The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP042882	Klebsiella pneumoniae strain NMBU-W07E18 chromosome, complete genome	5314939	1432394	1518524	5314939	integrase,capsid,head,terminase,protease,tail,tRNA,holin,portal	Klebsiella_phage(30.91%)	100	1455397:1455424	1495767:1495794
WP_002913437.1|1432394_1433813_+|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_002913435.1|1433864_1434257_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_002913434.1|1434260_1434614_-	putative DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_004151096.1|1435235_1437407_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_002913423.1|1437455_1438658_-	nucleoside permease NupC	NA	NA	NA	NA	NA
WP_002913421.1|1439004_1440246_+	Nramp family divalent metal transporter	NA	NA	NA	NA	NA
WP_002913419.1|1440303_1440663_-	DUF2502 domain-containing protein	NA	NA	NA	NA	NA
WP_004174934.1|1440793_1441786_-	L-glyceraldehyde 3-phosphate reductase	NA	NA	NA	NA	NA
WP_099761833.1|1441966_1443628_+	indolepyruvate decarboxylase	NA	NA	NA	NA	NA
WP_023316074.1|1443624_1444860_-	ion channel protein	NA	NA	NA	NA	NA
WP_002913377.1|1445123_1446089_+	glucokinase	NA	NA	NA	NA	NA
WP_032419440.1|1446142_1446880_-	response regulator transcription factor	NA	A0A2R2ZGH8	Clostridioides_phage	25.9	3.2e-14
WP_004149230.1|1446891_1448589_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	28.5	6.7e-47
WP_004153200.1|1448587_1448701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004145585.1|1448697_1448883_-	hypothetical protein	NA	NA	NA	NA	NA
WP_002913372.1|1448971_1450186_+	alanine transaminase	NA	NA	NA	NA	NA
WP_099119320.1|1450256_1450328_-	membrane protein YpdK	NA	NA	NA	NA	NA
WP_032428036.1|1450666_1451863_-	cyanate transporter	NA	NA	NA	NA	NA
WP_009486224.1|1451859_1452318_-	nucleoside deaminase	NA	A0A0B5J096	Pandoravirus	32.3	1.6e-11
WP_004149227.1|1452450_1453359_+	transcriptional regulator CynR	NA	A0A2P0ZL89	Lactobacillus_phage	24.2	4.6e-10
WP_009309554.1|1453368_1454250_-	hypothetical protein	NA	A0A2H4JEC4	uncultured_Caudovirales_phage	56.8	1.5e-05
WP_004174945.1|1454617_1455100_-	WbuC family cupin fold metalloprotein	NA	NA	NA	NA	NA
1455397:1455424	attL	TCGTTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_172988719.1|1455618_1456788_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2R2Z2Y0	Escherichia_phage	85.8	4.3e-202
WP_080850372.1|1456771_1456957_-	hypothetical protein	NA	G3CFG7	Escherichia_phage	63.2	2.1e-15
WP_099761773.1|1456979_1457537_-	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	64.3	4.3e-67
WP_172952758.1|1457538_1458135_-	DUF3850 domain-containing protein	NA	A0A0P0I3U9	Klebsiella_phage	56.2	2.6e-14
WP_080850368.1|1458131_1458359_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080850366.1|1458359_1458791_-	ead/Ea22-like family protein	NA	K7P6V8	Enterobacteria_phage	40.7	5.5e-06
WP_040209280.1|1458783_1459047_-	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	75.6	2.2e-29
WP_172988668.1|1459043_1459454_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172988721.1|1459581_1460367_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.4	1.9e-60
WP_172988723.1|1460366_1460666_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048264674.1|1461072_1461525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_094311060.1|1461844_1462477_-	helix-turn-helix domain-containing protein	NA	A0A1W6JP50	Morganella_phage	54.5	1.0e-48
WP_048264672.1|1462576_1462765_+	Cro/Cl family transcriptional regulator	NA	A0A1W6JP24	Morganella_phage	62.3	6.7e-17
WP_000230161.1|1462799_1463261_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	87.5	3.8e-69
WP_072042575.1|1463498_1463711_+	DUF4222 domain-containing protein	NA	S5M7S5	Escherichia_phage	70.9	1.1e-15
WP_040210607.1|1463667_1464582_+	conserved phage C-terminal domain-containing protein	NA	H2DE83	Erwinia_phage	59.6	4.0e-30
WP_172988725.1|1464578_1465388_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A1C9II58	Salmonella_phage	69.3	2.0e-110
WP_004184734.1|1465397_1465775_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A1C9IIA0	Salmonella_phage	73.6	5.1e-48
