2257939_2260369_+	trimethylamine N-oxide reductase TorZ	NA	NA	NA	NA	NA
WP_000564730.1|2260403_2261375_-|tRNA	tRNA 5-methoxyuridine(34)/uridine 5-oxyacetic acid(34) synthase CmoB	tRNA	NA	NA	NA	NA
WP_000019591.1|2261371_2262115_-	carboxy-S-adenosyl-L-methionine synthase CmoA	NA	F5B419	Synechococcus_phage	30.0	4.6e-24
WP_000252980.1|2262155_2262551_-	MAPEG family protein	NA	NA	NA	NA	NA
WP_042196262.1|2262603_2263374_-	DUF72 domain-containing protein	NA	Q859D1	Escherichia_coli_phage	96.9	5.7e-70
WP_000362005.1|2263355_2264669_-	DUF3596 domain-containing protein	NA	Q8W658	Enterobacteria_phage	95.6	4.1e-246
WP_000528718.1|2264724_2264961_-	excisionase family protein	NA	Q8W657	Enterobacteria_phage	100.0	6.4e-41
WP_001030156.1|2264969_2265116_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.8	1.6e-21
WP_000457723.1|2265119_2265362_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_000208033.1|2265446_2265959_-	hypothetical protein	NA	A0A1U9AJ59	Stx1_converting_phage	97.4	2.2e-78
WP_000224229.1|2265969_2266233_-	hypothetical protein	NA	S4TNB5	Salmonella_phage	71.3	1.1e-30
WP_001290008.1|2266234_2266771_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	67.2	1.6e-63
WP_000034225.1|2266767_2267454_-	ead/Ea22-like family protein	NA	A5VWB1	Enterobacteria_phage	68.2	1.8e-38
WP_001300189.1|2267440_2267755_-	hypothetical protein	NA	B1GS43	Salmonella_phage	86.0	2.8e-39
WP_000179800.1|2267708_2268026_-	DUF4752 family protein	NA	A0A1I9LJV1	Stx_converting_phage	82.6	5.2e-38
WP_001551261.1|2268274_2268856_-	hypothetical protein	NA	Q8W653	Enterobacteria_phage	64.5	9.6e-70
WP_001551260.1|2268861_2269044_-	hypothetical protein	NA	Q8W652	Enterobacteria_phage	50.9	1.7e-09
WP_000141093.1|2269238_2269445_-	hypothetical protein	NA	Q8W651	Enterobacteria_phage	94.1	1.3e-29
WP_001551258.1|2269732_2270236_-	helix-turn-helix domain-containing protein	NA	Q8W649	Enterobacteria_phage	95.5	8.9e-64
WP_000838350.1|2270339_2270996_-	helix-turn-helix domain-containing protein	NA	Q8W648	Enterobacteria_phage	98.2	3.1e-125
WP_001551257.1|2271331_2272039_+	Rha family transcriptional regulator	NA	Q8W645	Enterobacteria_phage	85.5	4.5e-106
WP_001551256.1|2272147_2273002_+	Rha family phage regulatory protein	NA	Q8HA97	Salmonella_phage	69.0	8.2e-102
WP_000626793.1|2272998_2273193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000995578.1|2273409_2273709_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551255.1|2273705_2274698_+	hypothetical protein	NA	Q8W642	Enterobacteria_phage	96.3	5.1e-55
WP_000988266.1|2274708_2275608_+	ATP-binding protein	NA	Q8W641	Enterobacteria_phage	94.8	2.3e-139
WP_000203851.1|2275604_2277005_+	replicative DNA helicase	NA	Q8W640	Enterobacteria_phage	92.0	1.1e-244
WP_001065351.1|2277001_2277259_+	hypothetical protein	NA	Q8W639	Enterobacteria_phage	70.1	1.6e-21
WP_001204776.1|2278318_2278702_+	antitermination protein QuuD	NA	A0A088CD47	Shigella_phage	83.3	1.5e-55
WP_000737259.1|2278889_2279972_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	78.7	1.4e-162
WP_077634182.1|2280422_2280761_+	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.9	2.1e-48
WP_000874512.1|2282025_2283879_+	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.3	0.0e+00
WP_000284510.1|2284029_2284245_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000193278.1|2284249_2284594_+	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000369850.1|2284559_2284832_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000992072.1|2284937_2285471_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	94.4	2.4e-99
WP_001082539.1|2285769_2286237_+|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	90.3	9.1e-71
WP_000347013.1|2286587_2286728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|2286860_2287046_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000235436.1|2287861_2288371_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001550967.1|2288342_2290271_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.6e-262
WP_000259002.1|2290254_2290461_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_021524278.1|2290457_2292050_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	3.8e-185
WP_016238736.1|2292039_2293545_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.8	9.3e-101
WP_016247652.1|2293581_2293929_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	3.7e-21
WP_016238735.1|2293986_2295015_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	1.1e-113
WP_001565314.1|2295066_2295450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001204533.1|2295442_2295796_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000974994.1|2295811_2296387_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	3.7e-50
WP_000683079.1|2296383_2296779_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235037.1|2296786_2297533_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	8.7e-124
WP_001299690.1|2297551_2297983_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000533402.1|2298009_2298423_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_173009506.1|2298403_2300965_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	90.0	0.0e+00
WP_000847298.1|2300961_2301291_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001550635.1|2301290_2301989_+|tail	phage minor tail protein L	tail	Q6H9T5	Enterobacteria_phage	97.0	2.2e-129
WP_001576728.1|2301994_2302738_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	93.4	8.3e-143
WP_072258937.1|2302683_2303316_+|tail	tail assembly protein	tail	B6ETG3	Enterobacteria_phage	92.3	1.7e-96
WP_173009507.1|2303659_2307352_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.5	0.0e+00
WP_021553086.1|2307419_2308019_+	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	89.4	5.4e-100
WP_173009508.1|2308170_2310234_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	62.7	3.7e-148
WP_001204582.1|2310230_2310509_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	1.0e-21
WP_000355700.1|2310518_2310812_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071586406.1|2310851_2310950_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.1	1.2e-06
WP_001550976.1|2311004_2311661_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_000937496.1|2311729_2311996_+|tail	tail fiber assembly protein	tail	K7PMH7	Enterobacteria_phage	78.3	2.3e-18
WP_000799406.1|2312227_2313091_-	spermidine/putrescine ABC transporter permease PotB	NA	Q6GZ02	Mycoplasma_phage	28.7	6.7e-11
WP_000531594.1|2313074_2314211_-	spermidine/putrescine ABC transporter ATP-binding protein PotA	NA	Q6GZ03	Mycoplasma_phage	39.8	5.5e-29
WP_000359446.1|2314460_2315687_+	peptidase T	NA	NA	NA	NA	NA
WP_001295435.1|2315735_2316857_-	[50S ribosomal protein L16]-arginine 3-hydroxylase	NA	NA	NA	NA	NA
WP_000735412.1|2316932_2318393_-	two-component system sensor histidine kinase PhoQ	NA	NA	NA	NA	NA
WP_001265481.1|2318392_2319064_-	two-component system response regulator PhoP	NA	NA	NA	NA	NA
WP_000423742.1|2319232_2320603_-	adenylosuccinate lyase	NA	A0A2H4UUU6	Bodo_saltans_virus	44.9	1.2e-107
WP_001297479.1|2320606_2321248_-	high frequency lysogenization protein HflD	NA	NA	NA	NA	NA
WP_001295972.1|2321283_2322390_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000476103.1|2322443_2322905_-	phosphatase NudJ	NA	NA	NA	NA	NA
WP_000873387.1|2322914_2323553_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_012602377.1|2323885_2324236_-	DUF1493 family protein	NA	NA	NA	NA	NA
