The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054048	Yersinia massiliensis strain 2011N-4075 chromosome, complete genome	4909193	27	34556	4909193	capsid,portal,head,integrase,tail,plate,terminase,holin	Salmonella_phage(17.39%)	45	22393:22406	39703:39716
WP_108087865.1|27_624_-	YmfQ family protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	37.2	2.8e-32
WP_108087866.1|620_1757_-|plate	baseplate J/gp47 family protein	plate	B6SBU6	Clostridium_virus	25.7	9.8e-10
WP_108087867.1|1760_2198_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	48.2	2.6e-19
WP_108087868.1|2194_2788_-|plate	phage baseplate assembly protein	plate	NA	NA	NA	NA
WP_108087869.1|2784_3858_-|tail	phage tail protein	tail	M1PVV2	Vibrio_phage	30.9	1.6e-41
WP_172986824.1|3854_5261_-	DNA circularization protein	NA	A0A192Y5U9	Salmonella_phage	27.8	3.0e-24
WP_108087871.1|5318_7121_-	transglycosylase SLT domain-containing protein	NA	A0A2H4J9N7	uncultured_Caudovirales_phage	51.7	4.5e-25
WP_083159844.1|7238_7541_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_049615551.1|7542_7917_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_172986825.1|7929_9420_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	44.6	3.1e-104
WP_108087873.1|9419_9611_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_108087874.1|9616_10162_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_108087875.1|10158_10503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108087876.1|10502_10997_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108087806.1|10998_12045_-|capsid	major capsid protein	capsid	Q6UYI3	Burkholderia_phage	31.3	2.4e-39
WP_108087807.1|12153_12555_-|head	head decoration protein	head	A0A067ZIL6	Vibrio_phage	37.5	9.0e-11
WP_108087877.1|12554_13139_-	DNA primase	NA	NA	NA	NA	NA
WP_108087878.1|13138_13996_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	39.1	1.3e-51
WP_108088282.1|13992_15561_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	38.3	2.2e-97
WP_108087879.1|15629_15893_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_108088283.1|15901_17878_-|terminase	phage terminase large subunit family protein	terminase	G8EXZ6	Synechococcus_phage	45.3	1.7e-134
WP_108087880.1|17849_18449_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_108087881.1|18559_19084_-	HNH endonuclease	NA	A0A1W6DY33	Salmonella_phage	50.6	9.0e-35
WP_108087882.1|19160_19805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145566229.1|20037_20316_-	hypothetical protein	NA	NA	NA	NA	NA
WP_145566227.1|20334_20745_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986939.1|20755_21256_-	DUF2514 family protein	NA	Q7Y3V2	Yersinia_phage	83.7	1.3e-70
WP_049525582.1|21273_21672_-	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	61.7	1.0e-38
WP_049525581.1|21658_21976_-|holin	phage holin family protein	holin	E7C9S8	Salmonella_phage	57.6	8.4e-28
22393:22406	attL	CATAACCACCTTTA	NA	NA	NA	NA
WP_049606725.1|22765_22966_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108087887.1|23298_23700_-	antitermination protein	NA	S5M7R9	Escherichia_phage	56.3	2.6e-34
WP_172986826.1|23887_24904_-	hypothetical protein	NA	A0A1B5FPA6	Escherichia_phage	50.5	9.2e-68
WP_050535715.1|25003_27673_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	48.7	4.1e-232
WP_032898470.1|27669_28065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986827.1|28178_28382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_099460543.1|28384_28555_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_172986822.1|28532_28730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986828.1|28722_29517_-	ORF6N domain-containing protein	NA	F1C5A3	Cronobacter_phage	45.1	7.2e-44
WP_145519121.1|29509_29806_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_172986829.1|29960_30161_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_050880143.1|30354_30540_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172986830.1|30811_31432_-	hypothetical protein	NA	A0A0P0J0J7	Acinetobacter_phage	39.7	8.5e-24
WP_172986831.1|31540_31747_-	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	45.3	4.1e-07
WP_172986832.1|31891_32950_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108087895.1|33365_34556_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	59.0	3.2e-136
39703:39716	attR	CATAACCACCTTTA	NA	NA	NA	NA
>prophage 2
NZ_CP054048	Yersinia massiliensis strain 2011N-4075 chromosome, complete genome	4909193	359231	399778	4909193	terminase,capsid,portal,head,integrase,tail,plate,protease,holin	Shigella_phage(34.29%)	64	378970:378985	400834:400849
WP_098904284.1|359231_360224_-	hypothetical protein	NA	U5P0I1	Shigella_phage	47.6	1.5e-22