WP_172988729.1|1465787_1466768_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	67.2	8.4e-135
WP_172988731.1|1466781_1467360_+	DUF1133 family protein	NA	A0A0U2S606	Escherichia_phage	56.7	3.8e-50
WP_172988733.1|1467445_1467895_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001294159.1|1468168_1468555_+|holin	phage holin family protein	holin	A0A192Y8P2	Salmonella_phage	90.6	1.6e-57
WP_000243811.1|1468541_1468823_+|holin	phage holin family protein	holin	K7PKN9	Enterobacterial_phage	48.4	4.8e-19
WP_172988735.1|1468822_1469452_+	glycoside hydrolase family 19 protein	NA	G8C7W0	Escherichia_phage	90.4	4.4e-105
WP_172988738.1|1469459_1469729_+	hypothetical protein	NA	G8C7W1	Escherichia_phage	59.8	3.0e-18
WP_172988741.1|1469901_1470297_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172988743.1|1470591_1470942_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	77.2	1.2e-48
WP_032439286.1|1471332_1471830_+|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	74.5	1.1e-63
WP_110198617.1|1471833_1473585_+|terminase	terminase large subunit	terminase	A0A1W6JP18	Morganella_phage	69.5	3.0e-252
WP_000923127.1|1473732_1474959_+|portal	phage portal protein	portal	Q8SBI0	Shigella_phage	85.3	2.5e-208
WP_000999827.1|1474951_1475551_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	82.5	1.0e-90
WP_004104235.1|1475560_1476799_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	69.2	6.8e-158
WP_004104233.1|1476876_1477194_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	52.0	1.2e-21
WP_038434521.1|1477263_1477476_+	hypothetical protein	NA	A0A286S2A5	Klebsiella_phage	74.3	1.1e-15
WP_172988744.1|1477477_1477810_+|head	phage head closure protein	head	A0A286S2A2	Klebsiella_phage	98.2	2.9e-55
WP_004216814.1|1477802_1478342_+	HK97 gp10 family phage protein	NA	A0A286S249	Klebsiella_phage	99.4	3.0e-94
WP_048982730.1|1478338_1478704_+	DUF3168 domain-containing protein	NA	A0A286S1R1	Klebsiella_phage	95.0	7.1e-63
WP_172988746.1|1478760_1479252_+|tail	phage tail protein	tail	A0A286S1Q8	Klebsiella_phage	97.5	2.3e-85
WP_001177591.1|1479295_1479649_+|tail	phage tail assembly chaperone family protein, TAC	tail	A0A286S1N4	Klebsiella_phage	99.1	4.9e-61
WP_061154019.1|1479681_1479945_+	hypothetical protein	NA	A0A286S1P2	Klebsiella_phage	97.7	1.5e-43
WP_094311071.1|1480008_1480401_+	hypothetical protein	NA	A0A286S1N7	Klebsiella_phage	41.4	3.6e-20
WP_094311072.1|1480470_1482903_+|tail	phage tail tape measure protein	tail	A0A286S1S3	Klebsiella_phage	86.1	0.0e+00
WP_004207036.1|1482902_1483373_+	hypothetical protein	NA	A0A286S298	Klebsiella_phage	67.7	8.3e-64
WP_023317177.1|1483369_1483852_+	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	90.6	7.2e-79
WP_064143746.1|1483862_1484243_+	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	94.4	6.9e-69
WP_172988749.1|1484239_1487308_+	kinase	NA	A0A286S259	Klebsiella_phage	90.6	0.0e+00
WP_172988751.1|1487363_1489886_+	right-handed parallel beta-helix repeat-containing protein	NA	A0A1U9ZA50	Proteus_phage	37.3	4.8e-17
WP_048256738.1|1489893_1490199_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162859349.1|1490273_1490423_-	hypothetical protein	NA	A0A2H5BN82	Klebsiella_phage	73.5	3.0e-12
WP_048256783.1|1490431_1491373_-	hypothetical protein	NA	A0A2H5BN49	Klebsiella_phage	89.4	1.4e-163
WP_099761331.1|1492180_1492759_+	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	89.1	1.5e-86
WP_172988753.1|1492809_1493232_+	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.0	2.1e-26
WP_040225406.1|1493891_1494131_+	hypothetical protein	NA	I6PD82	Cronobacter_phage	55.7	1.2e-21
WP_172988755.1|1494133_1494460_+	hypothetical protein	NA	K7PGV5	Enterobacterial_phage	51.9	4.7e-26
WP_172988757.1|1494524_1494911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050849656.1|1494892_1495138_-	hypothetical protein	NA	NA	NA	NA	NA
WP_129088477.1|1495158_1495455_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004149224.1|1495882_1496812_-	formate/nitrite transporter family protein	NA	E7DYY8	Enterobacteria_phage	81.4	6.7e-134