WP_000381622.1|2324220_2324670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522898.1|2325251_2326502_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	98.1	6.5e-23
WP_000526135.1|2326697_2327156_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_001309448.1|2327313_2327637_-	anti-adapter protein IraM	NA	Q20GJ2	Phage_258-320	63.6	1.3e-39
WP_000526135.1|2328275_2328734_+|transposase	IS200/IS605 family transposase	transposase	I4AZI8	Saccharomonospora_phage	32.3	2.9e-13
WP_019842521.1|2328890_2329001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001522899.1|2329053_2329458_-	DUF1398 domain-containing protein	NA	NA	NA	NA	NA
WP_000332298.1|2329678_2330410_-	DNA-binding transcriptional repressor BluR	NA	Q9EYF2	Enterobacteria_phage	50.5	3.5e-53
WP_001522901.1|2330614_2331826_-	blue light-responsive regulator BluF	NA	NA	NA	NA	NA
WP_000554146.1|2332139_2332376_+	two-component-system connector protein YcgZ	NA	NA	NA	NA	NA
2332403:2332462	attL	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGC	NA	NA	NA	NA
WP_000429836.1|2333261_2333696_-	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_001294663.1|2333767_2334118_+	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000732292.1|2334131_2334407_+	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001340589.1|2334442_2334865_+	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000105636.1|2334916_2336611_+	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001277456.1|2336628_2336991_+	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_173009509.1|2336987_2337224_+	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001300294.1|2337259_2337928_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000179844.1|2338002_2339682_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001381192.1|2339684_2340677_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000376623.1|2340645_2341146_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|2341273_2342113_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|2342106_2342454_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000703418.1|2342683_2343157_-	trimethoprim-resistant dihydrofolate reductase DfrA7	NA	A0A1B2IBQ4	Erwinia_phage	32.0	8.4e-16
WP_000845048.1|2343314_2344328_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
2350214:2350981	attR	GGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACCGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTCCGCCATTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGATACGTCGGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGGCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAACGCACTATGGCGACGCTGGGGCGTCTTATGAGCCTGCTGTCACCCTTTGACGTGGTGATATGGATGACGGATGGCTGGCCGCTGTATGAATCCCGCCTGAAGGGAAAGCTGCACGTAATCAGCAAGCGATATACGCAGCGAATTGAGCGGCATAACCTGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACC	NA	NA	NA	NA
>prophage 9
NZ_CP042878	Escherichia coli strain NMBU_W05E18 chromosome, complete genome	5299922	2543387	2649851	5299922	tail,lysis,terminase,transposase,tRNA	Escherichia_phage(47.37%)	102	NA	NA
WP_173009510.1|2543387_2544620_-	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.6	1.4e-17
WP_000387388.1|2544874_2545858_+	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_001551034.1|2546335_2547709_+	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	6.6e-53
WP_000662472.1|2547837_2548773_-|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.4	1.7e-145
WP_001551035.1|2548824_2550060_-	DUF3596 domain-containing protein	NA	A0A0U2JGI6	Escherichia_phage	98.5	1.3e-238
WP_000079604.1|2550061_2550277_-	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001551036.1|2550376_2550565_-	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	95.2	7.9e-26
WP_001317028.1|2550557_2550752_-	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	96.9	5.8e-32
WP_001551037.1|2550808_2551618_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.1	4.4e-105
WP_001551038.1|2551610_2554262_-	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	77.6	0.0e+00
WP_001314664.1|2554363_2554639_-	hypothetical protein	NA	A0A0U2QW85	Escherichia_phage	93.4	1.3e-40
WP_001551041.1|2554713_2554884_-	phage protein	NA	A0A0U2SHB5	Escherichia_phage	89.3	9.7e-23
WP_000560221.1|2554883_2555105_-	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	3.1e-37
WP_001551042.1|2555525_2555678_-	DUF1391 family protein	NA	M4QQ57	Salicola_phage	55.3	6.0e-08
WP_001551043.1|2556131_2556608_-	DNA-binding transcriptional repressor RacR	NA	NA	NA	NA	NA
WP_001551044.1|2556731_2557028_+	toxin YdaS	NA	A0A0R6PH31	Moraxella_phage	43.5	1.6e-09
WP_001551045.1|2557050_2557473_+	phage protein	NA	A0A0U2RXZ9	Escherichia_phage	95.7	5.3e-70
WP_001551046.1|2557485_2558343_+	DUF1376 domain-containing protein	NA	A0A0U2RT81	Escherichia_phage	82.6	3.5e-68
WP_001551047.1|2558349_2559096_+	ATP-binding protein	NA	V5UQI5	Shigella_phage	78.5	2.4e-110
WP_001551048.1|2559118_2559880_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	93.3	2.3e-119
WP_001403739.1|2559895_2560327_+	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.7	4.4e-64
WP_000385105.1|2560520_2561675_+	AAA family ATPase	NA	A0A2H4UTU5	Bodo_saltans_virus	31.3	1.9e-13
WP_001551050.1|2561649_2563914_+	S8 family peptidase	NA	NA	NA	NA	NA
WP_000940316.1|2564327_2564927_+	DUF1367 family protein	NA	A0A0U2RT94	Escherichia_phage	93.0	1.6e-107
WP_001551052.1|2564926_2565217_+	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	85.4	9.0e-45
WP_000640136.1|2565213_2565756_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	74.0	1.4e-75
WP_000839599.1|2567037_2567253_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	2.0e-33
WP_001135296.1|2567252_2567750_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
WP_001228688.1|2567966_2568152_+|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.5	3.6e-15
WP_001291094.1|2569944_2570736_+	ParB N-terminal domain-containing protein	NA	R4TG31	Halovirus	40.2	2.8e-48
WP_001204037.1|2570728_2571661_+	hypothetical protein	NA	A0A1B1INP7	uncultured_Mediterranean_phage	54.9	1.4e-83
WP_000613571.1|2571596_2571848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551055.1|2571851_2572946_+|terminase	terminase small subunit	terminase	A0A0U2RXW9	Escherichia_phage	80.2	1.0e-112
WP_000625348.1|2572926_2574228_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.6	3.6e-149
WP_001551056.1|2574230_2575637_+	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	69.2	2.3e-186
WP_001363932.1|2575620_2576733_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	54.5	7.1e-114
WP_001551057.1|2576837_2577602_+	hypothetical protein	NA	G8C7P6	Escherichia_phage	61.4	1.8e-79
WP_000918487.1|2577700_2578840_+	hypothetical protein	NA	G8C7P7	Escherichia_phage	75.0	7.4e-159
WP_000908084.1|2578882_2579059_+	hypothetical protein	NA	G8C7P8	Escherichia_phage	62.3	4.7e-12
WP_000634214.1|2579062_2579458_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551058.1|2579457_2579841_+	hypothetical protein	NA	A0A0P0I456	Acinetobacter_phage	39.4	2.2e-14
WP_001551059.1|2579841_2580222_+	hypothetical protein	NA	A0A059VF88	Pseudomonas_phage	44.4	2.9e-19
WP_000673077.1|2580218_2580611_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551060.1|2580637_2581600_+	hypothetical protein	NA	A0A059VG08	Pseudomonas_phage	38.6	3.8e-55
WP_122452218.1|2581750_2582110_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032284309.1|2582217_2582418_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551061.1|2582581_2585080_+|tail	phage tail length tape measure family protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	35.1	1.7e-86
