The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054160	Serratia fonticola strain Biosolid 3 chromosome, complete genome	5842462	660616	752858	5842462	capsid,integrase,tRNA,tail,terminase,plate,holin	Escherichia_phage(20.0%)	80	681789:681804	729728:729743
WP_024528176.1|660616_661036_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_021180656.1|661038_661344_-	DUF883 domain-containing protein	NA	NA	NA	NA	NA
WP_024483094.1|661507_661879_-	DUF1090 domain-containing protein	NA	NA	NA	NA	NA
WP_173408639.1|662091_662466_-	EnvZ/OmpR regulon moderator MzrA	NA	NA	NA	NA	NA
WP_021180653.1|662462_663137_-	DedA family protein	NA	NA	NA	NA	NA
WP_024528179.1|663336_663786_-	hypothetical protein	NA	NA	NA	NA	NA
WP_024528180.1|663973_664750_-	transcriptional regulator ExuR	NA	NA	NA	NA	NA
WP_173408640.1|666563_667976_+	glucuronate isomerase	NA	NA	NA	NA	NA
WP_173408641.1|667996_669487_+	altronate dehydratase	NA	NA	NA	NA	NA
WP_173408642.1|669563_670121_+	YgjV family protein	NA	NA	NA	NA	NA
WP_173408643.1|670241_671456_-	serine/threonine transporter SstT	NA	NA	NA	NA	NA
WP_173408644.1|671749_672487_-	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_173408645.1|672488_673469_-	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_024528187.1|673558_674065_-	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_173408646.1|675392_677414_-	NADPH-dependent 2,4-dienoyl-CoA reductase	NA	NA	NA	NA	NA
WP_098931810.1|679395_681102_+	amidohydrolase	NA	NA	NA	NA	NA
WP_024483079.1|681405_682746_+	APC family permease	NA	NA	NA	NA	NA
681789:681804	attL	TGGCTCCATTGCCAGC	NA	NA	NA	NA
WP_173408647.1|682750_684250_-	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	29.6	4.9e-17
WP_024528194.1|684370_685636_+	4-aminobutyrate--2-oxoglutarate transaminase	NA	A0A1V0SKB7	Klosneuvirus	27.6	5.4e-25
WP_021180637.1|685648_687103_+	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_161711735.1|687969_688623_-	Qnr family pentapeptide repeat protein	NA	NA	NA	NA	NA
WP_161711736.1|688814_689459_+	thermostable hemolysin	NA	NA	NA	NA	NA
WP_173408648.1|689455_690895_+	long-chain fatty acid--CoA ligase	NA	NA	NA	NA	NA
WP_161739844.1|690891_691548_+	iron-containing redox enzyme family protein	NA	NA	NA	NA	NA
WP_098929736.1|691544_692354_+	SDR family oxidoreductase	NA	A0A0K0KVL6	Prochlorococcus_phage	28.7	3.9e-05
WP_173408649.1|692350_692962_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024528198.1|695427_696885_+	EmmdR/YeeO family multidrug/toxin efflux MATE transporter	NA	NA	NA	NA	NA
WP_173408650.1|699755_701129_+	DUF3999 family protein	NA	NA	NA	NA	NA
WP_173408651.1|701492_702320_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_065684702.1|702303_702756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065684701.1|703305_703695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065684700.1|704380_704932_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_024528218.1|704995_705709_+	molecular chaperone	NA	NA	NA	NA	NA
WP_173408652.1|705683_705998_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_173408653.1|705975_706254_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065684698.1|706261_706969_+	molecular chaperone	NA	NA	NA	NA	NA
WP_173408654.1|706965_707727_+	molecular chaperone	NA	NA	NA	NA	NA
WP_173410105.1|710668_711517_+	adhesin	NA	NA	NA	NA	NA
WP_173410106.1|711828_712677_+	adhesin	NA	NA	NA	NA	NA
WP_173408655.1|712945_713425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173408656.1|713421_714450_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A218M4I3	Erwinia_phage	62.4	1.1e-116
WP_173408657.1|714499_715285_-	hypothetical protein	NA	M1PL51	Streptococcus_phage	22.4	5.9e-06
WP_071682591.1|715286_715871_-	phage repressor protein CI	NA	F1BUS8	Erwinia_phage	39.7	1.4e-31
WP_071682590.1|715988_716210_+	regulator	NA	NA	NA	NA	NA
WP_173408658.1|716762_716933_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173408659.1|716929_717430_+	replication protein B	NA	A0A0F7LBQ6	Escherichia_phage	63.9	2.0e-60