1495767:1495794	attR	TCGTTATATCCATTTAACTAAGGGGACA	NA	NA	NA	NA
WP_002913362.1|1497101_1497863_+	phospholipid-binding lipoprotein MlaA	NA	NA	NA	NA	NA
WP_002913360.1|1497924_1499247_-	long-chain fatty acid transporter FadL	NA	NA	NA	NA	NA
WP_004185011.1|1499620_1499905_+	YfcZ/YiiS family protein	NA	NA	NA	NA	NA
WP_019705519.1|1500064_1501375_+	acetyl-CoA C-acyltransferase FadI	NA	NA	NA	NA	NA
WP_099761155.1|1501374_1503519_+	fatty acid oxidation complex subunit alpha FadJ	NA	NA	NA	NA	NA
WP_002913355.1|1503728_1504214_+	phosphohistidine phosphatase SixA	NA	NA	NA	NA	NA
WP_002913348.1|1504234_1504786_-	endonuclease SmrB	NA	NA	NA	NA	NA
WP_002913346.1|1504953_1505886_+	50S ribosomal protein L3 N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_002913342.1|1505927_1507013_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	46.6	4.5e-89
WP_004174960.1|1507015_1507840_+	penicillin-insensitive murein endopeptidase	NA	NA	NA	NA	NA
WP_002913340.1|1507839_1508649_+	TSUP family transporter	NA	NA	NA	NA	NA
WP_002913339.1|1508648_1509197_+	elongation factor P hydroxylase	NA	NA	NA	NA	NA
WP_002913338.1|1509228_1509510_+	YfcL family protein	NA	NA	NA	NA	NA
WP_032435686.1|1509571_1511560_-|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_002913291.1|1511718_1512939_+	beta-ketoacyl-ACP synthase I	NA	NA	NA	NA	NA
WP_004149211.1|1513148_1514324_+	MFS transporter	NA	NA	NA	NA	NA
WP_022615607.1|1514410_1515388_-	flagella biosynthesis regulator Flk	NA	NA	NA	NA	NA
WP_023282883.1|1515498_1516635_+	4-phosphoerythronate dehydrogenase PdxB	NA	A0A2R8FDS8	Brazilian_cedratvirus	27.8	9.4e-21
WP_002913227.1|1516698_1517712_+	aspartate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_002913226.1|1517711_1518524_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP042882	Klebsiella pneumoniae strain NMBU-W07E18 chromosome, complete genome	5314939	1717325	1724232	5314939	tRNA	Planktothrix_phage(33.33%)	6	NA	NA
WP_004180551.1|1717325_1718189_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	27.5	5.7e-10
WP_023301146.1|1718199_1718973_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.2	1.3e-26
WP_004151134.1|1719215_1720112_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.8	6.1e-15
WP_004144192.1|1720354_1721716_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	94.8	1.8e-207
WP_004175198.1|1722034_1722757_-	two-component system response regulator BaeR	NA	W8CYM9	Bacillus_phage	33.2	8.3e-31
WP_004149058.1|1722753_1724232_-	two-component system sensor histidine kinase BaeS	NA	W8CYF6	Bacillus_phage	28.3	8.5e-30
>prophage 3
NZ_CP042882	Klebsiella pneumoniae strain NMBU-W07E18 chromosome, complete genome	5314939	1761993	1769618	5314939		Enterobacteria_phage(28.57%)	7	NA	NA
WP_004152488.1|1761993_1763400_+	NADP-dependent phosphogluconate dehydrogenase	NA	M4QQM4	Ostreococcus_lucimarinus_virus	28.7	4.7e-38
WP_004152487.1|1763624_1764689_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	55.0	3.4e-105
WP_004152486.1|1764715_1765585_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	67.0	9.8e-111
WP_004152485.1|1765616_1766507_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	33.6	2.8e-28
WP_004152484.1|1766521_1767076_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	58.2	3.8e-52
WP_004152483.1|1767256_1768423_+	UDP-glucose 6-dehydrogenase	NA	M1I798	Paramecium_bursaria_Chlorella_virus	54.7	4.1e-112
WP_004152482.1|1768616_1769618_+	NAD-dependent epimerase	NA	E3T4Y8	Cafeteria_roenbergensis_virus	28.6	1.2e-30
>prophage 4
NZ_CP042882	Klebsiella pneumoniae strain NMBU-W07E18 chromosome, complete genome	5314939	2692613	2703501	5314939		Escherichia_phage(87.5%)	9	NA	NA
WP_040189703.1|2692613_2695721_+	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	59.6	0.0e+00
WP_004176258.1|2695775_2697041_+	MFS transporter	NA	NA	NA	NA	NA
WP_001620097.1|2697071_2698160_-	AAA family ATPase	NA	A0A077SLJ9	Escherichia_phage	100.0	8.0e-211
WP_004183954.1|2698246_2698507_-	hypothetical protein	NA	A0A077SK33	Escherichia_phage	97.7	3.5e-40
WP_004176269.1|2698804_2699665_+	class A broad-spectrum beta-lactamase SHV-11	NA	A0A077SL40	Escherichia_phage	99.3	2.2e-155