WP_050874971.1|360230_360812_-	YmfQ family protein	NA	O22003	Shigella_phage	64.6	3.9e-71
WP_172986837.1|360802_361861_-|plate	baseplate J/gp47 family protein	plate	U5P424	Shigella_phage	63.1	3.2e-132
WP_050874976.1|361853_362267_-	phage GP46 family protein	NA	A0A192Y6D0	Salmonella_phage	59.9	2.7e-42
WP_172986838.1|362270_362837_-|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	48.3	1.8e-33
WP_172986839.1|362836_363907_-|plate	baseplate protein	plate	U5P0H6	Shigella_phage	65.2	1.9e-132
WP_172986840.1|363903_365208_-	DNA circularization N-terminal domain-containing protein	NA	S5FUX4	Shigella_phage	55.8	5.0e-135
WP_172986841.1|365273_365828_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050090279.1|365790_367620_-|tail	phage tail tape measure protein	tail	M1FQW0	Enterobacteria_phage	61.0	2.0e-174
WP_050090283.1|367761_368028_-|tail	phage tail assembly protein	tail	M1FPE4	Enterobacteria_phage	63.5	9.5e-25
WP_038277325.1|368024_368381_-|tail	phage tail tube protein	tail	U5P076	Shigella_phage	85.6	9.1e-55
WP_172986842.1|368381_369875_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A192Y7L1	Salmonella_phage	68.5	4.6e-185
WP_049603053.1|369871_370078_-	DUF2635 domain-containing protein	NA	Q8SBH3	Shigella_phage	66.7	4.3e-09
WP_057645666.1|370084_370636_-	hypothetical protein	NA	S5FM61	Shigella_phage	58.2	1.8e-57
WP_057645669.1|370632_371151_-	hypothetical protein	NA	M1FPE2	Enterobacteria_phage	58.6	5.7e-50
WP_057645672.1|371150_371543_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_057645676.1|371539_371857_-|head,tail	phage gp6-like head-tail connector protein	head,tail	S5FKK6	Shigella_phage	62.3	8.1e-31
WP_057645732.1|371940_373167_-|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	68.5	8.0e-159
WP_057645679.1|373185_373785_-|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	76.0	1.0e-82
WP_172986843.1|373777_375010_-|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	82.2	1.4e-195
WP_019081897.1|374999_375161_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057645684.1|375157_376888_-|terminase	terminase large subunit	terminase	Q8HAD6	Salmonella_phage	81.8	1.3e-287
WP_050535723.1|376884_377379_-|terminase	phage terminase small subunit P27 family	terminase	U5P067	Shigella_phage	84.1	9.9e-76
WP_138774975.1|377555_377906_-	HNH endonuclease	NA	A0A1W6JP27	Morganella_phage	67.2	1.2e-43
WP_138775215.1|378001_378583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172986943.1|378656_379157_-	DUF2514 family protein	NA	Q7Y3V2	Yersinia_phage	84.3	2.0e-71
378970:378985	attL	CCGGCTGATTGTGCAG	NA	NA	NA	NA
WP_049525582.1|379174_379573_-	M15 family metallopeptidase	NA	E7C9S9	Salmonella_phage	61.7	1.0e-38
WP_049525581.1|379559_379877_-|holin	phage holin family protein	holin	E7C9S8	Salmonella_phage	57.6	8.4e-28
WP_049606725.1|380666_380867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986844.1|381248_382013_-	antitermination protein	NA	A0A286N2Q2	Klebsiella_phage	47.3	3.1e-60
WP_050875033.1|382028_383390_-	helicase	NA	Q8W640	Enterobacteria_phage	50.0	8.4e-117
WP_172986845.1|383386_384226_-	ATP-binding protein	NA	K7PLU3	Enterobacteria_phage	44.8	9.6e-63
WP_172986846.1|384258_385140_-	hypothetical protein	NA	A0A067ZIA1	Vibrio_phage	43.9	6.6e-30
WP_172986847.1|385136_385961_-	transporter	NA	Q8W644	Enterobacteria_phage	70.8	2.4e-114
WP_050151988.1|385980_386190_-	helix-turn-helix transcriptional regulator	NA	A0A1C9IHV8	Salmonella_phage	52.9	8.6e-13
WP_050874302.1|386307_386997_+	helix-turn-helix transcriptional regulator	NA	F1C5C2	Cronobacter_phage	62.4	1.4e-80
WP_050874299.1|387186_387396_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050874297.1|387409_387628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050874294.1|387624_387816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172986848.1|387812_388178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172986849.1|388167_388368_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172986850.1|388360_388567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172986851.1|388556_388778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172986852.1|388770_389154_+	S24 family peptidase	NA	NA	NA	NA	NA
WP_172986853.1|389157_389592_+	hypothetical protein	NA	A0A286S1S2	Klebsiella_phage	41.0	2.3e-15
WP_172986854.1|389680_390040_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050079869.1|390036_390225_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050075091.1|390221_390752_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050079870.1|390765_391362_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050874145.1|391345_391471_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050874148.1|391467_391689_+	hypothetical protein	NA	A0A1B5FPG2	Escherichia_phage	55.6	6.9e-13