WP_173408660.1|717494_717767_+	DUF2732 family protein	NA	NA	NA	NA	NA
WP_071682586.1|717769_717994_+	TraR/DksA C4-type zinc finger protein	NA	Q9ZXI6	Pseudomonas_virus	41.9	3.1e-08
WP_173408661.1|718116_718389_+	DUF5405 family protein	NA	A0A0M4R2Q0	Salmonella_phage	52.2	1.0e-21
WP_173408662.1|718385_719108_+	Dcm methylase	NA	A0A1V0E7C5	Klebsiella_phage	60.8	1.5e-77
WP_173408663.1|719104_721408_+	replication endonuclease	NA	A0A0F7LBQ2	Escherichia_phage	59.1	5.2e-260
WP_173408476.1|721493_721676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173408664.1|722177_723296_+	ParB N-terminal domain-containing protein	NA	Q858T2	Yersinia_virus	29.4	1.1e-26
WP_173408665.1|723308_724322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173408666.1|728602_729448_+|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	70.5	4.4e-108
WP_173408667.1|729509_730691_+|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	76.9	2.6e-154
729728:729743	attR	TGGCTCCATTGCCAGC	NA	NA	NA	NA
WP_173408668.1|730694_731441_+|terminase	terminase	terminase	Q6K1I5	Salmonella_virus	63.2	2.1e-69
WP_173408669.1|732040_732244_+|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	71.6	8.3e-21
WP_173408670.1|732246_732456_+	hypothetical protein	NA	B6SD15	Bacteriophage	46.4	5.0e-05
WP_173408671.1|732439_732949_+	lysozyme	NA	A0A218M4K3	Erwinia_phage	71.9	1.9e-61
WP_173408672.1|732945_733218_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173408673.1|733214_733505_+|holin	holin	holin	S4TNY4	Salmonella_phage	63.5	7.2e-26
WP_173408674.1|733467_733935_+|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	74.8	2.0e-62
WP_173408675.1|733927_734377_+	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	72.6	1.6e-48
WP_173408676.1|734448_735090_+|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	71.8	2.2e-83
WP_173408677.1|735086_735434_+	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	71.9	2.5e-41
WP_173408678.1|736339_736867_+|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	73.4	1.5e-74
WP_173408679.1|739162_739588_+|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	43.5	2.9e-23
WP_173408680.1|739869_741039_+|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	82.1	1.6e-188
WP_141132051.1|741053_741575_+|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	77.3	2.2e-73
WP_074031002.1|741637_741934_+|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	78.8	1.3e-27
WP_071680395.1|741948_742086_+|tail	GpE family phage tail protein	tail	A0A0F7LCR6	Escherichia_phage	80.0	3.5e-15
WP_173408681.1|742078_744526_+|tail	phage tail tape measure protein	tail	U5N0T4	Enterobacteria_phage	45.8	2.2e-155
WP_173408682.1|745023_746199_+	phage late control D family protein	NA	Q6K1G4	Salmonella_virus	73.7	3.1e-160
WP_071682894.1|746270_746489_+	DNA-binding transcriptional regulator	NA	A0A2I8TV89	Erwinia_phage	63.9	3.6e-22
WP_024528265.1|746884_747373_+	G/U mismatch-specific DNA glycosylase	NA	NA	NA	NA	NA
WP_024528266.1|747422_749261_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	33.3	1.9e-34
WP_021179484.1|749418_751167_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	38.4	8.7e-74
WP_001144069.1|751304_751520_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_065684694.1|751844_752858_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	58.9	7.4e-110
>prophage 2
NZ_CP054160	Serratia fonticola strain Biosolid 3 chromosome, complete genome	5842462	1328031	1343715	5842462	tail	Cronobacter_phage(36.36%)	13	NA	NA
WP_021807641.1|1328031_1328397_+	phage antitermination protein Q	NA	B6SCY2	Bacteriophage	55.0	4.6e-30
WP_173408848.1|1328683_1329088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_065686661.1|1329191_1329854_+|tail	phage tail protein	tail	I6PBN6	Cronobacter_phage	63.1	6.8e-72
WP_143182220.1|1329927_1330281_+	hypothetical protein	NA	G8C7Q5	Escherichia_phage	52.6	2.7e-27