WP_002210513.1|2699685_2700447_-	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	100.0	1.9e-134
WP_002903955.1|2700708_2701611_+	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	99.7	2.6e-159
WP_004190239.1|2701622_2702888_+	four-carbon acid sugar kinase family protein	NA	A0A077SLJ7	Escherichia_phage	99.5	3.9e-233
WP_002210516.1|2702880_2703501_+	aldolase	NA	A0A077SK32	Escherichia_phage	100.0	8.0e-115
>prophage 5
NZ_CP042882	Klebsiella pneumoniae strain NMBU-W07E18 chromosome, complete genome	5314939	2884587	2949691	5314939	transposase,integrase,terminase,tail,tRNA,holin,lysis	Escherichia_phage(28.57%)	76	2874992:2875007	2954470:2954485
2874992:2875007	attL	CGGCCAGCTGATGCCG	NA	NA	NA	NA
WP_099761326.1|2884587_2885853_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	83.6	6.0e-210
WP_099761328.1|2885854_2886274_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	57.9	2.5e-35
WP_168445798.1|2886351_2887839_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	35.5	2.0e-31
WP_172988753.1|2888844_2889267_-	hypothetical protein	NA	K7P834	Enterobacteria_phage	45.0	2.1e-26
WP_099761331.1|2889317_2889896_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	89.1	1.5e-86
WP_172988795.1|2890038_2892045_+	hypothetical protein	NA	L7TQP3	Acinetobacter_phage	27.5	2.7e-26
WP_048256738.1|2892052_2892358_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162859349.1|2892432_2892582_-	hypothetical protein	NA	A0A2H5BN82	Klebsiella_phage	73.5	3.0e-12
WP_172988850.1|2892590_2893532_-	hypothetical protein	NA	A0A2H5BN49	Klebsiella_phage	88.5	5.9e-162
WP_172988797.1|2894769_2897838_-	kinase	NA	A0A286S259	Klebsiella_phage	90.9	0.0e+00
WP_004207032.1|2897834_2898215_-	hypothetical protein	NA	A0A286S2A6	Klebsiella_phage	92.9	1.7e-67
WP_004207033.1|2898344_2898614_+	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_023317176.1|2898594_2898963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065806091.1|2898972_2899455_-	DUF1833 family protein	NA	A0A286S2B1	Klebsiella_phage	91.2	5.0e-80
WP_043875398.1|2899451_2899916_-	hypothetical protein	NA	A0A286S298	Klebsiella_phage	59.2	1.4e-52
WP_015958316.1|2900229_2900565_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099761335.1|2900648_2903762_-|tail	phage tail length tape measure family protein	tail	A0A2D1GPC9	Escherichia_phage	32.1	6.9e-90
WP_038421372.1|2903862_2904330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077256309.1|2904568_2904934_+	hypothetical protein	NA	A0A077K9U2	Edwardsiella_phage	41.1	1.5e-12
WP_172988799.1|2904919_2905165_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014386148.1|2905190_2906171_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	98.8	2.6e-184
WP_071845752.1|2906526_2906724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_026005925.1|2906861_2907344_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099761337.1|2907383_2908316_-	hypothetical protein	NA	A0A0D4DBN5	Acinetobacter_phage	27.0	3.7e-23
WP_086071002.1|2908339_2908732_-	electron transfer flavoprotein subunit beta	NA	NA	NA	NA	NA
WP_012967909.1|2908728_2909280_-	hypothetical protein	NA	G8C7Q1	Escherichia_phage	39.9	5.9e-29
WP_057214740.1|2909281_2909665_-	hypothetical protein	NA	A0A0S2SYG4	Pseudomonas_phage	44.4	4.6e-20
WP_099761338.1|2909666_2910077_-	protein singed	NA	A0A0H5AUF0	Pseudomonas_phage	38.2	5.1e-09
WP_072413058.1|2910080_2910293_-	hypothetical protein	NA	G8C7P8	Escherichia_phage	55.2	1.2e-09
WP_004184463.1|2910332_2911469_-	hypothetical protein	NA	G8C7P7	Escherichia_phage	76.5	2.8e-158
WP_004184465.1|2911556_2912321_-	hypothetical protein	NA	G8C7P6	Escherichia_phage	59.4	1.1e-76
WP_099761340.1|2912427_2913540_-	hypothetical protein	NA	I6PD76	Cronobacter_phage	53.6	9.0e-109
WP_099761342.1|2913523_2914948_-	DUF4055 domain-containing protein	NA	G8C7P4	Escherichia_phage	71.3	1.3e-192
WP_072045687.1|2914952_2916257_-|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	60.0	2.2e-146
WP_099761343.1|2916234_2917239_-|terminase	terminase small subunit	terminase	Q5QF76	Pseudomonas_virus	44.2	4.5e-35
