The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054212	Erwiniaceae bacterium PD-1 chromosome, complete genome	4617009	1107415	1112095	4617009	transposase	Shigella_phage(33.33%)	6	NA	NA
WP_173633062.1|1107415_1108629_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	58.1	3.4e-101
WP_173636122.1|1108647_1109121_+|transposase	transposase family protein	transposase	S5WIU1	Leptospira_phage	45.3	1.8e-29
WP_173633063.1|1109350_1109752_+	zinc ribbon domain-containing protein	NA	S4TR42	Salmonella_phage	52.2	5.7e-21
WP_173633064.1|1109991_1111138_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	89.6	9.8e-143
WP_173633065.1|1111334_1111775_+	hypothetical protein	NA	A0A218M4J4	Erwinia_phage	46.9	5.1e-31
WP_173633066.1|1111771_1112095_+	DUF1493 family protein	NA	A0A218M4K1	Erwinia_phage	48.8	2.0e-16
>prophage 2
NZ_CP054212	Erwiniaceae bacterium PD-1 chromosome, complete genome	4617009	1332104	1398138	4617009	tRNA,protease,transposase	Bodo_saltans_virus(12.5%)	55	NA	NA
WP_173633271.1|1332104_1332764_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_173633272.1|1332731_1333418_+	ABC transporter ATP-binding protein	NA	A0A2H4UU96	Bodo_saltans_virus	27.4	4.7e-07
WP_173633273.1|1333414_1335832_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_173633274.1|1335905_1336973_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_173633275.1|1336969_1337479_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_173633276.1|1337624_1338350_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_173633277.1|1338349_1338844_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_173633278.1|1339075_1340461_+|tRNA	cysteine--tRNA ligase	tRNA	F1C979	Terra1_virus	33.6	8.2e-43
WP_173633279.1|1340494_1340707_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_173633280.1|1340706_1341573_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	34.7	1.4e-32
WP_173633281.1|1342512_1342899_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173633282.1|1343635_1345297_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_173633283.1|1345309_1354357_+	hemagglutinin repeat-containing protein	NA	A0A0R6PJK4	Moraxella_phage	37.4	1.1e-31
WP_173633284.1|1354353_1354665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173636135.1|1354710_1354962_-	type I addiction module toxin, SymE family	NA	NA	NA	NA	NA
WP_173633285.1|1355105_1355219_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_173633286.1|1355603_1356458_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_173633287.1|1356692_1357040_+	anti-adapter protein IraP	NA	NA	NA	NA	NA
WP_173633288.1|1357203_1357302_-	YoaK family small membrane protein	NA	NA	NA	NA	NA
WP_173633289.1|1357368_1357596_-	DUF333 domain-containing protein	NA	NA	NA	NA	NA
WP_173632181.1|1357778_1358992_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	57.4	1.1e-99
WP_173633290.1|1359098_1359401_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173633291.1|1360528_1361053_-	outer membrane lipoprotein Blc	NA	A0A1W6JNX6	Morganella_phage	59.7	1.4e-48
WP_173633292.1|1361170_1361899_+	MerR family transcriptional regulator	NA	Q9EYF2	Enterobacteria_phage	44.3	1.2e-42
WP_173633293.1|1362127_1362562_+	nuclear transport factor 2 family protein	NA	NA	NA	NA	NA
WP_173633294.1|1362558_1363278_+	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_173633295.1|1363274_1364534_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_173633296.1|1364535_1365249_+	DUF1365 domain-containing protein	NA	NA	NA	NA	NA
WP_173633297.1|1365254_1366475_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_173633298.1|1366548_1367070_+	DUF3833 domain-containing protein	NA	NA	NA	NA	NA