WP_081375768.1|1330277_1330583_+	DUF1799 domain-containing protein	NA	I6PD79	Cronobacter_phage	65.6	2.4e-19
WP_173408849.1|1331934_1332093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_024486957.1|1332376_1332718_+|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	40.2	1.5e-14
WP_059201583.1|1332726_1333479_+|tail	phage minor tail protein L	tail	K7PGX3	Enterobacteria_phage	57.4	1.3e-87
WP_065686658.1|1333481_1334192_+	C40 family peptidase	NA	M9NZD8	Enterobacteria_phage	55.7	3.9e-81
WP_173408850.1|1334188_1334842_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	49.3	1.1e-45
WP_173408851.1|1334900_1340579_+	DUF1983 domain-containing protein	NA	F1C571	Cronobacter_phage	54.7	7.2e-287
WP_173408852.1|1340620_1342303_+	hypothetical protein	NA	J9Q6E3	Salmonella_phage	46.6	2.2e-26
WP_024530943.1|1342977_1343715_-	class I SAM-dependent methyltransferase	NA	A0A1X9I6N4	Streptococcus_phage	43.6	1.9e-54
>prophage 3
NZ_CP054160	Serratia fonticola strain Biosolid 3 chromosome, complete genome	5842462	2328423	2338463	5842462		Enterobacteria_phage(25.0%)	12	NA	NA
WP_173410153.1|2328423_2329959_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	K7P6V4	Enterobacteria_phage	59.9	5.0e-134
WP_173409103.1|2331576_2331801_-	hypothetical protein	NA	Q24LE4	Clostridium_phage	42.5	1.6e-09
WP_173409104.1|2332213_2332705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173409105.1|2332953_2333340_-	helix-turn-helix transcriptional regulator	NA	K7PM35	Enterobacteria_phage	54.0	9.0e-32
WP_173409106.1|2333442_2333685_+	helix-turn-helix domain-containing protein	NA	A0A0M4QX15	Salmonella_phage	64.9	8.1e-23
WP_173409107.1|2333695_2334157_+	hypothetical protein	NA	H9C162	Pectobacterium_phage	42.9	1.6e-19
WP_173409108.1|2334172_2334412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173409109.1|2334417_2335530_+	hypothetical protein	NA	A0A0U2RT81	Escherichia_phage	44.7	1.2e-23
WP_173409110.1|2335492_2336017_+	replication protein	NA	A0A0U2JGJ0	Escherichia_phage	48.6	1.2e-39
WP_173409111.1|2336032_2336437_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173409112.1|2336429_2336753_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173409113.1|2337971_2338463_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	78.6	1.1e-69
>prophage 4
NZ_CP054160	Serratia fonticola strain Biosolid 3 chromosome, complete genome	5842462	2346738	2365646	5842462	plate,terminase	Escherichia_phage(94.12%)	19	NA	NA
WP_173409125.1|2346738_2348061_+|terminase	terminase	terminase	A0A0U2JTW9	Escherichia_phage	68.2	2.7e-184
WP_173410154.1|2349446_2350259_+	hypothetical protein	NA	A0A0U2I1R8	Escherichia_phage	70.0	1.6e-110
WP_173410155.1|2350224_2351547_+	NUDIX hydrolase	NA	A0A0U2QW61	Escherichia_phage	60.5	5.7e-94
WP_173409126.1|2351546_2352143_+	hypothetical protein	NA	A0A0U2S600	Escherichia_phage	48.0	1.0e-42
WP_173409127.1|2353253_2353721_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173410156.1|2353723_2354176_+	hypothetical protein	NA	A0A0U2S646	Escherichia_phage	52.0	1.2e-38
WP_173409128.1|2354172_2354607_+	hypothetical protein	NA	A0A0U2RTA8	Escherichia_phage	57.1	2.6e-40
WP_173409129.1|2354593_2355535_+	hypothetical protein	NA	A0A0U2SH76	Escherichia_phage	54.9	3.1e-94
WP_173409130.1|2355534_2356617_+	hypothetical protein	NA	A0A0U2KD19	Escherichia_phage	47.2	1.4e-98
WP_173409131.1|2356632_2357073_+	hypothetical protein	NA	A0A0U2S616	Escherichia_phage	48.6	1.2e-37
WP_173409132.1|2357075_2357480_+	hypothetical protein	NA	A0A0U2S634	Escherichia_phage	49.6	6.9e-35
WP_173409133.1|2357750_2359721_+	glycoside hydrolase family 104 protein	NA	H9C1A7	Pectobacterium_phage	53.0	1.3e-41
WP_173409134.1|2359731_2360397_+	hypothetical protein	NA	A0A0U2JGI7	Escherichia_phage	53.2	4.3e-58
WP_173409135.1|2360659_2361673_+	hypothetical protein	NA	A0A0U2QL72	Escherichia_phage	39.3	1.1e-60