WP_099761345.1|2917337_2918015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_163613273.1|2918793_2919018_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014832162.1|2919977_2920172_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_099761347.1|2920158_2920431_+	hypothetical protein	NA	NA	NA	NA	NA
WP_042935788.1|2920587_2920860_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099761348.1|2920860_2921325_-|lysis	lysis protein	lysis	A5LH84	Enterobacteria_phage	54.6	4.2e-36
WP_099761350.1|2921321_2921801_-	glycoside hydrolase family 104 protein	NA	A5VW81	Enterobacteria_phage	82.4	7.1e-71
WP_023304961.1|2921784_2922108_-|holin	phage holin, lambda family	holin	G5DA93	Enterobacteria_phage	81.3	2.1e-42
WP_050888101.1|2922855_2923242_+	hypothetical protein	NA	NA	NA	NA	NA
WP_099761351.1|2923616_2924414_-	antitermination protein	NA	H6WRZ1	Salmonella_phage	76.6	3.5e-115
WP_099761353.1|2924416_2924548_-	YlcG family protein	NA	A0A0M5M7B2	Salmonella_phage	71.1	1.8e-08
WP_099761354.1|2924544_2924889_-	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	72.8	2.3e-39
WP_099761356.1|2924885_2925182_-	DUF1364 domain-containing protein	NA	A0A0U2KD41	Escherichia_phage	71.9	4.6e-36
WP_099761358.1|2925390_2925987_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	79.6	2.5e-89
WP_132349619.1|2926352_2926619_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086647621.1|2926735_2927179_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_099761359.1|2927331_2929422_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	53.1	6.9e-203
WP_032428063.1|2929418_2929676_-	hypothetical protein	NA	NA	NA	NA	NA
WP_015958290.1|2929684_2929936_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	52.8	2.8e-10
WP_015958289.1|2929932_2930133_-	hypothetical protein	NA	A0A2R2Z313	Escherichia_phage	78.5	6.7e-23
WP_099761361.1|2930129_2930498_-	DUF977 family protein	NA	H6WRX9	Salmonella_phage	40.0	5.7e-12
WP_004121629.1|2930505_2931255_-	ATP-binding protein	NA	H6WRX8	Salmonella_phage	81.5	7.1e-118
WP_172952748.1|2931257_2932145_-	hypothetical protein	NA	Q8HA96	Salmonella_phage	52.2	2.1e-23
WP_099761363.1|2932162_2932957_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.7	4.8e-64
WP_032427957.1|2933085_2933622_-	hypothetical protein	NA	K7PJT7	Enterobacteria_phage	71.8	2.5e-64
WP_032427956.1|2933624_2933852_-	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	70.3	4.0e-24
WP_032427955.1|2933957_2934344_+	helix-turn-helix domain-containing protein	NA	A0A0M4R5D1	Salmonella_phage	78.7	4.3e-50
WP_063666496.1|2934557_2935862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032427954.1|2936487_2936796_+	hypothetical protein	NA	G8C7T6	Escherichia_phage	61.2	1.4e-24
WP_023282477.1|2937291_2937447_+	hypothetical protein	NA	K7PGY4	Enterobacteria_phage	71.2	2.0e-14
WP_099761364.1|2937584_2940833_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	54.1	1.7e-277
WP_094339448.1|2940845_2941955_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	86.7	2.0e-185
WP_172952749.1|2941989_2942688_+	hypothetical protein	NA	O03965	Myxococcus_phage	41.6	9.5e-40
WP_023159473.1|2942684_2942993_+	hypothetical protein	NA	I6PD68	Cronobacter_phage	55.9	7.1e-24
WP_032430507.1|2943000_2943240_+	DUF4060 family protein	NA	M9P0E0	Enterobacteria_phage	82.1	6.1e-31
WP_023159475.1|2943304_2943517_+	excisionase family protein	NA	A0A0U2RY08	Escherichia_phage	71.8	1.1e-23
WP_040206282.1|2943518_2944757_+|integrase	site-specific integrase	integrase	A0A0U2JGI6	Escherichia_phage	67.1	1.3e-161
WP_004179591.1|2944805_2945741_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	94.1	1.4e-139
WP_015958274.1|2945786_2947160_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	32.3	6.6e-53
WP_004148192.1|2947685_2948669_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_020316476.1|2948947_2949691_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	30.5	6.0e-16
2954470:2954485	attR	CGGCCAGCTGATGCCG	NA	NA	NA	NA
>prophage 6
NZ_CP042882	Klebsiella pneumoniae strain NMBU-W07E18 chromosome, complete genome	5314939	3321055	3332889	5314939	holin	Klebsiella_phage(37.5%)	12	NA	NA