WP_173636136.1|1367077_1368421_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173633299.1|1368675_1368855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173633300.1|1369051_1369915_-	aldo/keto reductase family oxidoreductase	NA	NA	NA	NA	NA
WP_173633301.1|1370012_1370174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173633302.1|1370462_1370897_-	DUF1311 domain-containing protein	NA	NA	NA	NA	NA
WP_173633303.1|1372241_1372454_+	DUF2767 family protein	NA	NA	NA	NA	NA
WP_173633304.1|1373036_1373918_+	ABC transporter	NA	NA	NA	NA	NA
WP_173633305.1|1373917_1375456_+	histidine ammonia-lyase	NA	NA	NA	NA	NA
WP_173633306.1|1375455_1376091_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_173633307.1|1376087_1376729_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_173633308.1|1376734_1377703_+	ABC transporter ATP-binding protein	NA	A0A285PWH2	Cedratvirus	29.8	2.2e-18
WP_173633309.1|1377714_1378719_+	ornithine cyclodeaminase family protein	NA	NA	NA	NA	NA
WP_173633310.1|1378756_1379539_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173633311.1|1379546_1380422_-	N-acetylmannosamine kinase	NA	NA	NA	NA	NA
WP_173633312.1|1380418_1381114_-	N-acetylmannosamine-6-phosphate 2-epimerase	NA	NA	NA	NA	NA
WP_173633313.1|1381452_1382466_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_173633314.1|1382495_1383761_+	sugar ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_173633315.1|1383821_1384682_+	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_173633316.1|1384674_1385499_+	carbohydrate ABC transporter permease	NA	NA	NA	NA	NA
WP_173633317.1|1388031_1389024_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_173633318.1|1389031_1392580_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_173633319.1|1392726_1393407_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_173633320.1|1394084_1396049_+|protease	protease modulator HflK	protease	NA	NA	NA	NA
WP_173633321.1|1396045_1397098_+|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_173633322.1|1397094_1398138_+|protease	protease modulator HflK	protease	NA	NA	NA	NA
>prophage 3
NZ_CP054212	Erwiniaceae bacterium PD-1 chromosome, complete genome	4617009	1774192	1820424	4617009	lysis,protease,plate,holin	Erwinia_phage(64.0%)	55	NA	NA
WP_173633646.1|1774192_1775989_-|protease	Lon protease family protein	protease	NA	NA	NA	NA
WP_173633647.1|1776122_1776581_+	macrodomain Ter protein MatP	NA	NA	NA	NA	NA
WP_173633648.1|1776666_1777743_-	porin OmpA	NA	NA	NA	NA	NA
WP_173633649.1|1778095_1778602_-	cell division inhibitor SulA	NA	NA	NA	NA	NA
WP_173633650.1|1778810_1779425_+	TfoX/Sxy family DNA transformation protein	NA	NA	NA	NA	NA
WP_173633651.1|1779437_1781576_-	TIGR01666 family membrane protein	NA	NA	NA	NA	NA
WP_173633652.1|1781587_1782034_-	YccF domain-containing protein	NA	NA	NA	NA	NA
WP_173633653.1|1782171_1784226_+	DNA helicase IV	NA	A7KV33	Bacillus_phage	26.6	2.2e-15
WP_173633654.1|1784254_1784716_-	methylglyoxal synthase	NA	NA	NA	NA	NA
WP_173633655.1|1784789_1785437_-	DUF2057 family protein	NA	NA	NA	NA	NA
WP_173633656.1|1785628_1786045_+	CoA-binding protein	NA	NA	NA	NA	NA
WP_173633657.1|1786072_1786390_-	heat shock protein HspQ	NA	NA	NA	NA	NA
WP_173633658.1|1786451_1787642_-	23S rRNA (cytosine(1962)-C(5))-methyltransferase RlmI	NA	NA	NA	NA	NA
WP_173633659.1|1787728_1788007_+	acylphosphatase	NA	NA	NA	NA	NA
WP_173633660.1|1788017_1788344_-	sulfurtransferase TusE	NA	NA	NA	NA	NA
WP_173633661.1|1788450_1789107_-|protease	FtsH protease modulator YccA	protease	A0A2H4JFM9	uncultured_Caudovirales_phage	57.2	3.4e-47
WP_173633662.1|1790061_1791669_+	bifunctional glucose-1-phosphatase/inositol phosphatase	NA	NA	NA	NA	NA