WP_077634177.1|2585083_2585815_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	48.2	5.4e-54
WP_000024051.1|2585807_2586146_+|tail	phage tail protein	tail	H6WZM2	Escherichia_phage	50.0	4.0e-28
WP_001152425.1|2586145_2586844_+|tail	phage minor tail protein L	tail	A0A1B5FP81	Escherichia_phage	95.3	1.9e-128
WP_032147653.1|2586849_2587593_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.3	2.8e-146
WP_050436738.1|2587529_2588138_+|tail	tail assembly protein	tail	A5LH42	Enterobacteria_phage	91.6	7.1e-100
WP_001551065.1|2588198_2591678_+	host specificity protein J	NA	A5LH43	Enterobacteria_phage	89.5	0.0e+00
WP_173009511.1|2591745_2592345_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	96.5	5.3e-108
WP_065726093.1|2592409_2594785_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
WP_000654143.1|2594784_2595066_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	1.6e-17
WP_001551067.1|2595075_2596116_+|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	67.6	4.9e-125
WP_000355602.1|2596158_2596452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000968130.1|2596803_2597661_-	iron/manganese ABC transporter permease subunit SitD	NA	NA	NA	NA	NA
WP_001101728.1|2597657_2598515_-	iron/manganese ABC transporter permease subunit SitC	NA	NA	NA	NA	NA
WP_000983720.1|2598511_2599339_-	iron/manganese ABC transporter ATP-binding protein SitB	NA	G9BWD6	Planktothrix_phage	28.5	3.8e-11
WP_000286867.1|2599338_2600253_-	iron/manganese ABC transporter substrate-binding protein SitA	NA	NA	NA	NA	NA
WP_001295593.1|2600839_2601274_-	universal stress protein UspF	NA	A0A1W6JNV4	Morganella_phage	52.8	1.4e-28
WP_000837902.1|2601414_2602548_-	porin OmpN	NA	Q1MVN1	Enterobacteria_phage	58.8	4.8e-118
WP_001551068.1|2602909_2606434_-	pyruvate:ferredoxin (flavodoxin) oxidoreductase	NA	NA	NA	NA	NA
WP_001295715.1|2606707_2606974_+	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_001523197.1|2606970_2607393_-	heat shock protein HslJ	NA	NA	NA	NA	NA
WP_000762229.1|2607503_2608493_-	D-lactate dehydrogenase	NA	M1I4S0	Paramecium_bursaria_Chlorella_virus	44.0	2.5e-70
WP_001551069.1|2608700_2611340_+	YdbH family protein	NA	NA	NA	NA	NA
WP_000698145.1|2611336_2611522_+	YnbE family lipoprotein	NA	NA	NA	NA	NA
WP_001306533.1|2611529_2611856_+	YdbL family protein	NA	NA	NA	NA	NA
WP_001067519.1|2612027_2612933_-	transcriptional regulator FeaR	NA	NA	NA	NA	NA
WP_001551070.1|2613168_2614668_+	phenylacetaldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000535436.1|2614726_2617000_-	primary-amine oxidase	NA	NA	NA	NA	NA
WP_001551071.1|2617247_2619293_-	phenylacetic acid degradation bifunctional protein PaaZ	NA	NA	NA	NA	NA
WP_071591516.1|2619541_2620507_+	1,2-phenylacetyl-CoA epoxidase subunit A	NA	NA	NA	NA	NA
WP_000073393.1|2620518_2620806_+	1,2-phenylacetyl-CoA epoxidase subunit B	NA	NA	NA	NA	NA
WP_001551072.1|2620814_2621561_+	phenylacetate-CoA oxygenase subunit PaaC	NA	NA	NA	NA	NA
WP_001189203.1|2621575_2622073_+	phenylacetate degradation protein PaaD	NA	NA	NA	NA	NA
WP_001551073.1|2622080_2623151_+	phenylacetate-CoA oxygenase/reductase subunit PaaK	NA	NA	NA	NA	NA
WP_001551074.1|2623147_2623915_+	2,3-dehydroadipyl-CoA hydratase	NA	NA	NA	NA	NA
WP_001551075.1|2623914_2624703_+	2-(1,2-epoxy-1,2-dihydrophenyl)acetyl-CoA isomerase	NA	NA	NA	NA	NA
WP_078271840.1|2624704_2626132_+	3-hydroxyacyl-CoA dehydrogenase PaaC	NA	NA	NA	NA	NA
WP_078271839.1|2626058_2626463_+	hydroxyphenylacetyl-CoA thioesterase PaaI	NA	NA	NA	NA	NA
WP_001206190.1|2626462_2627668_+	3-oxoadipyl-CoA thiolase	NA	NA	NA	NA	NA
WP_000632281.1|2627694_2629008_+	phenylacetate--CoA ligase	NA	NA	NA	NA	NA
WP_001551078.1|2629108_2630059_+	phenylacetic acid degradation operon negative regulatory protein PaaX	NA	NA	NA	NA	NA
WP_001551079.1|2630040_2630631_+	phenylacetic acid degradation protein PaaY	NA	NA	NA	NA	NA
WP_001551080.1|2630961_2635983_+	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_001563833.1|2636190_2637051_+	pyridoxine 4-dehydrogenase	NA	NA	NA	NA	NA
WP_000048949.1|2637164_2637770_-	FMN-dependent NADH-azoreductase	NA	NA	NA	NA	NA
WP_001551082.1|2637970_2641873_+	ATP-dependent RNA helicase HrpA	NA	A0A1V0SIV3	Klosneuvirus	29.7	7.6e-54
WP_001523214.1|2642157_2642496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001314706.1|2642482_2642932_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000343026.1|2643051_2643429_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001027956.1|2643544_2644345_+	YdcF family protein	NA	NA	NA	NA	NA
WP_000115969.1|2644541_2645981_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_000048646.1|2646022_2647024_-	type I glyceraldehyde-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001306523.1|2647212_2647743_+	cytochrome b561	NA	A0A0U2QLA7	Escherichia_phage	43.9	2.0e-18
WP_000731833.1|2647987_2648161_+	periplasmic protein	NA	A0A0R6PKG1	Moraxella_phage	67.4	4.4e-07
WP_001309484.1|2648232_2648382_-	type I toxin-antitoxin system toxin HokB	NA	NA	NA	NA	NA
WP_085948682.1|2648481_2649851_-|transposase	IS3-like element IS150 family transposase	transposase	A0A2I6AZV9	Macacine_betaherpesvirus	99.5	4.8e-112
>prophage 10
NZ_CP042878	Escherichia coli strain NMBU_W05E18 chromosome, complete genome	5299922	2936389	2994160	5299922	tail,integrase,capsid,lysis,portal,terminase,transposase,head,tRNA	Enterobacteria_phage(52.54%)	72	2943363:2943390	2994185:2994212
WP_000672359.1|2936389_2938777_-|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001551178.1|2938791_2939775_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	37.4	1.7e-34
WP_001386830.1|2939913_2939958_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000124850.1|2940080_2940437_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001124225.1|2940490_2940688_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001700733.1|2940784_2941327_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001144202.1|2941330_2943259_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
2943363:2943390	attL	AAATTGGTACACAATTTGGTACACAAAT	NA	NA	NA	NA
WP_171858046.1|2943997_2945740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001551179.1|2946221_2946515_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016247637.1|2946557_2947598_-|tail	tail fiber domain-containing protein	tail	A0A0E3M4A9	Enterobacteria_phage	66.1	3.0e-122
WP_001518417.1|2947607_2947889_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
WP_016238726.1|2947888_2950264_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	69.3	1.4e-167
WP_001551182.1|2950328_2950928_-	Ail/Lom family outer membrane beta-barrel protein	NA	Q9EV15	Enterobacteria_phage	88.9	1.0e-98
WP_001551184.1|2950995_2954394_-	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	89.8	0.0e+00
WP_000090872.1|2954454_2955087_-|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	97.1	1.2e-94
WP_019843054.1|2955023_2955767_-|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	98.4	1.2e-149
WP_001551186.1|2955772_2956471_-|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	97.4	8.9e-131
WP_000847339.1|2956470_2956800_-|tail	phage tail protein	tail	A0A2R9YJM0	Escherichia_phage	97.2	2.8e-58
WP_173009512.1|2956796_2959358_-|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	98.4	0.0e+00
WP_000459467.1|2959350_2959785_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	99.2	7.6e-64
WP_000479143.1|2959766_2960189_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	96.4	8.2e-71