WP_048256741.1|3321055_3321625_-	recombinase family protein	NA	A0A286S1P7	Klebsiella_phage	85.7	3.3e-83
WP_172988809.1|3321766_3323773_+	right-handed parallel beta-helix repeat-containing protein	NA	L7TQP3	Acinetobacter_phage	28.0	2.0e-26
WP_048256738.1|3323780_3324086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162859349.1|3324160_3324310_-	hypothetical protein	NA	A0A2H5BN82	Klebsiella_phage	73.5	3.0e-12
WP_048256783.1|3324318_3325260_-	hypothetical protein	NA	A0A2H5BN49	Klebsiella_phage	89.4	1.4e-163
WP_004199504.1|3326974_3327127_-	DUF1378 family protein	NA	NA	NA	NA	NA
WP_009308366.1|3327123_3327654_-	hypothetical protein	NA	K7P6W1	Enterobacteria_phage	48.9	2.4e-35
WP_048256735.1|3327650_3328190_-	lysozyme	NA	H6WRZ4	Salmonella_phage	77.5	6.5e-81
WP_004199490.1|3328191_3328407_-|holin	class II holin family protein	holin	A5LH82	Enterobacteria_phage	61.0	1.1e-12
WP_072071502.1|3329034_3329688_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004141527.1|3329751_3329964_+	hypothetical protein	NA	NA	NA	NA	NA
WP_048256727.1|3329964_3332889_-	hypothetical protein	NA	W6MWW8	Pseudomonas_phage	41.4	2.7e-197
>prophage 7
NZ_CP042882	Klebsiella pneumoniae strain NMBU-W07E18 chromosome, complete genome	5314939	3341852	3366696	5314939	head,protease,tail,integrase	Pectobacterium_phage(29.17%)	36	3334351:3334366	3375239:3375254
3334351:3334366	attL	ACTTTGATATTTTTGA	NA	NA	NA	NA
WP_004191050.1|3341852_3342326_-	hypothetical protein	NA	K4NYY6	Pseudomonas_phage	46.3	1.8e-26
WP_024623093.1|3342364_3343360_-	hypothetical protein	NA	W6MW28	Pseudomonas_phage	60.6	1.9e-105
WP_004191053.1|3343370_3344129_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029503969.1|3344115_3344439_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009308354.1|3344441_3346106_-|head,tail	head-tail connector protein	head,tail	A0A221SAN2	Ralstonia_phage	39.4	5.3e-105
WP_009308353.1|3346105_3347500_-	hypothetical protein	NA	A0A0E3JIA1	Rhodoferax_phage	36.9	3.1e-58
WP_020947865.1|3347584_3348037_-	hypothetical protein	NA	A3EYX3	Salmonella_phage	66.4	1.5e-49
WP_009308351.1|3348043_3348304_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048256716.1|3348287_3348521_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048256713.1|3348589_3348883_-	hypothetical protein	NA	G8C7W3	Escherichia_phage	70.1	1.4e-29
WP_023316634.1|3348879_3349236_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_072071501.1|3349223_3349547_-	DUF968 domain-containing protein	NA	A0A1I9KFA7	Aeromonas_phage	55.8	2.3e-25
WP_048256710.1|3349536_3350130_-	DUF1367 family protein	NA	H9C173	Pectobacterium_phage	71.6	2.7e-80
WP_029499143.1|3350198_3350390_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048256707.1|3350568_3350910_-	hypothetical protein	NA	A0A193GYX4	Enterobacter_phage	82.0	7.4e-46
WP_048256704.1|3350922_3351540_-	HNH endonuclease	NA	NA	NA	NA	NA
WP_009308338.1|3351536_3351767_-	hypothetical protein	NA	A0A2H4JCC5	uncultured_Caudovirales_phage	38.7	2.9e-06
WP_009308336.1|3351769_3352360_-	adenine methylase	NA	A0A2R9YJG0	Escherichia_phage	84.7	4.3e-94
WP_029499137.1|3352487_3353273_-	hypothetical protein	NA	C7BGF1	Burkholderia_phage	51.4	1.5e-62
WP_004141586.1|3353312_3353546_-	hypothetical protein	NA	NA	NA	NA	NA
WP_009308333.1|3353549_3354200_-	hypothetical protein	NA	NA	NA	NA	NA
WP_048256698.1|3354238_3355627_-	AAA family ATPase	NA	Q8HA30	Enterobacteria_phage	47.1	3.4e-105
WP_162859350.1|3355623_3356607_-	helix-turn-helix domain-containing protein	NA	H9C164	Pectobacterium_phage	72.9	5.1e-39
WP_016197573.1|3356609_3356768_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004199487.1|3356851_3357298_-	hypothetical protein	NA	H9C162	Pectobacterium_phage	56.1	7.4e-30
WP_024623103.1|3357358_3357553_-	Cro/Cl family transcriptional regulator	NA	K7PHK4	Enterobacteria_phage	45.9	1.7e-07
WP_024623104.1|3357632_3358034_+	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	60.2	2.7e-39
WP_029499124.1|3358974_3359208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_009308322.1|3359215_3359461_+	hypothetical protein	NA	A0A1B1W282	Salmonella_phage	58.1	1.8e-14