WP_173633663.1|1791742_1793116_-	NAD-dependent succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_173633664.1|1793194_1793425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173633665.1|1793446_1794046_-	NAD(P)H:quinone oxidoreductase	NA	NA	NA	NA	NA
WP_173633666.1|1794119_1794320_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173633667.1|1794556_1794721_+	general stress protein	NA	NA	NA	NA	NA
WP_173633668.1|1794908_1795550_+	HTH-type transcriptional regulator RutR	NA	NA	NA	NA	NA
WP_173633669.1|1795598_1796993_-	D-serine/D-alanine/glycine transporter	NA	NA	NA	NA	NA
WP_173633670.1|1797211_1797874_-	DUF4396 domain-containing protein	NA	NA	NA	NA	NA
WP_173636159.1|1798827_1799442_+	autoinducer synthase	NA	NA	NA	NA	NA
WP_173633671.1|1799442_1799778_-	GlpM family protein	NA	NA	NA	NA	NA
WP_173633672.1|1799845_1800070_-	DUF2594 family protein	NA	NA	NA	NA	NA
WP_173633673.1|1800575_1801235_+	UvrY/SirA/GacA family response regulator transcription factor	NA	NA	NA	NA	NA
WP_173633674.1|1801227_1803060_+	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_173633675.1|1803131_1803680_+	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
WP_173633676.1|1804523_1804916_-	helix-turn-helix domain-containing protein	NA	K7PM82	Enterobacteria_phage	58.0	2.7e-15
WP_173633677.1|1805423_1805939_+	hypothetical protein	NA	H9C166	Pectobacterium_phage	39.3	1.7e-22
WP_173633678.1|1806077_1806269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173633679.1|1806329_1806800_+	antiterminator	NA	Q5TJL7	Enterobacteria_phage	45.1	1.7e-29
WP_173633680.1|1807069_1807450_+|holin	phage holin family protein	holin	F1C592	Cronobacter_phage	69.8	1.1e-42
WP_173633681.1|1807436_1807709_+|holin	phage holin family protein	holin	G8C7V9	Escherichia_phage	32.6	1.8e-07
WP_173633682.1|1807716_1808328_+	glycoside hydrolase family 19 protein	NA	A0A192Y6G4	Salmonella_phage	60.9	7.5e-65
WP_173633683.1|1808324_1808798_+|lysis	lysis protein	lysis	A0A2H4JHL8	uncultured_Caudovirales_phage	47.8	5.8e-25
WP_173633684.1|1808907_1809291_+	DUF4054 domain-containing protein	NA	E5AGB0	Erwinia_phage	45.4	1.4e-24
WP_173633685.1|1809338_1809695_+	hypothetical protein	NA	E5AGB2	Erwinia_phage	50.0	1.2e-25
WP_173633686.1|1809687_1810194_+	hypothetical protein	NA	E5AGB3	Erwinia_phage	50.3	1.7e-38
WP_173633687.1|1810208_1811573_+	DUF3383 family protein	NA	E5AGB4	Erwinia_phage	52.6	2.4e-124
WP_173633688.1|1811584_1812034_+	DUF3277 family protein	NA	E5AGB5	Erwinia_phage	58.5	9.4e-41
WP_173633689.1|1812044_1812476_+	hypothetical protein	NA	E5AGB6	Erwinia_phage	59.2	8.2e-42
WP_173633690.1|1812636_1814214_+	tape measure protein	NA	E5AGB7	Erwinia_phage	48.6	1.3e-137
WP_173633691.1|1814216_1814876_+	hypothetical protein	NA	E5AGB8	Erwinia_phage	52.8	2.6e-47
WP_173633692.1|1814917_1815259_+	hypothetical protein	NA	E5AGB9	Erwinia_phage	42.7	1.8e-23
WP_173633693.1|1815233_1816184_+	hypothetical protein	NA	E5AGC0	Erwinia_phage	70.6	4.5e-117
WP_173633694.1|1816167_1816842_+|plate	baseplate assembly protein	plate	E5AGC1	Erwinia_phage	70.1	2.5e-90
WP_173633695.1|1816941_1817283_+	DUF2634 domain-containing protein	NA	E5AGC2	Erwinia_phage	57.5	1.5e-35
WP_173636160.1|1817417_1818758_+|plate	baseplate J/gp47 family protein	plate	E5AGC3	Erwinia_phage	56.4	1.7e-138
WP_173633696.1|1818765_1819509_+	hypothetical protein	NA	E5AGC4	Erwinia_phage	43.8	1.5e-30
WP_173633697.1|1819498_1819714_+	phosphoglycolate phosphatase	NA	E5AGC5	Erwinia_phage	54.9	3.8e-16
WP_173633698.1|1819713_1820424_+	hypothetical protein	NA	E5AGC6	Erwinia_phage	35.5	2.2e-23
>prophage 4
NZ_CP054212	Erwiniaceae bacterium PD-1 chromosome, complete genome	4617009	2152532	2162761	4617009	tRNA	Tupanvirus(16.67%)	12	NA	NA
WP_173633982.1|2152532_2154461_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.6	4.2e-130