WP_050874150.1|391685_392060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050874152.1|392049_392511_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019210765.1|392503_392740_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050079875.1|392739_393006_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172665462.1|393002_393161_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172986855.1|393153_393447_+	hypothetical protein	NA	NA	NA	NA	NA
WP_025377636.1|393449_393650_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_172986856.1|393615_394809_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q8W6M6	Sinorhizobium_phage	37.9	4.9e-60
WP_050286551.1|394984_395764_-	molybdate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_004877266.1|395957_396098_-	multidrug efflux pump-associated protein, AcrZ family	NA	NA	NA	NA	NA
WP_108087933.1|396301_397093_+	molybdenum-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_050082513.1|397202_398714_+	molybdate ABC transporter ATP-binding protein ModF	NA	A0A1M7XV31	Cedratvirus	29.5	6.2e-12
WP_050082512.1|398959_399778_+|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
400834:400849	attR	CTGCACAATCAGCCGG	NA	NA	NA	NA
>prophage 3
NZ_CP054048	Yersinia massiliensis strain 2011N-4075 chromosome, complete genome	4909193	2495224	2566006	4909193	capsid,portal,head,plate,integrase,tail,tRNA,lysis,terminase,holin	Erwinia_phage(48.65%)	76	2508226:2508241	2531487:2531502
WP_050083160.1|2495224_2495620_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_019212474.1|2495622_2495928_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_108087304.1|2496053_2496446_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_050286895.1|2496632_2497022_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_050083155.1|2497018_2497723_-	DedA family protein	NA	NA	NA	NA	NA
WP_050083153.1|2497961_2498495_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050083152.1|2498747_2499557_-	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_050083218.1|2499800_2501102_-	MFS transporter	NA	NA	NA	NA	NA
WP_019212482.1|2501702_2503112_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_050083148.1|2503306_2504758_+	tagaturonate reductase	NA	NA	NA	NA	NA
WP_050286898.1|2504768_2506259_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_019212485.1|2506432_2506984_+	YgjV family protein	NA	NA	NA	NA	NA
WP_050083145.1|2507050_2508307_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
2508226:2508241	attL	CGGCAATCAAGCCAAC	NA	NA	NA	NA
WP_167311508.1|2508639_2509623_-	TerC family protein	NA	A0A291LBC5	Escherichia_phage	35.6	1.8e-36
WP_099462050.1|2509678_2509873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050874444.1|2509978_2510980_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_050286901.1|2511077_2511581_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_050083136.1|2511869_2513057_+	23S rRNA (guanine(1835)-N(2))-methyltransferase RlmG	NA	NA	NA	NA	NA
WP_159074550.1|2513131_2516008_-	autotransporter outer membrane beta-barrel domain-containing protein	NA	NA	NA	NA	NA
WP_108087306.1|2516374_2518396_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_050083133.1|2518634_2519207_-	HdeD family acid-resistance protein	NA	NA	NA	NA	NA
WP_072084818.1|2519376_2520171_-	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_019212496.1|2520332_2520980_-	bifunctional 4-hydroxy-2-oxoglutarate aldolase/2-dehydro-3-deoxy-phosphogluconate aldolase	NA	NA	NA	NA	NA
WP_019212497.1|2521070_2522387_-	MFS transporter	NA	NA	NA	NA	NA
WP_050083127.1|2522428_2523421_-	2-dehydro-3-deoxygalactonokinase	NA	NA	NA	NA	NA
WP_050083125.1|2523578_2524598_-	2-dehydro-3-deoxygalactonokinase	NA	NA	NA	NA	NA
WP_057650849.1|2524677_2525829_-	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_057650847.1|2526127_2527303_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_098904993.1|2527413_2527863_+	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_159074551.1|2528218_2529154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_108087307.1|2529166_2530177_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	91.5	6.1e-181
WP_108087308.1|2530176_2530755_-	phage repressor protein CI	NA	A0A218M4J1	Erwinia_phage	63.0	5.6e-62
WP_064515257.1|2530884_2531160_+	hypothetical protein	NA	A0A218M4I5	Erwinia_phage	82.4	2.8e-35
WP_108087309.1|2531180_2531690_+	phage regulatory CII family protein	NA	A0A1S6L008	Salmonella_phage	51.2	2.1e-44
2531487:2531502	attR	GTTGGCTTGATTGCCG	NA	NA	NA	NA
WP_012303669.1|2531699_2531885_+	DUF2724 domain-containing protein	NA	NA	NA	NA	NA