WP_173409136.1|2361672_2362365_+|plate	phage baseplate protein	plate	A0A0U2JTX5	Escherichia_phage	43.2	7.9e-47
WP_173409137.1|2362361_2362706_+	hypothetical protein	NA	A0A0U2I1S2	Escherichia_phage	72.2	6.5e-42
WP_173409138.1|2363143_2363539_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173409139.1|2363644_2364871_+|plate	baseplate J/gp47 family protein	plate	A0A0U2RJZ0	Escherichia_phage	55.2	2.7e-122
WP_173409140.1|2364854_2365646_+	Ig-like domain-containing protein	NA	A0A0U2RK03	Escherichia_phage	57.6	1.6e-72
>prophage 5
NZ_CP054160	Serratia fonticola strain Biosolid 3 chromosome, complete genome	5842462	3144153	3225148	5842462	coat,capsid,integrase,tRNA,tail,terminase,protease,lysis,head,plate	Escherichia_phage(28.95%)	75	3154940:3154959	3188408:3188427
WP_021804595.1|3144153_3145137_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	7.6e-35
WP_173409375.1|3145350_3145545_-	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_004963673.1|3145516_3145873_-	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_024485856.1|3145915_3146113_-	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_071683678.1|3146210_3146762_-	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.7	1.2e-16
WP_021178149.1|3146765_3148694_-|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.7	1.1e-130
WP_173409376.1|3148998_3149577_+	DUF2239 family protein	NA	NA	NA	NA	NA
WP_065686075.1|3151815_3153099_-	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
3154940:3154959	attL	AAAGGGCCTCGAACGAGGCC	NA	NA	NA	NA
WP_071683683.1|3155064_3155283_-	DNA-binding transcriptional regulator	NA	S4TNZ3	Salmonella_phage	65.3	1.8e-21
WP_074031003.1|3159473_3159611_-|tail	GpE family phage tail protein	tail	O80316	Escherichia_phage	80.0	3.9e-14
WP_173409377.1|3159625_3159922_-|tail	phage tail assembly protein	tail	A0A0F7LDQ8	Escherichia_phage	78.8	2.3e-27
WP_141132051.1|3159983_3160505_-|tail	phage major tail tube protein	tail	S4TNZ0	Salmonella_phage	77.3	2.2e-73
WP_173409378.1|3160519_3161689_-|tail	phage tail sheath protein	tail	S4TRX2	Salmonella_phage	81.9	4.6e-188
WP_173409379.1|3161970_3162396_-|tail	tail fiber assembly protein	tail	B6SCW7	Bacteriophage	44.4	1.3e-23
WP_173409380.1|3162398_3163424_-	hypothetical protein	NA	F1BUK3	Cronobacter_phage	43.1	3.6e-19
WP_173409381.1|3163413_3164646_-|tail	phage tail protein	tail	Q858V4	Yersinia_virus	55.5	1.0e-60
WP_173409382.1|3164659_3165187_-|tail	phage tail protein I	tail	Q858V5	Yersinia_virus	73.4	4.0e-75
WP_173409383.1|3165179_3166088_-|plate	baseplate assembly protein	plate	A0A0F7LCJ3	Escherichia_phage	77.2	6.6e-126
WP_173409384.1|3166093_3166441_-	GPW/gp25 family protein	NA	F1BUP4	Erwinia_phage	71.9	1.9e-41
WP_173409385.1|3166437_3167079_-|plate	phage baseplate assembly protein V	plate	A0A0M4S6F6	Salmonella_phage	73.7	4.4e-84
WP_161712040.1|3167237_3168038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173409386.1|3168134_3168584_-	phage virion morphogenesis protein	NA	O80313	Escherichia_phage	67.8	6.7e-47
WP_173409387.1|3168726_3169662_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173409388.1|3169717_3170185_-|tail	phage tail protein	tail	A0A0F7LA33	Escherichia_phage	76.8	2.0e-62
WP_173409389.1|3170265_3170706_-|lysis	LysB family phage lysis regulatory protein	lysis	O80310	Escherichia_phage	46.0	6.2e-21
WP_173409390.1|3170702_3171212_-	lysozyme	NA	A0A218M4K3	Erwinia_phage	71.9	4.2e-61
WP_173409391.1|3171195_3171405_-	hypothetical protein	NA	B6SD15	Bacteriophage	46.4	5.0e-05
WP_141132037.1|3171407_3171611_-|tail	tail protein X	tail	U5N3E7	Enterobacteria_phage	68.7	5.4e-20
WP_173409392.1|3171610_3172117_-|head	head completion/stabilization protein	head	S4TNY1	Salmonella_phage	70.8	7.1e-61
WP_173409393.1|3172205_3172955_-|terminase	terminase	terminase	O80305	Escherichia_phage	65.5	2.5e-62
WP_173409394.1|3172958_3174110_-|capsid	phage major capsid protein, P2 family	capsid	Q778Y7	Enterobacteria_phage	76.0	1.2e-151