WP_173636185.1|2154464_2155016_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	31.9	3.7e-15
WP_006118955.1|2155111_2155309_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_038626360.1|2155401_2155758_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_170870447.1|2155879_2155924_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_173633983.1|2156097_2157081_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2H4UW22	Bodo_saltans_virus	42.6	8.4e-34
WP_173633984.1|2157096_2159484_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	A0A1L3IZU3	BeAn_58058_virus	29.9	2.7e-09
WP_173633985.1|2159488_2159788_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
WP_173633986.1|2159902_2160886_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
WP_173636186.1|2160919_2161471_+	glutathione peroxidase	NA	NA	NA	NA	NA
WP_173633987.1|2161471_2162221_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	NA	NA	NA	NA
WP_173633988.1|2162302_2162761_+	C40 family peptidase	NA	A0A217EQL1	Bacillus_phage	37.5	4.2e-12
>prophage 5
NZ_CP054212	Erwiniaceae bacterium PD-1 chromosome, complete genome	4617009	2538707	2639006	4617009	protease,terminase,tRNA,integrase,portal,bacteriocin,tail	Escherichia_phage(13.56%)	113	2574611:2574639	2635991:2636019
WP_173634309.1|2538707_2539409_-|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex dimerization subunit type 1 TsaB	tRNA	NA	NA	NA	NA
WP_173634310.1|2539468_2541379_-	ATP-dependent DNA helicase	NA	A0A127AW80	Bacillus_phage	33.4	7.7e-92
WP_173634311.1|2541513_2541858_+	RidA family protein	NA	NA	NA	NA	NA
WP_173634312.1|2541870_2542056_-	YoaH family protein	NA	NA	NA	NA	NA
WP_173636207.1|2542193_2543570_+	aminodeoxychorismate synthase component 1	NA	S4VT78	Pandoravirus	33.5	1.9e-39
WP_173634313.1|2543556_2544138_+	CoA pyrophosphatase	NA	NA	NA	NA	NA
WP_173634314.1|2544432_2545797_+	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_173634315.1|2546011_2547574_+	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_173634316.1|2547616_2549188_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	43.8	2.0e-37
WP_173634317.1|2549718_2550684_+	PTS mannose transporter subunit IIAB	NA	NA	NA	NA	NA
WP_173634318.1|2550761_2551565_+	PTS mannose/fructose/sorbose transporter subunit IIC	NA	NA	NA	NA	NA
WP_173634319.1|2551579_2552428_+	PTS mannose transporter subunit IID	NA	NA	NA	NA	NA
WP_173634320.1|2552537_2552996_+	DUF986 domain-containing protein	NA	NA	NA	NA	NA
WP_173634321.1|2553302_2553863_+	manganese efflux pump MntP	NA	NA	NA	NA	NA
WP_173634322.1|2553877_2554693_-	23S rRNA (guanine(745)-N(1))-methyltransferase	NA	NA	NA	NA	NA
WP_173634323.1|2554859_2555069_-	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	79.7	5.3e-23
WP_173634324.1|2555777_2556782_-	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_173634325.1|2556811_2557084_-	YebO family protein	NA	NA	NA	NA	NA
WP_173634326.1|2557316_2557556_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634327.1|2557605_2558397_-	DNA-binding transcriptional regulator KdgR	NA	NA	NA	NA	NA
WP_173636208.1|2558593_2559973_+	MFS transporter	NA	NA	NA	NA	NA
WP_173634328.1|2560035_2560917_-|protease	protease HtpX	protease	NA	NA	NA	NA
WP_173634329.1|2561149_2563195_-	carboxy terminal-processing peptidase	NA	A0A0R6PIZ1	Moraxella_phage	33.4	2.9e-89
WP_173634330.1|2563214_2563907_-	RNA chaperone ProQ	NA	NA	NA	NA	NA
WP_173634331.1|2564004_2564505_-	GAF domain-containing protein	NA	NA	NA	NA	NA
WP_173634332.1|2564743_2565988_+	membrane integrity lipid transport subunit YebS	NA	NA	NA	NA	NA
WP_173634333.1|2565956_2568581_+	MCE family protein	NA	NA	NA	NA	NA
WP_173634334.1|2568681_2570124_+	16S rRNA (cytosine(1407)-C(5))-methyltransferase RsmF	NA	NA	NA	NA	NA