WP_108087310.1|2531896_2532208_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108087311.1|2532273_2532522_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_108087312.1|2532508_2534791_+	replication endonuclease	NA	Q858T4	Yersinia_virus	57.2	1.7e-242
WP_050535850.1|2534810_2535170_+	hypothetical protein	NA	H9C172	Pectobacterium_phage	43.4	3.1e-18
WP_050535841.1|2535370_2535589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050535840.1|2535879_2536086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050535839.1|2536102_2536954_+	hypothetical protein	NA	I6PD67	Cronobacter_phage	54.2	5.9e-76
WP_108087314.1|2537339_2538377_-|portal	phage portal protein	portal	F1BUR7	Erwinia_phage	79.1	4.5e-163
WP_108087315.1|2538373_2540146_-|terminase	terminase ATPase subunit family protein	terminase	F1BUR2	Erwinia_phage	81.3	2.0e-288
WP_108087316.1|2540291_2541146_+|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	62.5	6.9e-93
WP_108087317.1|2541222_2542458_+|capsid	phage major capsid protein, P2 family	capsid	F1BUQ8	Erwinia_phage	74.4	1.9e-152
WP_108087318.1|2542461_2543121_+|terminase	terminase endonuclease subunit	terminase	F1BUQ7	Erwinia_phage	71.7	8.6e-83
WP_108087319.1|2543220_2543694_+|head	head completion/stabilization protein	head	M1SNN6	Escherichia_phage	56.1	4.9e-40
WP_020282765.1|2543693_2543897_+|tail	tail protein X	tail	A0A218M4L8	Erwinia_phage	65.7	5.4e-20
WP_019079970.1|2543899_2544109_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108087320.1|2544092_2544599_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	63.1	8.9e-56
WP_108087321.1|2544600_2545005_+|lysis	LysB family phage lysis regulatory protein	lysis	F1BUQ1	Erwinia_phage	50.4	1.5e-26
WP_071827698.1|2544976_2545174_+|holin	holin	holin	F1BUQ0	Erwinia_phage	54.8	5.2e-12
WP_108087322.1|2545112_2545568_+|tail	phage tail protein	tail	F1BUP9	Erwinia_phage	62.7	1.8e-47
WP_108087323.1|2545564_2546029_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	66.0	4.5e-46
WP_108087324.1|2546115_2546739_+	sce7726 family protein	NA	NA	NA	NA	NA
WP_108088232.1|2546724_2547756_-	beta family protein	NA	NA	NA	NA	NA
WP_108087325.1|2547761_2548304_-	ImmA/IrrE family metallo-endopeptidase	NA	Q854W5	Mycobacterium_virus	34.2	6.1e-10
WP_108087326.1|2548304_2549048_-	hydrolase	NA	NA	NA	NA	NA
WP_108087327.1|2549202_2549844_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	64.5	2.5e-71
WP_108087328.1|2549840_2550191_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	66.4	2.0e-38
WP_108087329.1|2550195_2551104_+|plate	baseplate assembly protein	plate	F1BUP3	Erwinia_phage	79.8	1.9e-125
WP_108087330.1|2551096_2551705_+|tail	phage tail protein I	tail	F1BUP2	Erwinia_phage	79.1	6.7e-90
WP_108087332.1|2552873_2553353_+|tail	phage tail protein	tail	F1BUP0	Erwinia_phage	46.2	1.8e-37
WP_145566058.1|2553479_2554649_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	F1BUU3	Erwinia_phage	80.5	3.1e-184
WP_108087336.1|2554662_2555178_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	73.7	1.0e-67
WP_108087337.1|2555231_2555543_+|tail	phage tail assembly protein	tail	F1BUU0	Erwinia_phage	62.5	1.6e-23
WP_004875948.1|2555575_2555698_+|tail	GpE family phage tail protein	tail	Q858U8	Yersinia_virus	71.1	2.0e-09
WP_108087338.1|2555690_2558123_+|tail	phage tail tape measure protein	tail	Q7Y4C8	Escherichia_virus	45.2	2.8e-147
WP_108087339.1|2558125_2558611_+|tail	phage tail protein	tail	A0A0F7LDE8	Escherichia_phage	59.9	6.3e-51
WP_108087340.1|2558607_2559771_+	phage late control D family protein	NA	A0A0M5M5V5	Salmonella_phage	67.2	7.9e-148
WP_072076720.1|2559877_2560096_+	DNA-binding transcriptional regulator	NA	Q37973	Salmonella_virus	70.8	1.6e-25
WP_019212504.1|2560524_2562363_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_050083118.1|2562520_2564269_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	1.0e-74
WP_001144069.1|2564404_2564620_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_019212506.1|2564992_2566006_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.7	1.1e-105
>prophage 4
NZ_CP054048	Yersinia massiliensis strain 2011N-4075 chromosome, complete genome	4909193	3488812	3533599	4909193	head,protease,integrase,tail	Salmonella_phage(23.91%)	63	3532387:3532400	3535596:3535609
WP_108087564.1|3488812_3489274_-	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	84.0	3.8e-53
WP_108087565.1|3489270_3490134_-	ATP-binding protein	NA	Q94MN8	Myxococcus_phage	44.9	2.4e-48
WP_172986898.1|3490144_3490321_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986899.1|3490317_3490497_-	DUF5444 family protein	NA	NA	NA	NA	NA
WP_099466446.1|3490493_3490625_-|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_128823345.1|3490719_3490926_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050311062.1|3491319_3491577_-	hypothetical protein	NA	U5PUY0	Salmonella_phage	53.8	1.4e-17