WP_173409395.1|3174172_3175018_-|capsid	GPO family capsid scaffolding protein	capsid	Q01088	Escherichia_phage	70.5	7.5e-108
WP_173409396.1|3175181_3176954_+|terminase	terminase ATPase subunit family protein	terminase	A0A218M4M1	Erwinia_phage	81.5	3.8e-287
WP_173409397.1|3178190_3178907_+	HNH endonuclease	NA	NA	NA	NA	NA
WP_173409398.1|3179549_3181337_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_173410190.1|3181332_3181740_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_173409399.1|3182106_3184521_-	replication endonuclease	NA	Q858T4	Yersinia_virus	60.3	4.6e-267
WP_173409400.1|3185125_3185398_-	DUF5405 family protein	NA	A0A0M4R2Q0	Salmonella_phage	48.9	1.1e-20
WP_173409401.1|3185520_3185775_-	DUF2732 family protein	NA	NA	NA	NA	NA
WP_039995117.1|3185838_3186339_-	hypothetical protein	NA	M1SV55	Escherichia_phage	68.7	2.1e-65
WP_173408479.1|3186335_3186506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021178192.1|3186520_3186805_-	hypothetical protein	NA	Q1JS60	Enterobacteria_phage	71.1	5.9e-33
WP_039995119.1|3186930_3187230_+	helix-turn-helix transcriptional regulator	NA	Q1JS61	Enterobacteria_phage	78.8	1.0e-38
WP_021178193.1|3187317_3188301_+|integrase	tyrosine-type recombinase/integrase	integrase	Q83VS6	Escherichia_phage	60.2	2.0e-112
WP_173409402.1|3188437_3189772_-	cytochrome c	NA	NA	NA	NA	NA
3188408:3188427	attR	AAAGGGCCTCGAACGAGGCC	NA	NA	NA	NA
WP_098931364.1|3189783_3191568_-	GMC family oxidoreductase	NA	NA	NA	NA	NA
WP_173409403.1|3191570_3192296_-	gluconate 2-dehydrogenase subunit 3 family protein	NA	NA	NA	NA	NA
WP_021178197.1|3192602_3193265_-	transglycosylase SLT domain-containing protein	NA	I6ZXX9	Escherichia_phage	34.3	5.0e-06
WP_024486844.1|3193374_3193674_+	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_173410191.1|3193869_3194742_+	metal ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_065685992.1|3194738_3195629_+	manganese/iron ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.3	1.8e-11
WP_024486841.1|3195628_3196492_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_024530033.1|3196491_3197352_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_173410192.1|3197804_3198590_+	fructosamine kinase family protein	NA	NA	NA	NA	NA
WP_065685989.1|3198678_3199239_-	YniB family protein	NA	NA	NA	NA	NA
WP_065685988.1|3199453_3200119_+	hexitol phosphatase HxpB	NA	NA	NA	NA	NA
WP_173409404.1|3200331_3201093_+	2-dehydro-3-deoxy-D-gluconate 5-dehydrogenase KduD	NA	Q06VL0	Trichoplusia_ni_ascovirus	29.0	5.7e-14
WP_024530036.1|3201314_3201863_+	metal-dependent hydrolase	NA	A0A127AVX7	Bacillus_phage	33.1	3.7e-07
WP_065685986.1|3202047_3203439_+	L-cystine transporter	NA	NA	NA	NA	NA
WP_173410193.1|3203555_3204476_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173410194.1|3204561_3205437_+	SDR family NAD(P)-dependent oxidoreductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.4	3.5e-15
WP_173409405.1|3205429_3206323_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_021178210.1|3206421_3207213_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_173409406.1|3207442_3208834_+	MFS transporter	NA	NA	NA	NA	NA
WP_021178212.1|3208921_3209800_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_173409407.1|3210066_3212115_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	34.4	8.3e-84
WP_173409408.1|3212134_3212848_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_021178215.1|3212943_3213441_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_098931999.1|3213681_3214929_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_173409409.1|3217719_3219156_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_173410195.1|3219159_3220131_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_065685975.1|3222668_3223466_-	molecular chaperone	NA	NA	NA	NA	NA