WP_001445656.1|2960204_2960945_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.6	4.7e-130
WP_032147602.1|2961068_2961746_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	2.5e-21
WP_000624622.1|2961745_2962093_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|2962112_2963684_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_173009513.1|2963710_2964055_-|tail	phage tail protein	tail	A0A0K2FIF4	Enterobacteria_phage	98.2	3.4e-59
WP_000975083.1|2964051_2964630_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.0	1.7e-79
WP_000752974.1|2964641_2964995_-|head,tail	head-tail joining protein	head,tail	A0A0K2FJB7	Enterobacteria_phage	97.4	2.9e-61
WP_000158862.1|2965006_2965405_-	DNA-packaging protein FI	NA	A0A0K2FIR1	Enterobacteria_phage	83.3	1.2e-50
WP_000063277.1|2965446_2966472_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	99.7	2.7e-192
WP_001563774.1|2966527_2966860_-|head	head decoration protein	head	C6ZCY1	Enterobacteria_phage	99.1	2.5e-54
WP_001563773.1|2966869_2968189_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.9	4.8e-234
WP_001563772.1|2968169_2969771_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	4.2e-309
WP_000198149.1|2969767_2969974_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001027297.1|2969970_2971896_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.8	0.0e+00
WP_000453587.1|2971870_2972416_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	98.9	1.4e-94
WP_000738421.1|2973084_2973378_+	increased serum survival lipoprotein Iss	NA	K7PL54	Enterobacteria_phage	90.7	5.9e-44
WP_077872524.1|2973468_2973651_-|lysis	prophage lysis lipoprotein RzoD	lysis	K7PHU6	Enterobacteria_phage	96.7	5.0e-17
WP_001135296.1|2973867_2974365_-	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	1.6e-89
WP_000839582.1|2974364_2974580_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	98.6	1.2e-33
WP_001146309.1|2974768_2975500_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_106378881.1|2975593_2976821_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.7	1.9e-168
WP_000592546.1|2977187_2978147_-	DUF523 and DUF1722 domain-containing protein	NA	NA	NA	NA	NA
WP_000780581.1|2978339_2978864_+	lipocalin family protein	NA	A0A1W6JNX6	Morganella_phage	54.1	1.1e-48
WP_001204777.1|2979019_2979397_-	antitermination protein	NA	Q777W5	Enterobacteria_phage	84.2	7.3e-55
WP_000971055.1|2979482_2979623_-	YlcG family protein	NA	K7PHH3	Enterobacteria_phage	69.8	1.1e-08
WP_000774488.1|2979979_2980270_-	DUF1364 domain-containing protein	NA	K7PGZ6	Enterobacteria_phage	94.8	4.3e-47
WP_000224916.1|2980262_2980433_-	hypothetical protein	NA	K7P7K0	Enterobacteria_phage	67.9	1.5e-12
WP_001054342.1|2980432_2980888_-	DNA base-flipping protein YbcN	NA	I6PD71	Cronobacter_phage	66.9	5.4e-60
WP_001303586.1|2980884_2980986_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000881075.1|2981102_2981900_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001445652.1|2981909_2982461_-	Raf kinase inhibitor-like protein YbcL	NA	NA	NA	NA	NA
WP_001551199.1|2982925_2984452_-	recombinase family protein	NA	Q3HQV4	Burkholderia_phage	31.1	1.2e-31
WP_001299444.1|2984509_2984659_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001070450.1|2984706_2985039_-	SMR family multidrug efflux protein EmrE	NA	NA	NA	NA	NA
WP_000145915.1|2985106_2985409_-	protein ren	NA	A0A0N6WES4	Escherichia_phage	95.7	1.1e-42
WP_000788813.1|2985405_2986107_-	hypothetical protein	NA	M1FJ72	Enterobacteria_phage	99.1	3.8e-129
WP_000147955.1|2986103_2987123_-	replication protein	NA	A0A0M5M7Y1	Salmonella_phage	64.1	8.8e-111
WP_001182891.1|2987119_2987659_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	67.6	6.8e-62
WP_001067458.1|2987728_2987959_-	helix-turn-helix domain-containing protein	NA	A0A2H4FNF3	Salmonella_phage	68.0	1.5e-21
WP_000259990.1|2987997_2988753_+	helix-turn-helix transcriptional regulator	NA	Q76H56	Enterobacteria_phage	75.0	1.4e-92
WP_023148105.1|2989264_2989555_+	hypothetical protein	NA	K7P6H3	Enterobacteria_phage	85.1	5.0e-27
WP_001550843.1|2989630_2989927_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_000100847.1|2989932_2990718_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	100.0	6.3e-149
WP_000186804.1|2990714_2991395_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	98.7	1.3e-131
WP_000682318.1|2991391_2991574_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000548531.1|2991546_2991738_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001386642.1|2991748_2992030_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763364.1|2992128_2992347_+	TraR/DksA family transcriptional regulator	NA	M1FQT7	Enterobacteria_phage	95.8	1.8e-34
WP_000488401.1|2992394_2992673_+	DUF4222 domain-containing protein	NA	M1FPC8	Enterobacteria_phage	96.7	1.4e-47
WP_001354056.1|2992763_2992994_+	hypothetical protein	NA	A0A1P8DTG1	Proteus_phage	55.7	2.9e-14
WP_001196928.1|2992951_2994160_-|integrase	site-specific integrase	integrase	I6R9B6	Salmonella_phage	74.9	4.7e-180
2994185:2994212	attR	AAATTGGTACACAATTTGGTACACAAAT	NA	NA	NA	NA
>prophage 11
NZ_CP042878	Escherichia coli strain NMBU_W05E18 chromosome, complete genome	5299922	3102229	3192267	5299922	tail,integrase,capsid,lysis,portal,terminase,protease,transposase,holin,head,tRNA	Escherichia_phage(34.92%)	104	3108086:3108101	3196478:3196493
WP_000984517.1|3102229_3103111_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_001055785.1|3103302_3105351_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.5	6.8e-86
WP_000431370.1|3105370_3106069_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_001043876.1|3106165_3106663_-	L-methionine (R)-S-oxide reductase	NA	NA	NA	NA	NA
WP_001316436.1|3106792_3108076_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_001306757.1|3108044_3110678_+	lipid-binding membrane homeostasis protein YebT	NA	NA	NA	NA	NA
3108086:3108101	attL	TAAAAATAAACGCCGT	NA	NA	NA	NA
WP_024186439.1|3110757_3112197_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_001295499.1|3112314_3112551_+	DUF1480 family protein	NA	NA	NA	NA	NA
WP_001296140.1|3112655_3112847_+	YebW family protein	NA	NA	NA	NA	NA
WP_001551231.1|3112847_3113504_-	protein-serine/threonine phosphatase	NA	A0A2D1GLI5	Escherichia_phage	49.1	1.2e-55
WP_000976472.1|3113899_3114241_-	YebY family protein	NA	NA	NA	NA	NA
WP_001551232.1|3114253_3115126_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_000168747.1|3115129_3115504_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_000916763.1|3115642_3115873_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	1.3e-14
WP_049144542.1|3115974_3116631_+	carbon-nitrogen hydrolase family protein	NA	NA	NA	NA	NA
WP_000944256.1|3116654_3117317_+	exodeoxyribonuclease X	NA	Q6UAU3	Klebsiella_phage	41.6	2.0e-07
WP_001551233.1|3117313_3119374_-	oligopeptidase B	NA	NA	NA	NA	NA
WP_000064873.1|3119530_3119956_-|transposase	IS200/IS605-like element ISEc46 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	49.6	8.9e-25
WP_001551234.1|3120012_3121182_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A077SLN2	Escherichia_phage	99.0	1.7e-203
WP_000024733.1|3121345_3122005_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_001295500.1|3122331_3122688_-	protein YebF	NA	NA	NA	NA	NA
WP_000257738.1|3122754_3123045_-	DNA damage-inducible protein YebG	NA	NA	NA	NA	NA
WP_001551236.1|3123178_3124357_+	formate-dependent phosphoribosylglycinamide formyltransferase	NA	NA	NA	NA	NA