WP_072083845.1|3491738_3491918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172986900.1|3492061_3492292_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986901.1|3492352_3492700_-	hypothetical protein	NA	A0A0K2FII1	Escherichia_phage	34.9	8.4e-05
WP_050144656.1|3493342_3493549_+	hypothetical protein	NA	A0A2H5BFH9	Salmonella_phage	58.2	4.9e-13
WP_050945902.1|3493873_3494227_-	hypothetical protein	NA	NA	NA	NA	NA
WP_057532843.1|3494528_3495254_-	LexA family transcriptional regulator	NA	K7PK07	Enterobacteria_phage	61.2	3.6e-74
WP_172986902.1|3495700_3495991_+	hypothetical protein	NA	I6RSP4	Salmonella_phage	57.3	3.1e-21
WP_172986903.1|3496003_3496165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172986904.1|3496157_3497363_+	hypothetical protein	NA	Q7Y5W1	Haemophilus_phage	33.7	1.1e-06
WP_172986952.1|3497362_3498748_+	AAA family ATPase	NA	A0A0P0ZC27	Stx2-converting_phage	62.7	4.5e-158
WP_172986905.1|3498747_3499050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172986906.1|3499046_3499340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172986907.1|3499336_3499894_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172986908.1|3499890_3500130_+	DUF4752 family protein	NA	T1S9K2	Salmonella_phage	60.0	5.4e-19
WP_057649643.1|3500132_3500570_+	recombination protein NinB	NA	E5AGF7	Erwinia_phage	84.1	3.9e-68
WP_108087580.1|3500566_3500773_+	hypothetical protein	NA	A0A2H4P784	Pseudomonas_phage	47.6	8.2e-08
WP_077174391.1|3500896_3501412_+	hypothetical protein	NA	A0A0H4IQ56	Shigella_phage	72.8	7.9e-68
WP_172986909.1|3501404_3501551_+	hypothetical protein	NA	NA	NA	NA	NA
WP_050879018.1|3501525_3502119_+	recombination protein NinG	NA	A0A2R2Z332	Escherichia_phage	43.5	1.2e-38
WP_172986910.1|3502115_3502733_+	hypothetical protein	NA	A0A1V0E5R2	Salmonella_phage	56.3	7.5e-57
WP_172986911.1|3503128_3503452_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	61.2	1.1e-27
WP_050535746.1|3503654_3504167_+	HNH endonuclease	NA	G0XNS0	Escherichia_phage	54.1	6.3e-41
WP_172986912.1|3504341_3504557_+	peptidoglycan-binding protein LysM	NA	H9C183	Pectobacterium_phage	54.3	1.1e-12
WP_172986913.1|3504556_3505087_+	lysozyme	NA	H9C184	Pectobacterium_phage	74.3	5.3e-75
WP_172986914.1|3505079_3505469_+	exotoxin	NA	U5P0U9	Shigella_phage	30.8	1.4e-08
WP_108087586.1|3505883_3506570_+	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	85.1	3.2e-109
WP_172986953.1|3507232_3507847_+	hypothetical protein	NA	H9C189	Pectobacterium_phage	72.7	2.2e-85
WP_057649664.1|3507880_3508360_+	DUF2280 domain-containing protein	NA	F1C5D6	Cronobacter_phage	74.2	6.7e-61
WP_108087589.1|3508346_3509825_+	DNA-packaging protein	NA	G0ZND4	Cronobacter_phage	88.2	1.1e-260
WP_172986915.1|3510088_3511465_+	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	72.0	2.1e-179
WP_172986954.1|3511499_3512342_+|head	phage head morphogenesis protein	head	Q5G8Y3	Enterobacteria_phage	64.1	3.6e-94
WP_172986916.1|3512345_3513623_+	hypothetical protein	NA	G0ZND7	Cronobacter_phage	78.8	7.0e-190
WP_172986917.1|3513622_3514063_+	hypothetical protein	NA	A0A125RNM2	Pseudomonas_phage	64.1	5.4e-41
WP_057649678.1|3514073_3515171_+	hypothetical protein	NA	A0A125RNM3	Pseudomonas_phage	65.8	7.7e-137
WP_145585524.1|3515180_3515375_+	glycoprotein	NA	Q5G8X9	Enterobacteria_phage	70.3	9.1e-17
WP_172986918.1|3515438_3515837_+	hypothetical protein	NA	G0ZNE1	Cronobacter_phage	81.1	8.9e-59
WP_155483172.1|3516003_3516234_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172986919.1|3516234_3516585_+	hypothetical protein	NA	G0ZNE2	Cronobacter_phage	56.9	1.3e-29
WP_050879000.1|3516586_3516955_+	hypothetical protein	NA	F1C5E3	Cronobacter_phage	69.7	3.7e-43
WP_108087597.1|3516951_3517335_+	hypothetical protein	NA	G0ZNE4	Cronobacter_phage	66.9	2.4e-45
WP_172986920.1|3517359_3518109_+	Ig domain-containing protein	NA	G0ZNE6	Cronobacter_phage	51.2	9.5e-46
WP_108087599.1|3518183_3518789_-	hypothetical protein	NA	M9NZJ1	Enterobacteria_phage	47.2	4.8e-48
WP_108088261.1|3519122_3519461_+	hypothetical protein	NA	A0A222YZ97	Escherichia_phage	59.6	2.6e-27
WP_172986921.1|3519542_3520235_+	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	49.1	1.8e-51
WP_172986922.1|3520224_3522828_+	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	31.4	2.1e-84
WP_172986923.1|3522877_3523099_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172986924.1|3523160_3523511_+|tail	phage tail protein	tail	A0A1V0E5N3	Salmonella_phage	75.0	3.6e-48
WP_172986925.1|3523537_3523810_+	hypothetical protein	NA	NA	NA	NA	NA
WP_172986926.1|3523790_3524021_-	hypothetical protein	NA	NA	NA	NA	NA