WP_173636209.1|2570139_2570787_-	metallophosphoesterase	NA	Q8HA16	Enterobacteria_phage	46.3	9.1e-53
WP_173634335.1|2571056_2572070_-	acyltransferase	NA	NA	NA	NA	NA
WP_173634336.1|2573267_2573759_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_173634337.1|2573755_2574166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634338.1|2574143_2574545_+	hypothetical protein	NA	NA	NA	NA	NA
2574611:2574639	attL	ATTAAAAAAAGACCGAATACGATTCCTAT	NA	NA	NA	NA
WP_173634339.1|2575025_2583020_-	hypothetical protein	NA	Q08J70	Stx2-converting_phage	29.6	1.1e-269
WP_173634340.1|2583128_2584133_-	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	46.1	4.5e-75
WP_173634341.1|2584295_2585513_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173634342.1|2585611_2585875_-|bacteriocin	bacteriocin	bacteriocin	NA	NA	NA	NA
WP_173634343.1|2585871_2586264_-	hypothetical protein	NA	A0A1I9KFD7	Aeromonas_phage	52.4	2.1e-28
WP_173634344.1|2586272_2586938_-	hypothetical protein	NA	A0A1I9KFE8	Aeromonas_phage	54.6	7.6e-47
WP_173634345.1|2586948_2587314_-	hypothetical protein	NA	A0A088CC37	Shigella_phage	54.0	7.9e-22
WP_173634346.1|2587310_2587997_-	hypothetical protein	NA	A0A2D2W721	Pectobacterium_phage	28.1	2.5e-08
WP_173634347.1|2587996_2588269_-	hypothetical protein	NA	A0A0E3JPW0	Enterobacteria_phage	35.2	6.6e-05
WP_173634348.1|2588268_2589480_-	DUF1983 domain-containing protein	NA	A0A2L1IV54	Escherichia_phage	45.8	7.8e-90
WP_173634349.1|2589476_2591105_-	hypothetical protein	NA	A0A088CBK0	Shigella_phage	57.1	5.6e-176
WP_173634350.1|2591213_2592476_-	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	71.8	9.7e-176
WP_173634351.1|2592477_2592897_-	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A1W6JNS2	Morganella_phage	62.9	2.2e-39
WP_173634352.1|2593121_2593652_+	DUF2778 domain-containing protein	NA	NA	NA	NA	NA
WP_173634353.1|2593833_2594469_-	recombinase family protein	NA	A0A1S6L009	Salmonella_phage	73.3	1.2e-68
WP_173636210.1|2594967_2595423_+	hypothetical protein	NA	A0A220NRP2	Escherichia_phage	66.9	3.1e-55
WP_173634354.1|2595419_2597627_-|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1I9SF20	Klebsiella_phage	51.4	5.5e-33
WP_173634355.1|2597623_2598286_-	hypothetical protein	NA	Q08J85	Stx2-converting_phage	55.7	2.4e-69
WP_173634356.1|2598292_2598862_-	hypothetical protein	NA	A0A2I7RNR3	Vibrio_phage	30.6	4.3e-14
WP_173634357.1|2598863_2599310_-	hypothetical protein	NA	A0A0P0ZG73	Escherichia_phage	47.9	2.5e-25
WP_173634358.1|2599360_2599744_-	hypothetical protein	NA	A0A0P0ZFT7	Escherichia_phage	53.6	1.2e-25
WP_173634359.1|2599807_2601043_-	DUF4043 family protein	NA	A0A2L1IV46	Escherichia_phage	71.5	1.4e-166
WP_173634360.1|2601057_2602089_-	hypothetical protein	NA	V5UQM6	Shigella_phage	37.2	1.1e-47
WP_173636211.1|2602360_2604484_-|portal	portal protein	portal	A0A2L1IV74	Escherichia_phage	67.1	3.7e-244
WP_173636212.1|2604492_2606154_-|terminase	terminase	terminase	A0A2R2Z350	Escherichia_phage	76.5	3.1e-254
WP_173634361.1|2606201_2607035_-|terminase	terminase	terminase	A0A1I9KFG9	Aeromonas_phage	46.9	1.1e-42
WP_173634362.1|2607104_2607449_-	hypothetical protein	NA	W8EHJ5	Vibrio_phage	65.3	1.4e-28
WP_173634363.1|2607504_2607801_-	DUF2829 domain-containing protein	NA	L7TL09	Rhizobium_phage	54.1	4.2e-21
WP_173634364.1|2607967_2608327_-	hypothetical protein	NA	R9TPM9	Aeromonas_phage	37.5	7.3e-12
WP_173634365.1|2608404_2608947_-	lysozyme	NA	Q7Y3V3	Yersinia_phage	70.5	4.7e-71
WP_173634366.1|2608948_2609257_-	hypothetical protein	NA	O64361	Escherichia_phage	49.5	3.3e-21
WP_173634367.1|2609411_2610230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173634368.1|2610285_2611464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173634369.1|2611466_2611916_-	VRR-NUC domain-containing protein	NA	A0A0D4DBJ8	Acinetobacter_phage	40.0	1.5e-17