WP_000800512.1|3124411_3125053_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_001069467.1|3125089_3126901_-	phosphogluconate dehydratase	NA	NA	NA	NA	NA
WP_000301727.1|3127135_3128611_-	glucose-6-phosphate dehydrogenase	NA	H6WFS4	Cyanophage	37.5	4.4e-79
WP_001056694.1|3128948_3129818_+	DNA-binding transcriptional regulator HexR	NA	NA	NA	NA	NA
WP_000091148.1|3129945_3131388_+	pyruvate kinase	NA	NA	NA	NA	NA
WP_001551238.1|3131519_3132491_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001184045.1|3132610_3133933_-	murein DD-endopeptidase MepM	NA	A8ATH6	Listeria_phage	40.9	1.2e-14
WP_011076428.1|3133948_3134881_-	zinc ABC transporter substrate-binding protein ZnuA	NA	NA	NA	NA	NA
WP_000202996.1|3134959_3135715_+	zinc ABC transporter ATP-binding protein ZnuC	NA	G3M9Y6	Bacillus_virus	28.3	1.3e-18
WP_000571479.1|3135711_3136497_+	zinc ABC transporter permease subunit ZnuB	NA	NA	NA	NA	NA
WP_000568522.1|3136646_3137657_-	Holliday junction branch migration DNA helicase RuvB	NA	A0A127AWE7	Bacillus_phage	25.5	5.6e-09
WP_000580323.1|3137665_3138277_-	Holliday junction branch migration protein RuvA	NA	NA	NA	NA	NA
WP_010723105.1|3138415_3138481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001024929.1|3138551_3139154_+	YebB family permuted papain-like enzyme	NA	NA	NA	NA	NA
WP_001551239.1|3139155_3139677_-	crossover junction endodeoxyribonuclease RuvC	NA	G3MA90	Bacillus_virus	35.1	2.0e-10
WP_000907234.1|3139711_3140452_-	YebC/PmpR family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_001308712.1|3140480_3140933_-	dihydroneopterin triphosphate diphosphatase	NA	NA	NA	NA	NA
WP_001551240.1|3141050_3142823_-|tRNA	aspartate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_001551241.1|3143132_3143699_+	hydrolase	NA	NA	NA	NA	NA
WP_001217553.1|3144053_3144302_+	DinI-like family protein	NA	K7PLW4	Enterobacteria_phage	100.0	1.8e-38
WP_000355701.1|3144556_3144850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001204581.1|3144859_3145138_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_173009515.1|3145134_3147201_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	62.7	3.7e-148
WP_001513563.1|3147265_3147865_-	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	96.5	1.8e-108
WP_171858037.1|3147932_3151625_-	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.5	0.0e+00
WP_117004347.1|3151968_3152601_-|tail	tail assembly protein	tail	A0A0P0ZC16	Stx2-converting_phage	92.3	3.8e-96
WP_000194711.1|3152546_3153290_-|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	98.4	7.7e-149
WP_001348269.1|3153300_3153999_-|tail	phage minor tail protein L	tail	H6WZM3	Escherichia_phage	96.6	1.1e-128
WP_000847298.1|3153998_3154328_-|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001550972.1|3154324_3156898_-|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	80.0	0.0e+00
WP_000533402.1|3156878_3157292_-|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_001299690.1|3157318_3157750_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000235037.1|3157768_3158515_-|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	8.7e-124
WP_000683079.1|3158522_3158918_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000974994.1|3158914_3159490_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	3.7e-50
WP_001204533.1|3159505_3159859_-|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_001565314.1|3159851_3160235_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016238735.1|3160286_3161315_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	1.1e-113
WP_016247652.1|3161372_3161720_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	3.7e-21
WP_016238736.1|3161756_3163262_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.8	9.3e-101
WP_021524278.1|3163251_3164844_-|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.3	3.8e-185
WP_000259002.1|3164840_3165047_-|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_001550967.1|3165030_3166959_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	66.4	1.6e-262
WP_000235436.1|3166930_3167440_-|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_001322427.1|3167922_3168276_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000830178.1|3168398_3168725_-	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_032147602.1|3168974_3169652_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	2.5e-21
WP_000624622.1|3169651_3169999_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|3170018_3171590_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_032142285.1|3171742_3172210_-|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_001280932.1|3172212_3172344_-	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	79.1	2.6e-07
WP_001446668.1|3172358_3172541_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092866.1|3172697_3173231_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	97.2	6.7e-102
WP_001037014.1|3173267_3174158_-	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.9	2.1e-108
WP_000284506.1|3174162_3174378_-|holin	class II holin family protein	holin	Q9ZWW2	Enterobacteria_phage	100.0	6.9e-34
WP_001538590.1|3174454_3174700_-	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	92.6	8.8e-17
WP_023143432.1|3174737_3174920_-	DUF1378 family protein	NA	S5MBZ5	Escherichia_phage	85.0	5.1e-22
WP_001550966.1|3175056_3177018_-	SASA family carbohydrate esterase	NA	A0A0P0ZBH7	Stx2-converting_phage	64.1	5.6e-239
WP_001336019.1|3177278_3177614_+	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	1.4e-44
WP_000562553.1|3177894_3178026_-	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_001545909.1|3178921_3179743_-	antitermination protein	NA	K7P7B9	Enterobacteria_phage	58.6	1.8e-77
WP_000139998.1|3179757_3180120_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	63.6	9.6e-36
WP_001550965.1|3180120_3181179_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	47.7	1.7e-88
WP_023141427.1|3181180_3181453_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	50.8	4.2e-12
WP_000813254.1|3181620_3181776_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000753060.1|3182697_3182874_-	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	94.8	6.7e-27
WP_001550964.1|3182866_3183049_-	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	98.3	2.4e-27
WP_000403785.1|3183142_3183499_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001151150.1|3183556_3183979_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	90.6	2.6e-64
WP_001262390.1|3184019_3185090_-	hypothetical protein	NA	A0A088CD36	Shigella_phage	56.6	2.6e-52
WP_000693850.1|3185161_3185587_-	Rha family transcriptional regulator	NA	NA	NA	NA	NA
WP_000747951.1|3185570_3185813_-	hypothetical protein	NA	H9C161	Pectobacterium_phage	55.8	4.8e-07
WP_001420344.1|3186204_3186543_+	peptidase S24	NA	H9C160	Pectobacterium_phage	32.0	2.5e-06
WP_000379575.1|3186835_3186991_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001171946.1|3187150_3187369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001517906.1|3187333_3187537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854558.1|3187937_3188126_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001070259.1|3188122_3188314_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_000102136.1|3188407_3190849_+	exonuclease	NA	V5UQJ3	Shigella_phage	46.9	3.1e-114
WP_000003742.1|3190910_3191180_+	excisionase	NA	NA	NA	NA	NA
WP_000074984.1|3191148_3192267_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	Q77Z04	Phage_21	44.2	5.9e-84