WP_050287234.1|3524195_3524900_+|tail	phage minor tail protein L	tail	A0A1V0E5N2	Salmonella_phage	79.9	2.0e-109
WP_108087607.1|3524899_3525625_+	C40 family peptidase	NA	Q5G8W2	Enterobacteria_phage	67.9	1.6e-98
WP_050287232.1|3525567_3526095_+|tail	tail assembly protein	tail	H6WRW3	Salmonella_phage	58.0	9.7e-45
WP_172986927.1|3526104_3529272_+	host specificity protein J	NA	I6R9B3	Salmonella_phage	66.4	0.0e+00
WP_108087609.1|3529271_3530270_+	hypothetical protein	NA	I6PBN9	Cronobacter_phage	29.8	5.4e-20
WP_172986928.1|3531966_3532176_-	hypothetical protein	NA	NA	NA	NA	NA
3532387:3532400	attL	AGGTGGGGTTGGTG	NA	NA	NA	NA
WP_172986929.1|3532420_3533599_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	54.1	9.2e-128
WP_172986929.1|3532420_3533599_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	54.1	9.2e-128
3535596:3535609	attR	AGGTGGGGTTGGTG	NA	NA	NA	NA
>prophage 5
NZ_CP054048	Yersinia massiliensis strain 2011N-4075 chromosome, complete genome	4909193	3919831	3931600	4909193		Herpes_simplex_virus(16.67%)	7	NA	NA
WP_108087544.1|3919831_3922978_-	beta-galactosidase	NA	L0N6M2	Herpes_simplex_virus	63.2	0.0e+00
WP_108087545.1|3923126_3924152_-	LacI family DNA-binding transcriptional regulator	NA	C6ZCU4	Enterobacteria_phage	52.1	7.5e-86
WP_002210893.1|3924643_3924856_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	80.0	2.0e-25
WP_004701013.1|3925189_3925381_+	protein DsrB	NA	NA	NA	NA	NA
WP_108087546.1|3925529_3927269_-	Tar ligand binding domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	51.2	4.7e-11
WP_050083779.1|3928025_3928724_+	MgtC family protein	NA	G3MA03	Bacillus_virus	42.5	3.6e-15
WP_050083778.1|3928903_3931600_+	magnesium-translocating P-type ATPase	NA	M1HM40	Paramecium_bursaria_Chlorella_virus	25.6	1.2e-42
>prophage 6
NZ_CP054048	Yersinia massiliensis strain 2011N-4075 chromosome, complete genome	4909193	4024680	4057406	4909193	capsid,portal,protease,head,integrase,tail,terminase,holin	Enterobacteria_phage(25.81%)	40	4024524:4024583	4064124:4064244
4024524:4024583	attL	TTTAAAATCCCTCGGCTTATGGCTGTGCGGGTTCAAGTCCCGCCCCGGGCACCATGGAAA	NA	NA	NA	NA
WP_108087620.1|4024680_4025703_-|integrase	tyrosine-type recombinase/integrase	integrase	K7PLZ2	Enterobacterial_phage	69.9	5.0e-138
WP_050134996.1|4025702_4025930_-	DUF4224 domain-containing protein	NA	K7PHA0	Enterobacterial_phage	44.4	3.8e-14
WP_108087621.1|4026207_4026738_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	57.2	5.5e-48
WP_108087622.1|4027195_4027663_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108087623.1|4028018_4028651_-	LexA family transcriptional regulator	NA	K7PM82	Enterobacteria_phage	47.8	2.2e-43
WP_057645851.1|4028750_4028951_+	cell division protein	NA	NA	NA	NA	NA
WP_057650005.1|4028988_4029516_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	27.7	1.6e-10
WP_108087624.1|4029681_4029879_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_108087625.1|4029875_4030889_+	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	77.2	7.3e-33
WP_108087626.1|4030885_4032448_+	phage N-6-adenine-methyltransferase	NA	A0A2H4J5Y9	uncultured_Caudovirales_phage	54.9	8.2e-100
WP_108088263.1|4032471_4033116_+	phage antirepressor KilAC domain-containing protein	NA	G0ZND1	Cronobacter_phage	52.0	1.4e-53
WP_108087627.1|4033112_4034114_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	50.3	4.8e-93
WP_159074567.1|4034139_4034802_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	37.1	1.1e-32
WP_023160403.1|4035758_4036085_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_108087629.1|4036088_4036715_+	glycoside hydrolase family 19 protein	NA	K7PJS7	Enterobacterial_phage	63.7	5.3e-66
WP_108087630.1|4036711_4037044_+	DUF2570 domain-containing protein	NA	NA	NA	NA	NA
WP_108087632.1|4037329_4037554_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108087633.1|4037647_4037878_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108087634.1|4037880_4038231_+	HNH endonuclease	NA	A0A1B5FP94	Escherichia_phage	71.3	7.6e-46
WP_108087635.1|4038380_4038878_+|terminase	phage terminase small subunit P27 family	terminase	K7PHI2	Enterobacteria_phage	81.2	2.2e-70
WP_108087636.1|4038877_4040626_+|terminase	terminase large subunit	terminase	K7PKT2	Enterobacteria_phage	86.3	1.3e-298
WP_172986959.1|4040648_4040828_+	hypothetical protein	NA	A0A1B5FP99	Escherichia_phage	55.2	2.0e-10
WP_108087638.1|4040827_4042051_+|portal	phage portal protein	portal	Q8W629	Enterobacteria_phage	77.1	2.2e-180
WP_108087639.1|4042040_4042691_+|head,protease	HK97 family phage prohead protease	head,protease	Q8HAD3	Salmonella_phage	80.6	2.0e-100
WP_108087640.1|4042706_4043915_+|capsid	phage major capsid protein	capsid	A0A192Y5T6	Salmonella_phage	81.3	6.4e-185