WP_065685974.1|3223484_3224009_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_065685973.1|3224020_3224539_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_173409410.1|3224602_3225148_-|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
>prophage 6
NZ_CP054160	Serratia fonticola strain Biosolid 3 chromosome, complete genome	5842462	5581928	5628436	5842462	transposase,plate,protease	Caulobacter_phage(28.57%)	42	NA	NA
WP_173410010.1|5581928_5582864_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_173410011.1|5583286_5584687_-	6-phospho-beta-glucosidase	NA	NA	NA	NA	NA
WP_098929201.1|5587219_5587969_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_065683532.1|5588006_5588243_-	DUF4282 domain-containing protein	NA	NA	NA	NA	NA
WP_098929203.1|5588435_5588663_-	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_173410012.1|5588668_5589703_-	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_173410013.1|5589967_5590660_+	HAD family hydrolase	NA	NA	NA	NA	NA
WP_173410014.1|5590880_5592125_-	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_021807716.1|5592340_5592916_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.1	2.1e-29
WP_071681669.1|5592988_5593567_-	tellurium resistance membrane protein TerD	NA	A0A2P1N0L4	Streptomyces_phage	42.1	1.5e-06
WP_021807714.1|5593624_5594668_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.7	8.5e-77
WP_065683517.1|5594691_5595147_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_065683516.1|5595170_5596337_-	TerD family protein	NA	NA	NA	NA	NA
WP_065683515.1|5596336_5596924_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	29.0	6.8e-15
WP_173410015.1|5597248_5598313_+	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_065683514.1|5598316_5599447_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	26.0	1.2e-28
WP_173410016.1|5599439_5600213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_098929213.1|5600214_5601294_+|protease	cysteine protease StiP family protein	protease	A0A172Q0S8	Acinetobacter_phage	35.7	4.6e-41
WP_065683511.1|5601293_5602250_+	HpcH/HpaI aldolase/citrate lyase family protein	NA	NA	NA	NA	NA
WP_173410017.1|5602252_5602726_+	tellurium resistance protein TerW	NA	NA	NA	NA	NA
WP_173408560.1|5602821_5603976_+|transposase	IS481 family transposase	transposase	NA	NA	NA	NA
WP_161738803.1|5604530_5605010_+	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_161738804.1|5605050_5605377_-	DUF2645 family protein	NA	NA	NA	NA	NA
WP_161738805.1|5605379_5606087_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021807361.1|5606564_5607203_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_173410018.1|5607223_5607868_+	TerD family protein	NA	NA	NA	NA	NA
WP_161738807.1|5607864_5608503_+	VWA domain-containing protein	NA	NA	NA	NA	NA
WP_173410019.1|5609640_5611242_+	protein phosphatase 2C domain-containing protein	NA	NA	NA	NA	NA
WP_173410020.1|5611272_5612772_+	kinase	NA	NA	NA	NA	NA
WP_065683504.1|5612873_5613470_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_173410021.1|5613526_5613808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_065683502.1|5614580_5615129_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_098929226.1|5615173_5615899_+	molecular chaperone	NA	NA	NA	NA	NA
WP_173410022.1|5615873_5616434_+	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_173410023.1|5616441_5617161_+	molecular chaperone	NA	NA	NA	NA	NA
WP_161738817.1|5617157_5617886_+	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_071682755.1|5622694_5622958_+	PAAR domain-containing protein	NA	E5E3Y0	Burkholderia_phage	46.5	1.6e-11
WP_173410024.1|5623048_5624509_+	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_173410025.1|5624533_5625718_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_173410026.1|5625683_5625923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173410027.1|5625888_5626278_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_173410028.1|5627320_5628436_+|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