3196478:3196493	attR	ACGGCGTTTATTTTTA	NA	NA	NA	NA
>prophage 12
NZ_CP042878	Escherichia coli strain NMBU_W05E18 chromosome, complete genome	5299922	3318490	3362003	5299922	tail,integrase,lysis,portal,terminase,protease,coat,holin	Enterobacteria_phage(44.64%)	66	3311059:3311076	3363837:3363854
3311059:3311076	attL	TGCCTGATGCGACGCTAA	NA	NA	NA	NA
WP_173009517.1|3318490_3320296_-|tail	tail fiber domain-containing protein	tail	A5VW57	Enterobacteria_phage	64.8	5.3e-42
WP_173009538.1|3320474_3321377_-	phage antirepressor Ant	NA	Q0H8C7	Salmonella_phage	98.7	3.0e-171
WP_000620145.1|3321439_3321613_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000410001.1|3321609_3321762_-	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_001051911.1|3321876_3322125_+	Arc family DNA-binding protein	NA	G0ZNE9	Cronobacter_phage	50.0	1.5e-08
WP_000903306.1|3322124_3322661_+|protease	ATP-dependent Clp protease proteolytic subunit	protease	NA	NA	NA	NA
WP_001198454.1|3322709_3323159_-	type II toxin-antitoxin system YafO family toxin	NA	G8C7Q9	Escherichia_phage	60.3	9.1e-44
WP_000064337.1|3323167_3323734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011703616.1|3323930_3324260_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000868966.1|3324277_3326290_-	hypothetical protein	NA	A0A2I7QW93	Vibrio_phage	36.7	2.9e-97
WP_173009518.1|3326289_3327669_-	DNA transfer protein	NA	A0A2H4FND5	Salmonella_phage	95.1	4.5e-227
WP_173009519.1|3327679_3328372_-	DNA transfer protein	NA	A5VW66	Enterobacteria_phage	97.4	2.9e-113
WP_137460563.1|3328374_3328830_-	DUF2824 family protein	NA	Q716G5	Shigella_phage	96.7	1.1e-84
WP_173009520.1|3328829_3329783_-	hypothetical protein	NA	Q716G6	Shigella_phage	83.3	1.5e-91
WP_173009521.1|3329782_3331201_-	packaged DNA stabilization protein gp10	NA	A0A088CQ70	Enterobacteria_phage	98.9	5.1e-274
WP_173009522.1|3331201_3331702_-	recombinase RmuC	NA	G8EYJ2	Enterobacteria_phage	98.8	1.9e-90
WP_088543238.1|3331679_3331928_-	hypothetical protein	NA	A0A2D1GLK1	Escherichia_phage	93.2	1.0e-25
WP_173009523.1|3331972_3333271_-|coat	coat protein	coat	A0A2D1GLV2	Escherichia_phage	95.1	8.3e-231
WP_173009524.1|3333270_3334182_-	scaffolding protein	NA	A0A2D1GLN7	Escherichia_phage	99.7	6.3e-161
WP_173009525.1|3334195_3336361_-|portal	portal protein	portal	G5DA97	Enterobacteria_phage	99.4	0.0e+00
WP_173009526.1|3336361_3337861_-|terminase	terminase	terminase	A0A2D1GLW6	Escherichia_phage	99.6	6.9e-306
WP_000729922.1|3337838_3338327_-	DNA-packaging protein gp3	NA	A0A0M3ULC0	Salmonella_phage	100.0	5.0e-88
WP_000807780.1|3338362_3338605_-	DUF2560 family protein	NA	A5VW77	Enterobacteria_phage	78.8	7.6e-29
WP_042019190.1|3338708_3339080_-	phage family protein	NA	K7PH35	Enterobacteria_phage	97.6	4.7e-62
WP_001139680.1|3339317_3339470_-	hypothetical protein	NA	K7PKL2	Enterobacteria_phage	100.0	1.2e-21
WP_173009527.1|3339457_3339925_-|lysis	lysis protein	lysis	A0A291AWW3	Escherichia_phage	93.5	5.1e-74
WP_000229392.1|3339921_3340398_-	glycoside hydrolase family protein	NA	K7PKV2	Enterobacteria_phage	100.0	1.7e-88
WP_000783734.1|3340381_3340705_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	100.0	1.3e-52
WP_001235461.1|3341381_3342005_-	antitermination protein	NA	K7PM87	Enterobacteria_phage	100.0	3.0e-114
WP_173009528.1|3342001_3342667_-	serine/threonine protein phosphatase	NA	A0A2D1GLI5	Escherichia_phage	98.6	2.5e-130
WP_016063342.1|3342644_3342851_-	NinH protein	NA	K7P867	Enterobacteria_phage	100.0	7.3e-33
WP_173009529.1|3342847_3343450_-	recombination protein NinG	NA	A0A1U9AJF8	Stx1_converting_phage	93.6	1.7e-93
WP_001108084.1|3343424_3343991_-	HNH endonuclease	NA	A0A1U9AJK5	Stx1_converting_phage	99.5	6.6e-108
WP_077899365.1|3343983_3344193_-	protein ninF	NA	G9L691	Escherichia_phage	98.5	3.1e-31
WP_021566241.1|3344152_3344554_-	hypothetical protein	NA	Q9EYC4	Enterobacteria_phage	99.2	2.4e-72
WP_001254255.1|3344556_3344733_-	NinE family protein	NA	A5VW90	Enterobacteria_phage	100.0	4.6e-28
WP_000736903.1|3344729_3345170_-	recombination protein NinB	NA	A0A220NRM1	Escherichia_phage	100.0	7.0e-81
WP_173009530.1|3345246_3346683_-	AAA family ATPase	NA	G5DA90	Enterobacteria_phage	99.6	2.6e-273
WP_173009531.1|3346672_3347629_-	DNA replication protein	NA	Q716D3	Shigella_phage	92.5	1.0e-153
WP_000166961.1|3347615_3347777_-	hypothetical protein	NA	Q76H53	Enterobacteria_phage	100.0	1.3e-21
WP_000424164.1|3347811_3348090_-	transcriptional regulator	NA	A0A220NRS4	Escherichia_phage	100.0	3.6e-43
WP_000276886.1|3348198_3348384_-	Cro/Cl family transcriptional regulator	NA	A5VW97	Enterobacteria_phage	100.0	1.6e-26
WP_000856967.1|3348464_3349115_+	LexA family transcriptional regulator	NA	A5VW98	Enterobacteria_phage	100.0	1.1e-122
WP_016063176.1|3349680_3349953_+	hypothetical protein	NA	K7P7A1	Enterobacteria_phage	100.0	3.6e-27
WP_001550846.1|3349969_3350551_-	super-infection exclusion protein B	NA	K7P6T7	Enterobacteria_phage	92.2	4.0e-92
WP_001550845.1|3350764_3350965_+	restriction inhibitor protein ral	NA	K7P7K1	Enterobacteria_phage	100.0	1.9e-33
WP_024189690.1|3351147_3351516_+	DUF2528 family protein	NA	M1FPD2	Enterobacteria_phage	99.2	5.0e-64
WP_001198861.1|3351588_3351753_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	Q776Q5	Enterobacteria_phage	100.0	1.1e-26
WP_000372937.1|3351721_3351865_+	host cell division inhibitory peptide Kil	NA	A0A0N7C2U2	Escherichia_phage	100.0	1.2e-18
WP_001550843.1|3351939_3352236_+	host-nuclease inhibitor protein Gam	NA	A0A1I9LJN1	Stx_converting_phage	99.0	6.2e-49
WP_001550842.1|3352241_3353027_+	phage recombination protein Bet	NA	A0A1I9LJN0	Stx_converting_phage	99.6	2.4e-148
WP_000186804.1|3353023_3353704_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	98.7	1.3e-131
WP_000682318.1|3353700_3353883_+	DUF1317 domain-containing protein	NA	A0A0N7CHV0	Escherichia_phage	98.3	1.3e-28
WP_000548531.1|3353855_3354047_+	DUF1382 family protein	NA	A0A0P0ZC67	Stx2-converting_phage	100.0	7.3e-27
WP_001386642.1|3354057_3354339_+	cell division protein ZapA	NA	A0A0P0ZE02	Stx2-converting_phage	98.9	5.5e-47
WP_000763367.1|3354437_3354659_+	TraR/DksA family transcriptional regulator	NA	A0A0K2FI84	Escherichia_phage	100.0	2.9e-35
WP_001348592.1|3354869_3355472_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000545733.1|3355714_3355882_+	hypothetical protein	NA	A0A0K2FJ46	Enterobacteria_phage	100.0	1.3e-27
WP_001303849.1|3355921_3356140_+	excisionase	NA	Q77WA4	Escherichia_phage	100.0	3.7e-35
WP_021572757.1|3356117_3357191_+|integrase	tyrosine-type recombinase/integrase	integrase	Q9G075	Enterobacteria_phage	99.2	1.8e-199
WP_023909335.1|3357285_3360030_+	TMAO reductase system sensor histidine kinase/response regulator TorS	NA	A0A1V0SGX0	Hokovirus	32.8	2.4e-38
WP_001550932.1|3360101_3361175_+	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_001019197.1|3361223_3361397_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309400.1|3361386_3361617_-	protein YmcE	NA	NA	NA	NA	NA
WP_071528143.1|3361591_3361780_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066490.1|3361790_3362003_-	cold shock protein CspG	NA	A0A1W6JNX5	Morganella_phage	71.4	7.8e-22
3363837:3363854	attR	TGCCTGATGCGACGCTAA	NA	NA	NA	NA
>prophage 13
NZ_CP042878	Escherichia coli strain NMBU_W05E18 chromosome, complete genome	5299922	4164532	4185104	5299922	plate,transposase	Stx2-converting_phage(60.0%)	16	NA	NA
WP_032147602.1|4164532_4165210_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	2.5e-21