WP_099761400.1|3359490_3361620_+	hypothetical protein	NA	H9C157	Pectobacterium_phage	34.3	2.6e-96
WP_009308318.1|3361619_3362186_+	siphovirus Gp157 family protein	NA	H9C156	Pectobacterium_phage	61.5	2.5e-51
WP_004141609.1|3362187_3362373_+	hypothetical protein	NA	H9C155	Pectobacterium_phage	44.3	8.1e-07
WP_004199480.1|3362582_3362807_+	DUF4224 domain-containing protein	NA	H9C153	Pectobacterium_phage	68.1	4.5e-20
WP_073579172.1|3362810_3363839_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	54.1	2.6e-94
WP_023286208.1|3364114_3365767_-	oligopeptide transport system substrate-binding protein	NA	NA	NA	NA	NA
WP_002898458.1|3366036_3366696_+|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	46.6	3.2e-37
3375239:3375254	attR	ACTTTGATATTTTTGA	NA	NA	NA	NA
>prophage 8
NZ_CP042882	Klebsiella pneumoniae strain NMBU-W07E18 chromosome, complete genome	5314939	3478017	3487491	5314939	protease,tRNA	Brazilian_cedratvirus(16.67%)	8	NA	NA
WP_004209699.1|3478017_3479739_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	A0A2R8FG22	Brazilian_cedratvirus	34.3	1.5e-14
WP_002898014.1|3479783_3480485_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3480838_3481057_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_002896522.1|3481187_3483467_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.0	1.6e-165
WP_002896520.1|3483497_3483815_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	45.7	2.0e-13
WP_002896516.1|3484140_3484362_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	1.3e-16
WP_025368306.1|3484438_3486379_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.0	5.0e-38
WP_002896440.1|3486375_3487491_-	macrolide transporter subunit MacA	NA	A0A140XAI1	Dickeya_phage	52.7	1.3e-06
>prophage 1
NZ_CP042883	Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence	194856	1727	66372	194856	holin,transposase,integrase,protease	uncultured_Caudovirales_phage(26.32%)	59	NA	NA
WP_001515717.1|1727_2468_-|integrase	site-specific integrase	integrase	I3WFA4	Macacine_betaherpesvirus	58.6	5.4e-25
WP_004152065.1|3611_4559_+	sensor domain-containing diguanylate cyclase	NA	G3MA91	Bacillus_virus	30.6	1.8e-12
WP_071527918.1|4585_4897_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_172988905.1|4916_5885_+|transposase	IS5 family transposase	transposase	A0A1B0VFY5	Salmonella_phage	98.1	3.3e-184
WP_004197688.1|6557_6815_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080895248.1|7434_8871_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_004152070.1|9853_11131_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_004178088.1|11193_13191_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	9.7e-21
WP_085955172.1|14230_15438_-|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	63.2	1.7e-100
WP_004178091.1|16866_17298_-	silver-binding protein SilE	NA	NA	NA	NA	NA
WP_003032875.1|17548_19024_-	copper/silver sensor histidine kinase SilS	NA	W8CYF6	Bacillus_phage	30.1	1.0e-27
WP_001572351.1|19016_19697_-	copper/silver response regulator transcription factor SilR	NA	W8CYM9	Bacillus_phage	35.6	2.1e-31
WP_000475512.1|19886_21272_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel SilC	NA	NA	NA	NA	NA
WP_001246153.1|21300_21654_+	cation efflux system protein CusF	NA	NA	NA	NA	NA
WP_004152079.1|21767_23060_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit SilB	NA	NA	NA	NA	NA
WP_004098958.1|23070_26217_+	Cu(+)/Ag(+) efflux RND transporter permease subunit SilA	NA	S5VTK5	Leptospira_phage	22.5	4.0e-61
WP_000758228.1|26303_26744_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004098955.1|26870_29318_+	Ag(+)-translocating P-type ATPase SilP	NA	A0A218MNH6	uncultured_virus	35.8	7.6e-84
WP_000843497.1|29358_29556_+	DUF2933 domain-containing protein	NA	NA	NA	NA	NA
WP_004118669.1|29589_30327_-	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A2H4JAF5	uncultured_Caudovirales_phage	32.5	1.2e-11
WP_001023257.1|30615_31065_-	copper resistance protein	NA	NA	NA	NA	NA
WP_000925242.1|31298_33116_+	multicopper oxidase PcoA	NA	NA	NA	NA	NA
WP_001378118.1|33121_34012_+	copper resistance outer membrane transporter PcoB	NA	NA	NA	NA	NA