WP_173634370.1|2611908_2612241_-	DUF1364 domain-containing protein	NA	A0A223LHA7	Pseudoalteromonas_phage	42.4	1.5e-14
WP_173634371.1|2612237_2612882_-	DUF1367 family protein	NA	K7PKS6	Enterobacteria_phage	35.6	2.5e-18
WP_173634372.1|2612881_2613754_-	hypothetical protein	NA	A9YWY3	Burkholderia_phage	48.2	3.2e-69
WP_173634373.1|2613750_2614218_-	hypothetical protein	NA	A0A1W6JP80	Morganella_phage	35.0	7.6e-09
WP_173636213.1|2614214_2614904_-	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	63.5	1.2e-82
WP_173634374.1|2614858_2615206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173634375.1|2615205_2616330_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	62.2	1.2e-97
WP_173634376.1|2616332_2616890_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173634377.1|2616813_2617929_-	hypothetical protein	NA	Q0H278	Geobacillus_phage	35.0	2.5e-10
WP_173634378.1|2617928_2618111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173634379.1|2618113_2618464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173634380.1|2618483_2618726_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173634381.1|2618811_2619483_+	helix-turn-helix domain-containing protein	NA	U5P0T5	Shigella_phage	45.4	1.7e-22
WP_173634382.1|2619488_2620085_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_173634383.1|2620538_2620895_+	antitermination protein	NA	C6ZR44	Salmonella_phage	35.2	2.6e-09
WP_173634384.1|2621749_2621986_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634385.1|2621985_2622261_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634386.1|2622257_2622509_+	KTSC domain-containing protein	NA	A9YWW2	Burkholderia_phage	61.2	6.7e-20
WP_173634387.1|2622522_2622831_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634388.1|2622956_2623106_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634389.1|2623116_2623941_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	58.5	2.6e-68
WP_173634390.1|2623927_2625637_+	YqaJ viral recombinase family protein	NA	A0A2H4J6P1	uncultured_Caudovirales_phage	49.8	5.6e-102
WP_173634391.1|2625669_2626800_+	hypothetical protein	NA	M4MHC3	Vibrio_phage	33.2	1.3e-30
WP_173634392.1|2626799_2627222_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634393.1|2627276_2627864_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634394.1|2627864_2628158_+	hypothetical protein	NA	S4TU79	Salmonella_phage	53.8	3.5e-20
WP_173634395.1|2628150_2628351_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634396.1|2628343_2628556_+	hypothetical protein	NA	A0A2P1JU43	Erwinia_phage	43.4	8.4e-08
WP_173634397.1|2628548_2628755_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634398.1|2628747_2629197_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_173634399.1|2629189_2629771_+	hypothetical protein	NA	R4W375	Alteromonas_phage	29.0	3.9e-15
WP_173634400.1|2629767_2630019_+	hypothetical protein	NA	R9W0X4	Serratia_phage	48.7	9.9e-16
WP_173634401.1|2630089_2631382_+	phosphoadenosine phosphosulfate reductase family protein	NA	Q8W6P3	Burkholderia_virus	35.2	1.1e-46
WP_173634402.1|2631391_2632147_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634403.1|2632143_2632335_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634404.1|2632362_2632608_+	DNA polymerase III subunit theta	NA	A0A2H4J4A9	uncultured_Caudovirales_phage	66.7	1.3e-23
WP_173634405.1|2632604_2632907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634406.1|2632972_2633332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634407.1|2633401_2634214_+	hypothetical protein	NA	A4JX52	Burkholderia_virus	49.2	2.2e-64