WP_000624622.1|4165209_4165557_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4165576_4167148_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_001077735.1|4167819_4168197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153269353.1|4168196_4169609_-	RHS domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	46.5	1.5e-23
WP_001550647.1|4172772_4174914_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	24.8	1.8e-25
WP_001142958.1|4175123_4175642_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_001550646.1|4176338_4176839_+	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_001521869.1|4176873_4177098_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001550644.1|4177148_4178624_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_001521866.1|4178630_4179044_+|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_001521865.1|4179047_4180898_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_000348804.1|4180861_4181944_+|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_001550643.1|4181968_4183249_+	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_001080149.1|4183245_4183770_+	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_000246418.1|4183772_4185104_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 14
NZ_CP042878	Escherichia coli strain NMBU_W05E18 chromosome, complete genome	5299922	4586427	4614013	5299922	protease,integrase,transposase	Stx2-converting_phage(71.43%)	22	4585702:4585715	4616415:4616428
4585702:4585715	attL	ATTATTATCAGGAA	NA	NA	NA	NA
WP_042047045.1|4586427_4586784_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_001550535.1|4586956_4587415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001499263.1|4588455_4588581_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	NA	NA	NA	NA
WP_049144582.1|4588623_4588869_+|transposase	Rpn family recombination-promoting nuclease/putative transposase	transposase	Q2A0A7	Sodalis_phage	57.1	8.8e-17
WP_001550533.1|4588927_4589404_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001550531.1|4589838_4594548_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001550530.1|4594544_4596776_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001499260.1|4597006_4597174_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001550529.1|4597521_4598073_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000735752.1|4598523_4599051_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001550528.1|4599150_4601559_+	PefC/AfrB family outer membrane usher protein	NA	NA	NA	NA	NA
WP_113228315.1|4601575_4602244_+	fimbrial chaperone	NA	NA	NA	NA	NA
WP_001550526.1|4602230_4602752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024189727.1|4602906_4603662_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_001550520.1|4603695_4604556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001550519.1|4604840_4605581_+	porin family protein	NA	NA	NA	NA	NA
WP_032147602.1|4606561_4607239_+|transposase	transposase	transposase	A0A0P0ZCV4	Stx2-converting_phage	46.0	2.5e-21
WP_000624622.1|4607238_4607586_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	76.6	2.6e-46
WP_000381395.1|4607605_4609177_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	58.7	9.9e-170
WP_000612591.1|4609467_4609815_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	100.0	2.2e-61
WP_001550332.1|4609864_4611403_+|transposase	IS66-like element ISEc8 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	99.4	9.3e-298
WP_001550516.1|4612747_4614013_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.7	6.5e-79
4616415:4616428	attR	ATTATTATCAGGAA	NA	NA	NA	NA
>prophage 15
NZ_CP042878	Escherichia coli strain NMBU_W05E18 chromosome, complete genome	5299922	4696676	4758759	5299922	protease,transposase,integrase,tRNA	Vibrio_phage(13.33%)	58	4746756:4746772	4761096:4761112
WP_000811566.1|4696676_4696952_+|protease	protease activator YjfN	protease	NA	NA	NA	NA
WP_001550492.1|4697068_4698694_-	isovaleryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_001550491.1|4698777_4699941_-	glutathionylspermidine synthase family protein	NA	B2ZXR7	Ralstonia_phage	43.8	8.3e-81
WP_000101676.1|4699943_4700582_-	DUF1190 domain-containing protein	NA	NA	NA	NA	NA
WP_000547760.1|4700591_4700990_-	DUF350 domain-containing protein	NA	NA	NA	NA	NA
WP_001564276.1|4701007_4701667_-	YjfK family protein	NA	NA	NA	NA	NA
WP_001522365.1|4701717_4702416_-	PspA/IM30 family protein	NA	NA	NA	NA	NA
WP_001550489.1|4702434_4702836_-	DUF2170 family protein	NA	NA	NA	NA	NA
WP_001293282.1|4702962_4703694_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000076315.1|4703784_4706226_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	33.1	6.4e-67
WP_001177639.1|4706264_4706690_-	nitric oxide-sensing transcriptional repressor NsrR	NA	NA	NA	NA	NA
WP_000527955.1|4706894_4708193_-	adenylosuccinate synthase	NA	W5S5V7	Pithovirus	35.9	2.2e-66
WP_001089295.1|4708296_4708494_-	DUF2065 domain-containing protein	NA	NA	NA	NA	NA
WP_001232412.1|4708575_4709580_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_000312488.1|4709582_4710842_-|protease	FtsH protease activity modulator HflK	protease	A0A1L2CVV0	Pectobacterium_phage	25.5	3.6e-05
WP_000460360.1|4710927_4712208_-	GTPase HflX	NA	NA	NA	NA	NA
WP_001051883.1|4712284_4712593_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_001280339.1|4712678_4713629_-|tRNA	tRNA (adenosine(37)-N6)-dimethylallyltransferase MiaA	tRNA	NA	NA	NA	NA
WP_001550486.1|4713621_4715469_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	41.3	4.4e-60
WP_000990303.1|4715478_4716816_-	N-acetylmuramoyl-L-alanine amidase AmiB	NA	A0A067ZJB6	Vibrio_phage	31.0	8.8e-18
WP_000981977.1|4716834_4717296_-|tRNA	tRNA (N6-adenosine(37)-N6)-threonylcarbamoyltransferase complex ATPase TsaE	tRNA	NA	NA	NA	NA
WP_023909786.1|4717267_4718815_-	bifunctional ADP-dependent NAD(P)H-hydrate dehydratase/NAD(P)H-hydrate epimerase	NA	NA	NA	NA	NA
WP_001550482.1|4718813_4719953_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_010723271.1|4719935_4719989_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295188.1|4720852_4721398_-	oligoribonuclease	NA	Q8B5Y0	Diachasmimorpha_longicaudata_entomopoxvirus	40.4	2.2e-28
WP_000041959.1|4721492_4722545_+	small ribosomal subunit biogenesis GTPase RsgA	NA	NA	NA	NA	NA
WP_000934925.1|4722641_4723610_+	phosphatidylserine decarboxylase	NA	NA	NA	NA	NA
WP_001550481.1|4723631_4726955_+	miniconductance mechanosensitive channel MscM	NA	NA	NA	NA	NA
WP_001276175.1|4726983_4727298_-	YjeO family protein	NA	NA	NA	NA	NA
WP_019842468.1|4727395_4728898_-	glutamate/gamma-aminobutyrate family transporter YjeM	NA	NA	NA	NA	NA
WP_001550479.1|4729116_4730094_-	elongation factor P--(R)-beta-lysine ligase	NA	A0A2K9KZX5	Tupanvirus	28.2	4.0e-28
WP_001192973.1|4730418_4732227_+	fumarate reductase (quinol) flavoprotein subunit	NA	NA	NA	NA	NA
WP_000829498.1|4732219_4732954_+	fumarate reductase iron-sulfur protein	NA	NA	NA	NA	NA
WP_000208763.1|4732964_4733360_+	fumarate reductase subunit FrdC	NA	NA	NA	NA	NA
WP_000609663.1|4733370_4733730_+	fumarate reductase subunit FrdD	NA	NA	NA	NA	NA
WP_001550478.1|4733792_4734926_+	BlaEC family class C beta-lactamase	NA	NA	NA	NA	NA
WP_001550477.1|4735013_4735547_+	lipocalin Blc	NA	A0A1W6JNX6	Morganella_phage	55.0	2.7e-47
WP_000118482.1|4735543_4735861_-	quaternary ammonium compound efflux SMR transporter SugE	NA	NA	NA	NA	NA
WP_000239596.1|4736035_4736182_-	lipoprotein toxin entericidin B	NA	NA	NA	NA	NA
WP_000977754.1|4736292_4736418_-	lipoprotein antitoxin entericidin A	NA	NA	NA	NA	NA