WP_172986930.1|4043955_4044315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108087641.1|4044350_4044677_+|head,tail	phage gp6-like head-tail connector protein	head,tail	Q8SBH7	Shigella_phage	32.4	3.4e-08
WP_108087642.1|4044673_4045012_+|head	phage head closure protein	head	A0A2H4JHK5	uncultured_Caudovirales_phage	61.3	2.3e-31
WP_108087643.1|4045008_4045425_+	HK97 gp10 family phage protein	NA	A0A1P8DTH7	Proteus_phage	52.8	5.3e-30
WP_108087644.1|4045421_4045769_+	DUF3168 domain-containing protein	NA	K7P7Q9	Enterobacteria_phage	51.3	2.5e-25
WP_108087645.1|4045825_4046536_+	Ig-like domain-containing protein	NA	A0A1W6JP06	Morganella_phage	67.8	7.6e-45
WP_108087646.1|4046538_4046928_+|tail	phage tail protein	tail	Q9MCS5	Enterobacteria_phage	52.8	2.5e-26
WP_051144542.1|4046951_4047224_+	DUF4035 domain-containing protein	NA	Q9MCS5	Enterobacteria_phage	62.7	4.7e-19
WP_108087647.1|4047256_4050652_+|tail	phage tail tape measure protein	tail	A0A1P8DTH2	Proteus_phage	30.0	1.4e-99
WP_108087648.1|4050648_4051002_+|tail	phage tail protein	tail	K7PKL8	Enterobacterial_phage	51.3	3.6e-27
WP_108087649.1|4051010_4051763_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	54.6	4.2e-78
WP_108087650.1|4051765_4052479_+	C40 family peptidase	NA	A0A1W6JP31	Morganella_phage	58.2	1.4e-78
WP_108087651.1|4052534_4053077_+	hypothetical protein	NA	NA	NA	NA	NA
WP_108087652.1|4053131_4053722_+|tail	tail assembly protein	tail	A0A1W6JNY8	Morganella_phage	57.3	1.6e-51
WP_108087653.1|4053779_4057406_+	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	54.5	0.0e+00
4064124:4064244	attR	TTTAAAATCCCTCGGCTTATGGCTGTGCGGGTTCAAGTCCCGCCCCGGGCACCATGGAAAATATTCTAAGTAAAACAAAGTAGTATGAGTATGTCGTTAACCGCCGAGAGGCGGTTTTTTT	NA	NA	NA	NA
>prophage 1
NZ_CP054046	Yersinia massiliensis strain 2011N-4075 plasmid unnamed1, complete sequence	124188	7705	76645	124188	transposase,integrase	Escherichia_phage(37.5%)	70	59915:59931	72048:72064
WP_019213468.1|7705_8401_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.6	9.1e-43
WP_042807144.1|8892_9531_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_019212798.1|9819_10560_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_050875729.1|10617_12996_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_019213442.1|13156_13798_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_019213441.1|14282_14921_-	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_019213439.1|15663_16089_-	glutaredoxin-dependent arsenate reductase	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	72.1	4.3e-51
WP_019213438.1|16101_17391_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4J144	uncultured_Caudovirales_phage	73.7	5.1e-172
WP_019213437.1|17439_19191_-	arsenite efflux transporter ATPase subunit ArsA	NA	NA	NA	NA	NA
WP_011817072.1|19208_19571_-	arsenite efflux transporter metallochaperone ArsD	NA	NA	NA	NA	NA
WP_019213436.1|19617_19971_-	transcriptional regulator	NA	A0A2H4J145	uncultured_Caudovirales_phage	47.8	3.7e-24
WP_019213468.1|20332_21028_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.6	9.1e-43
WP_172986711.1|21064_21394_-	hypothetical protein	NA	A0A1B2LRT6	Wolbachia_phage	37.8	7.7e-08
WP_172986712.1|21414_22032_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986713.1|22058_22799_-	molybdopterin-guanine dinucleotide biosynthesis protein MobC	NA	NA	NA	NA	NA
WP_172986714.1|22806_24591_-	type IV secretory system conjugative DNA transfer family protein	NA	NA	NA	NA	NA
WP_172986715.1|25263_25554_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986716.1|25572_25986_-	H-NS histone family protein	NA	NA	NA	NA	NA
WP_172986743.1|26014_26218_-	hemolysin expression modulator Hha	NA	NA	NA	NA	NA
WP_172986717.1|26225_26522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986718.1|26591_27617_-	YadA-like family protein	NA	NA	NA	NA	NA
WP_172986719.1|27714_28020_-	conjugal transfer protein	NA	NA	NA	NA	NA
WP_172986720.1|28433_28859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986721.1|28845_29871_-	P-type DNA transfer ATPase VirB11	NA	NA	NA	NA	NA
WP_172986744.1|29942_31115_-	TriI protein	NA	NA	NA	NA	NA
WP_172986745.1|31138_32014_-	P-type conjugative transfer protein VirB9	NA	NA	NA	NA	NA
WP_172986722.1|32142_32826_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_172986723.1|32800_32947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986724.1|32995_34015_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_172986725.1|34026_34266_-	EexN family lipoprotein	NA	NA	NA	NA	NA
WP_050116472.1|34314_34569_-	Txe/YoeB family addiction module toxin	NA	NA	NA	NA	NA
WP_050116471.1|34565_34817_-	YoeB-YefM toxin-antitoxin system antitoxin YefM	NA	NA	NA	NA	NA
WP_172986726.1|34883_35597_-	type IV secretion system protein	NA	NA	NA	NA	NA