WP_173636214.1|2634584_2634857_+	excisionase	NA	A0A2H4J5E1	uncultured_Caudovirales_phage	35.3	9.2e-07
WP_173634408.1|2634834_2635914_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4IYC8	uncultured_Caudovirales_phage	53.1	2.7e-102
WP_173634409.1|2636272_2636611_-	YebY family protein	NA	NA	NA	NA	NA
2635991:2636019	attR	ATTAAAAAAAGACCGAATACGATTCCTAT	NA	NA	NA	NA
WP_173634410.1|2636668_2637547_-	copper homeostasis membrane protein CopD	NA	NA	NA	NA	NA
WP_173634411.1|2637548_2637926_-	CopC domain-containing protein YobA	NA	NA	NA	NA	NA
WP_173634412.1|2638087_2638318_+	DNA polymerase III subunit theta	NA	H9C187	Pectobacterium_phage	61.8	4.8e-17
WP_173634413.1|2638337_2639006_+	exodeoxyribonuclease X	NA	A0A2I7S9L0	Vibrio_phage	28.0	8.0e-12
>prophage 6
NZ_CP054212	Erwiniaceae bacterium PD-1 chromosome, complete genome	4617009	3255894	3286485	4617009	protease,terminase,holin,integrase,lysis	Escherichia_phage(17.95%)	56	3257238:3257252	3290710:3290724
WP_173634919.1|3255894_3257502_-	hypothetical protein	NA	A0A1B1ITN4	uncultured_Mediterranean_phage	30.0	6.8e-57
3257238:3257252	attL	TATCTTCATAACCTG	NA	NA	NA	NA
WP_173634920.1|3257502_3257784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173634921.1|3257783_3259376_-|terminase	terminase	terminase	Q775B9	Bordetella_phage	39.4	1.9e-96
WP_173634922.1|3259432_3259648_-	DUF551 domain-containing protein	NA	A0A193GZ43	Enterobacter_phage	81.2	4.1e-26
WP_173634923.1|3259748_3260015_-	hypothetical protein	NA	A0A076G6T1	Escherichia_phage	47.5	8.4e-05
WP_173634924.1|3260007_3260511_-	DNA-packaging protein	NA	C6ZR06	Salmonella_phage	83.6	2.2e-62
WP_173634925.1|3260514_3260712_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173634926.1|3260708_3261086_-	hypothetical protein	NA	C6ZR72	Salmonella_phage	62.3	9.3e-42
WP_173634927.1|3261165_3261702_-	Rha family transcriptional regulator	NA	A0A1R3Y613	Salmonella_virus	83.0	2.5e-80
WP_173634928.1|3261869_3262334_-|lysis	lysis protein	lysis	G0ZNC9	Cronobacter_phage	44.7	4.8e-24
WP_173636249.1|3262323_3262821_-	lysozyme	NA	A0A2H4JCH1	uncultured_Caudovirales_phage	76.4	1.9e-71
WP_173636250.1|3262832_3263066_-|holin	class II holin family protein	holin	A0A2H4JCI1	uncultured_Caudovirales_phage	80.0	1.1e-21
WP_173634929.1|3263265_3263718_+	hypothetical protein	NA	E5AGG6	Erwinia_phage	68.9	1.7e-53
WP_173634930.1|3264268_3265102_-	antitermination protein	NA	K7PKS8	Enterobacteria_phage	63.0	2.0e-97
WP_173636251.1|3265214_3265799_-	recombination protein NinG	NA	A0A0P0ZG59	Escherichia_phage	42.4	1.7e-37
WP_173634931.1|3265894_3266194_-	hypothetical protein	NA	S5MLS6	Pseudoalteromonas_phage	60.5	8.2e-25
WP_173634932.1|3266190_3266364_-	NinE family protein	NA	Q5G8S3	Enterobacteria_phage	46.4	2.0e-07
WP_173634933.1|3266347_3266632_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_173634934.1|3266650_3267178_-	HNH endonuclease	NA	A0A2I7QUL1	Vibrio_phage	38.6	3.3e-29
WP_173634935.1|3267170_3267602_-	recombination protein NinB	NA	I6PD71	Cronobacter_phage	48.0	1.8e-28
WP_173634936.1|3268073_3269522_-	AAA family ATPase	NA	A0A0N7C224	Escherichia_phage	73.3	5.1e-205
WP_173634937.1|3269511_3270414_-	DNA replication protein	NA	Q37929	Escherichia_phage	52.7	9.0e-75
WP_173634938.1|3270581_3270860_-	hypothetical protein	NA	A0A220NRS4	Escherichia_phage	63.0	6.9e-26
WP_173634939.1|3270964_3271180_-	helix-turn-helix transcriptional regulator	NA	Q716D6	Shigella_phage	62.0	2.4e-18
WP_173634940.1|3271280_3271964_+	helix-turn-helix transcriptional regulator	NA	A0A2H4FNG6	Salmonella_phage	56.7	1.7e-73
WP_173634941.1|3272027_3272411_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634942.1|3272414_3272744_+	hemolysin XhlA	NA	NA	NA	NA	NA
WP_173634943.1|3272861_3273065_-	DUF2767 family protein	NA	NA	NA	NA	NA