WP_000257278.1|4736469_4737036_-	elongation factor P	NA	NA	NA	NA	NA
WP_000940514.1|4737077_4738106_+	EF-P beta-lysylation protein EpmB	NA	NA	NA	NA	NA
WP_001008025.1|4738340_4739210_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000558209.1|4739259_4739613_-	DUF4156 domain-containing protein	NA	NA	NA	NA	NA
WP_000729117.1|4739750_4741397_-	chaperonin GroEL	NA	A0A2I7SAK5	Vibrio_phage	68.9	5.3e-190
WP_001026276.1|4741440_4741734_-	co-chaperone GroES	NA	K4F9I2	Cronobacter_phage	45.4	9.2e-13
WP_000015844.1|4742009_4743266_+	L-methionine/branched-chain amino acid transporter	NA	NA	NA	NA	NA
WP_001267445.1|4743281_4743758_-	membrane protein FxsA	NA	NA	NA	NA	NA
WP_000069437.1|4744094_4745531_+	aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_000961959.1|4745648_4746950_+	anaerobic C4-dicarboxylate transporter DcuA	NA	NA	NA	NA	NA
4746756:4746772	attL	GCTTCTTTCGCTGCGGT	NA	NA	NA	NA
WP_000883400.1|4747064_4747403_+	divalent cation tolerance protein CutA	NA	NA	NA	NA	NA
WP_001550476.1|4747378_4749076_+	protein-disulfide reductase DsbD	NA	NA	NA	NA	NA
WP_001188520.1|4749112_4749688_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_173009536.1|4750067_4751330_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A1B0VMI6	Pseudomonas_phage	42.8	4.5e-80
WP_000608644.1|4752859_4754122_+|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_000239590.1|4754377_4755253_+	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_001393253.1|4755299_4755632_-	cupin fold metalloprotein, WbuC family	NA	NA	NA	NA	NA
WP_149003591.1|4757530_4758759_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	96.0	1.4e-171
4761096:4761112	attR	GCTTCTTTCGCTGCGGT	NA	NA	NA	NA
>prophage 1
NZ_CP042879	Escherichia coli strain NMBU_W05E18 plasmid pNMBU-W05E18_01, complete sequence	132874	1220	63665	132874	integrase,bacteriocin,transposase	Stx2-converting_phage(20.0%)	55	NA	NA
WP_001066947.1|1220_1961_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	57.6	1.6e-24
WP_001332784.1|2081_2270_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001072358.1|2636_3806_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001322642.1|4652_4925_-	adhesin biosynthesis transcription regulatory family protein	NA	NA	NA	NA	NA
WP_173009539.1|7111_7564_-	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	32.6	6.4e-05
WP_173009540.1|8070_8328_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000371883.1|9529_9790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000194542.1|9786_10296_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000142452.1|10315_10663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001336934.1|10791_11010_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001537591.1|13597_14473_+	ChaN family lipoprotein	NA	NA	NA	NA	NA
WP_000981091.1|14480_15257_+	energy transducer TonB	NA	NA	NA	NA	NA
WP_001100763.1|15425_17687_+	TonB-dependent receptor	NA	NA	NA	NA	NA
WP_001020413.1|17755_18931_+	enterotoxin production-related protein TieB	NA	NA	NA	NA	NA
WP_000065240.1|20252_21008_-	ATP-binding protein	NA	U5N3V8	Enterobacteria_phage	33.9	3.2e-33
WP_000143800.1|21004_22504_-|transposase	IS21-like element ISEc10 family transposase	transposase	NA	NA	NA	NA
WP_173009541.1|24074_24530_+	hypothetical protein	NA	A0A0U4J920	Pseudomonas_phage	32.6	6.5e-05
WP_000839179.1|26483_26888_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|26884_27232_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_000099150.1|27280_28819_+|transposase	IS66-like element ISEc22 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.8	5.9e-292
WP_001057995.1|29122_29971_+	3'-5' exonuclease	NA	K7RFY5	Vibrio_phage	40.1	3.5e-28
WP_001337004.1|30087_30570_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001545316.1|30779_31040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001089474.1|31146_31410_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000119542.1|31399_31699_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_000877662.1|32056_32332_+|bacteriocin	bacteriocin immunity protein	bacteriocin	NA	NA	NA	NA
WP_025999368.1|32409_33597_-	MFS transporter	NA	NA	NA	NA	NA
WP_000020504.1|33653_34415_-	ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	30.7	8.0e-16
WP_001545318.1|34414_35452_-	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_000756334.1|35451_36450_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000456855.1|37535_38327_+	AraC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000466682.1|38531_38948_-	SdiA-regulated domain-containing protein	NA	NA	NA	NA	NA
WP_106378881.1|39159_40387_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.7	1.9e-168
WP_079414660.1|40685_41171_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000243157.1|41278_41701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162929852.1|41716_44233_-	fimbria/pilus outer membrane usher protein	NA	NA	NA	NA	NA
WP_000471454.1|44295_45048_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_173009542.1|45270_45483_+	reverse transcriptase	NA	NA	NA	NA	NA
WP_001336919.1|46048_46618_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	Q9LA58	Enterobacterial_phage	44.2	6.4e-26
WP_000874189.1|48602_49088_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001267176.1|49112_49598_-	TlpA family protein disulfide reductase	NA	NA	NA	NA	NA
WP_000117262.1|49584_50280_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	7.5e-29
WP_000729218.1|50284_51415_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000964653.1|51404_52688_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000119836.1|52690_54070_-	DUF2318 domain-containing protein	NA	NA	NA	NA	NA
WP_000178050.1|54173_54701_-	iron transporter	NA	NA	NA	NA	NA
WP_001332815.1|54741_56628_-	FTR1 family iron permease	NA	NA	NA	NA	NA
WP_012372823.1|56974_57790_-	Na(+)-translocating NADH-quinone reductase subunit C	NA	NA	NA	NA	NA
WP_001067855.1|58122_58827_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000621194.1|59425_60898_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_001057737.1|60894_61617_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	35.5	1.6e-34
WP_001177183.1|61758_62358_+	cytochrome b/b6 domain-containing protein	NA	NA	NA	NA	NA
WP_000712166.1|62368_63139_+	molybdopterin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000738203.1|63168_63417_+	hypothetical protein	NA	NA	NA	NA	NA
WP_137491101.1|63566_63665_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	93.8	7.0e-10
>prophage 1
NZ_CP042880	Escherichia coli strain NMBU_W05E18 plasmid pNMBU-W05E18_02, complete sequence	49825	17234	24115	49825		Rhodococcus_virus(33.33%)	9	NA	NA
WP_000117622.1|17234_17735_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.3	4.2e-05
WP_173009546.1|18516_19044_+	single-stranded DNA-binding protein	NA	I3PGW4	Xanthomonas_phage	73.5	1.0e-46
WP_001042948.1|19100_19334_+	DUF905 domain-containing protein	NA	A0A096XUX0	Cronobacter_phage	51.1	1.5e-05
WP_173009547.1|19395_21354_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	29.2	2.8e-20
WP_000845953.1|21408_21843_+	conjugation system SOS inhibitor PsiB	NA	NA	NA	NA	NA
WP_001276263.1|21839_22559_+	plasmid SOS inhibition protein A	NA	NA	NA	NA	NA
WP_000978012.1|22555_23152_+	hypothetical protein	NA	A0A0N7KZV3	Escherichia_phage	61.9	3.1e-15
WP_173009548.1|23223_23694_+	DUF1472 domain-containing protein	NA	NA	NA	NA	NA
WP_000117622.1|23614_24115_+	antirestriction protein ArdA	NA	G9FHQ1	Rhodococcus_virus	27.3	4.2e-05