WP_000025662.1|34051_34432_+	copper resistance system metallochaperone PcoC	NA	NA	NA	NA	NA
WP_004118344.1|34436_35366_+	copper resistance inner membrane protein PcoD	NA	NA	NA	NA	NA
WP_001188930.1|35420_36101_+	copper response regulator transcription factor PcoR	NA	W8CYM9	Bacillus_phage	34.4	8.7e-30
WP_004152084.1|36097_37498_+	copper resistance membrane spanning protein PcoS	NA	W8CYF6	Bacillus_phage	26.3	4.1e-18
WP_004152085.1|37714_38149_+	copper resistance system metallochaperone PcoE	NA	NA	NA	NA	NA
WP_004152086.1|38380_38560_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_031944101.1|40302_40812_+	aquaporin	NA	NA	NA	NA	NA
WP_004152091.1|40861_41359_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152092.1|41690_42017_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_004152093.1|42013_42727_+	arsenical resistance protein ArsH	NA	A0A2H4J5V6	uncultured_Caudovirales_phage	77.0	2.9e-92
WP_004182005.1|42735_43281_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_004152095.1|43356_43719_+	arsenic metallochaperone ArsD family protein	NA	NA	NA	NA	NA
WP_004152096.1|45615_46152_+	N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152097.1|46184_46610_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.9	2.3e-52
WP_004152098.1|46622_47912_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	74.0	1.9e-171
WP_004152099.1|47959_49711_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_004152100.1|49728_50091_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_004152101.1|50140_50491_-	As(III)-sensing metalloregulatory transcriptional repressor ArsR	NA	A0A2H4J145	uncultured_Caudovirales_phage	50.9	1.4e-23
WP_004152102.1|50848_51118_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152103.1|51105_51681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152104.1|51711_52206_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_004152105.1|52249_52618_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152106.1|52651_52855_+	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_004152107.1|52903_53161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004152108.1|53236_53491_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003026799.1|53666_53933_+	DUF1778 domain-containing protein	NA	NA	NA	NA	NA
WP_003026803.1|53920_54403_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_004152113.1|57476_58439_-|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_009483782.1|58425_59175_-	phosphate-starvation-inducible PsiE family protein	NA	NA	NA	NA	NA
WP_004152115.1|59412_59610_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004152116.1|59609_62405_-	heat shock survival AAA family ATPase ClpK	NA	K4FB40	Cronobacter_phage	41.0	5.2e-129
WP_004152117.1|62519_63089_-	small heat shock protein sHSP20	NA	NA	NA	NA	NA
WP_004152118.1|63123_63405_-	helix-turn-helix domain-containing protein	NA	A0A1B1IUF9	uncultured_Mediterranean_phage	38.2	5.2e-05
WP_004118208.1|63648_63912_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004118209.1|63926_64190_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_014386148.1|65391_66372_+|transposase	IS5-like element ISKpn26 family transposase	transposase	Q38213	Escherichia_phage	98.8	2.6e-184
>prophage 2
NZ_CP042883	Klebsiella pneumoniae strain NMBU-W07E18 plasmid pNMBU-W07E18_01, complete sequence	194856	76246	86379	194856	transposase	Salmonella_phage(50.0%)	6	NA	NA
WP_000239590.1|76246_77122_-	class A extended-spectrum beta-lactamase CTX-M-15	NA	A0A1B0VBP7	Salmonella_phage	82.4	1.1e-125
WP_000608644.1|77377_78640_-|transposase	IS1380-like element ISEc9 family transposase	transposase	A0A1B0VDR3	Salmonella_phage	100.0	1.3e-39
WP_001235713.1|79203_79761_+	recombinase family protein	NA	Q1MVP4	Enterobacteria_phage	100.0	7.0e-94
WP_000027057.1|79943_80804_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|82507_83212_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001553819.1|83481_86379_+|transposase	Tn3-like element Tn5403 family transposase	transposase	A0A1B0V7H9	Salmonella_phage	37.8	4.2e-182