WP_173634944.1|3273075_3273252_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173634945.1|3273743_3273992_+	hypothetical protein	NA	K7PKE4	Enterobacteria_phage	39.1	4.9e-07
WP_173634946.1|3274315_3274627_+	superinfection exclusion protein	NA	Q76H37	Enterobacteria_phage	71.7	7.4e-37
WP_173634947.1|3274932_3275139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634948.1|3275249_3276185_+	hypothetical protein	NA	A0A2H4JIB1	uncultured_Caudovirales_phage	75.1	1.7e-52
WP_173634949.1|3276208_3276340_+|protease	protease FtsH-inhibitory lysogeny factor CIII	protease	NA	NA	NA	NA
WP_173634950.1|3276449_3276767_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634951.1|3276767_3277616_+	phage recombination protein Bet	NA	A0A1I9KF88	Aeromonas_phage	54.7	4.1e-69
WP_173634952.1|3277612_3277825_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_173634953.1|3277821_3278502_+	YqaJ viral recombinase family protein	NA	A0A0N6WET1	Escherichia_phage	82.7	3.4e-111
WP_173634954.1|3278505_3278910_+	regulator	NA	A0A248SL59	Klebsiella_phage	43.4	7.0e-19
WP_173634955.1|3279575_3279893_+	hypothetical protein	NA	A0A222YY67	Escherichia_phage	51.5	2.8e-23
WP_173634956.1|3279885_3280170_+	hypothetical protein	NA	S4TU79	Salmonella_phage	51.7	1.1e-21
WP_173634957.1|3280162_3280531_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634958.1|3280527_3281007_+	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	70.3	4.9e-64
WP_173636252.1|3281077_3281344_+	hypothetical protein	NA	A0A2H4EW60	Aeromonas_phage	36.4	1.1e-07
WP_173634959.1|3281353_3281794_+	hypothetical protein	NA	A0A1R3Y5T1	Salmonella_virus	39.8	4.8e-05
WP_173634960.1|3281777_3282278_+	HNH endonuclease	NA	Q7Y5F9	Xanthomonas_virus	39.7	8.6e-27
WP_173634961.1|3282289_3282586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634962.1|3282582_3282786_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634963.1|3282873_3283626_+	methyltransferase	NA	A0A1P8VVC9	Erythrobacter_phage	43.1	5.6e-38
WP_173634964.1|3283664_3283910_+	DNA polymerase III subunit theta	NA	A0A2H4J4A9	uncultured_Caudovirales_phage	65.4	1.1e-22
WP_173634405.1|3283906_3284209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634965.1|3284274_3284634_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634966.1|3284698_3284971_+	DUF5405 family protein	NA	A0A0M4R2Q0	Salmonella_phage	48.2	3.0e-18
WP_173634967.1|3285154_3285367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173634968.1|3285474_3285675_+	excisionase	NA	K7P7V0	Enterobacteria_phage	87.9	2.8e-29
WP_173636253.1|3285996_3286485_+|integrase	site-specific integrase	integrase	C6ZR22	Salmonella_phage	73.8	6.4e-67
3290710:3290724	attR	CAGGTTATGAAGATA	NA	NA	NA	NA
>prophage 7
NZ_CP054212	Erwiniaceae bacterium PD-1 chromosome, complete genome	4617009	3405492	3414795	4617009		Bacillus_phage(33.33%)	9	NA	NA
WP_173635069.1|3405492_3407100_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	39.2	1.3e-20
WP_173635070.1|3407438_3408899_+	M48 family metallopeptidase	NA	NA	NA	NA	NA
WP_173635071.1|3408923_3409274_+	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	44.4	6.2e-16
WP_173635072.1|3409286_3409994_-	DnaA inactivator Hda	NA	NA	NA	NA	NA
WP_173635073.1|3410081_3411365_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	36.9	1.6e-64
WP_173635074.1|3411432_3412059_-	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_173635075.1|3412299_3413340_+	phosphoribosylformylglycinamidine cyclo-ligase	NA	A0A1D7SE90	Cyanophage	42.9	1.6e-70
WP_173635076.1|3413336_3413975_+	phosphoribosylglycinamide formyltransferase	NA	E3SNR5	Prochlorococcus_phage	42.2	3.7e-30
WP_173635077.1|3414027_3414795_-	phosphate ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	31.0	1.3e-13