WP_172986727.1|35671_38419_-	VirB3 family type IV secretion system protein	NA	NA	NA	NA	NA
WP_172986728.1|38437_38728_-	TrbC/VirB2 family protein	NA	NA	NA	NA	NA
WP_172986729.1|38731_39343_-	lytic transglycosylase domain-containing protein	NA	NA	NA	NA	NA
WP_172986730.1|39774_40002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986731.1|40287_40596_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986732.1|40723_41710_-	replication initiation protein	NA	A0A222YYK1	Escherichia_phage	27.0	3.4e-19
WP_172986733.1|42780_42996_-	chromosome partitioning protein ParB	NA	NA	NA	NA	NA
WP_172986734.1|43016_43643_-	AAA family ATPase	NA	A2I303	Vibrio_virus	55.3	6.3e-51
WP_172986735.1|43694_43931_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986736.1|44246_45227_+	DUF1738 domain-containing protein	NA	A0A1V0EEV1	Caulobacter_phage	42.5	7.8e-56
WP_172986737.1|45254_45503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986738.1|45985_48148_-	DNA topoisomerase 3	NA	NA	NA	NA	NA
WP_172986739.1|48194_48413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019213468.1|48475_49171_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.6	9.1e-43
WP_172986746.1|50273_54506_-	inverse autotransporter beta domain-containing protein	NA	NA	NA	NA	NA
WP_019213434.1|54690_55386_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	44.0	2.7e-42
WP_145579294.1|56155_58756_+	autotransporter outer membrane beta-barrel domain-containing protein	NA	A0A2L1IV18	Escherichia_phage	56.4	1.8e-99
WP_019213431.1|58870_59488_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_042807111.1|59752_60103_-	hypothetical protein	NA	NA	NA	NA	NA
59915:59931	attL	TGATTTTATTTTTTTAT	NA	NA	NA	NA
WP_019213429.1|60177_60873_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.9	3.5e-42
WP_019213427.1|61781_62420_+	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_019213426.1|62903_63539_+	DUF1120 domain-containing protein	NA	NA	NA	NA	NA
WP_019213425.1|63737_64187_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PK80	Moraxella_phage	26.8	3.9e-10
WP_019213424.1|64405_65101_+|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.6	3.1e-43
WP_081578887.1|65177_65894_-|integrase	tyrosine-type recombinase/integrase	integrase	I3WFA4	Macacine_betaherpesvirus	54.8	3.1e-22
WP_019213422.1|66372_66690_-	CcdB family protein	NA	NA	NA	NA	NA
WP_019213421.1|66689_66935_-	type II toxin-antitoxin system CcdA family antitoxin	NA	NA	NA	NA	NA
WP_019213420.1|67415_68111_-|transposase	IS6 family transposase	transposase	A0A077SL39	Escherichia_phage	43.6	9.1e-43
WP_019213419.1|68314_68776_+	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	48.6	4.5e-30
WP_042807110.1|68775_69351_+	PIN domain-containing protein	NA	K4HZX4	Acidithiobacillus_phage	59.0	4.0e-52
WP_172986740.1|69661_70630_+	recombinase family protein	NA	M9Q1K0	Clostridium_phage	29.1	1.4e-09
WP_019213416.1|70667_71000_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019213415.1|70996_71704_-	ParA family protein	NA	A0A0A8IL09	Aurantimonas_phage	41.5	5.3e-38
WP_019213414.1|72131_73388_-	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	56.6	1.9e-139
72048:72064	attR	TGATTTTATTTTTTTAT	NA	NA	NA	NA
WP_019213413.1|73395_73815_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.9	7.4e-32
WP_019213411.1|74384_74621_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019213410.1|74680_76645_+	ParB/RepB/Spo0J family partition protein	NA	G8DH78	Emiliania_huxleyi_virus	31.3	6.6e-30
>prophage 1
NZ_CP054047	Yersinia massiliensis strain 2011N-4075 plasmid unnamed2, complete sequence	79154	20331	28569	79154		Klebsiella_phage(14.29%)	11	NA	NA
WP_172986766.1|20331_20895_-	helix-turn-helix transcriptional regulator	NA	A0A248SLB9	Klebsiella_phage	42.0	4.2e-06
WP_172986767.1|20994_21399_-	plasmid partitioning/stability family protein	NA	NA	NA	NA	NA
WP_172986768.1|21405_22383_-	StbA family protein	NA	A0A222YXF2	Escherichia_phage	44.7	5.0e-71
WP_172986769.1|22639_23140_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049615233.1|23567_23897_-	HigA family addiction module antidote protein	NA	B0VK57	Azospirillum_phage	36.4	8.5e-07
WP_172986770.1|23908_24199_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_172986771.1|24336_25158_-	N-6 DNA methylase	NA	A0A2K9V411	Faecalibacterium_phage	32.9	1.9e-23
WP_172986772.1|25534_25960_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	51.6	4.9e-31
WP_120806773.1|25959_27216_+	translesion error-prone DNA polymerase V subunit UmuC	NA	F1C5A5	Cronobacter_phage	55.1	1.3e-132
WP_145544398.1|27674_27902_-	hypothetical protein	NA	NA	NA	NA	NA
WP_172986821.1|27951_28569_-	dna-binding plasmid partition protein	NA	A0A219Y918	Aeromonas_phage	36.5	7.9e-22
