The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	0	24267	2843306	head,protease,holin,tail,capsid,terminase,portal	Staphylococcus_phage(96.15%)	27	NA	NA
WP_000625096.1|0_1662_+|terminase	terminase large subunit	terminase	A0A075M4D3	Staphylococcus_phage	100.0	0.0e+00
WP_000025268.1|1677_2841_+|portal	phage portal protein	portal	A0A1W6JPQ9	Staphylococcus_phage	100.0	1.8e-216
WP_000861911.1|2824_3562_+|protease	Clp protease ClpP	protease	A0A1W6JPK0	Staphylococcus_phage	100.0	1.8e-129
WP_000154568.1|3584_4730_+|capsid	phage major capsid protein	capsid	A0A1W6JPL4	Staphylococcus_phage	99.7	7.3e-215
WP_000238241.1|4749_5034_+	hypothetical protein	NA	A0A2I6PDJ3	Staphylococcus_phage	97.9	5.2e-45
WP_000150936.1|5023_5308_+|head,tail	phage head-tail adapter protein	head,tail	A0A2I6PDJ5	Staphylococcus_phage	100.0	2.3e-45
WP_000755150.1|5291_5654_+|head,tail	head-tail adaptor protein	head,tail	G4KNQ4	Staphylococcus_phage	100.0	4.4e-65
WP_000114341.1|5650_6055_+	HK97 gp10 family phage protein	NA	A0A1W6JPJ1	Staphylococcus_phage	100.0	2.5e-69
WP_000565498.1|6051_6459_+	hypothetical protein	NA	G4KNQ6	Staphylococcus_phage	100.0	7.1e-72
WP_000985142.1|6459_7104_+|tail	phage tail protein	tail	G4KNQ7	Staphylococcus_phage	99.1	1.9e-119
WP_071621395.1|7145_7370_+	Ig-like domain-containing protein	NA	A0A075LYE8	Staphylococcus_phage	100.0	3.0e-32
WP_001096355.1|7419_7770_+	hypothetical protein	NA	G4KNQ8	Staphylococcus_phage	100.0	7.8e-59
WP_001557459.1|8014_12547_+|tail	phage tail tape measure protein	tail	A0EX03	Staphylococcus_phage	98.9	0.0e+00
WP_000567396.1|12543_14028_+|tail	phage tail family protein	tail	A0A2I6PDJ0	Staphylococcus_phage	99.8	4.5e-297
WP_000582154.1|14043_17829_+	hypothetical protein	NA	Q6R866	Staphylococcus_virus	98.3	0.0e+00
WP_001153681.1|17818_17971_+	hypothetical protein	NA	D2JLG0	Staphylococcus_phage	100.0	5.2e-20
WP_001040261.1|18017_18305_+	hypothetical protein	NA	D2JLG1	Staphylococcus_phage	100.0	1.3e-43
WP_000539688.1|18362_18659_+	DUF2951 domain-containing protein	NA	D2JLG2	Staphylococcus_phage	100.0	2.9e-46
WP_011447039.1|18808_18985_+|holin	putative holin-like toxin	holin	D2JLG3	Staphylococcus_phage	98.3	2.2e-22
WP_001791821.1|19037_19145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000611512.1|19196_19451_+|holin	phage holin	holin	D2JLG4	Staphylococcus_phage	100.0	4.1e-41
WP_000861038.1|19462_20218_+	CHAP domain-containing protein	NA	D2JLG5	Staphylococcus_phage	100.0	3.4e-152
WP_000919350.1|20408_20900_+	staphylokinase	NA	A0A1X9H028	Staphylococcus_phage	100.0	9.5e-87
WP_000727649.1|21979_22429_-	chemotaxis-inhibiting protein CHIPS	NA	A0A1P8L6A8	Staphylococcus_phage	100.0	1.1e-78
WP_000702263.1|23113_23464_+	complement inhibitor SCIN-A	NA	A0A1P8L6B0	Staphylococcus_phage	100.0	7.5e-54
WP_001791826.1|23516_23777_-	hypothetical protein	NA	M9NS66	Staphylococcus_phage	100.0	2.3e-23
WP_000669789.1|24087_24267_-	hypothetical protein	NA	A0A1W6JQ29	Staphylococcus_phage	100.0	2.2e-25
>prophage 2
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	29878	32325	2843306		Staphylococcus_phage(100.0%)	3	NA	NA
WP_000991306.1|29878_30775_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtA	NA	A0A2H4PQG7	Staphylococcus_phage	30.2	5.0e-17
WP_000645727.1|30775_31456_+	phenol-soluble modulin export ABC transporter permease subunit PmtB	NA	NA	NA	NA	NA
WP_000763043.1|31452_32325_+	phenol-soluble modulin export ABC transporter ATP-binding protein PmtC	NA	A0A2H4PQG7	Staphylococcus_phage	36.0	1.0e-27
>prophage 3
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	38089	38491	2843306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000205106.1|38089_38491_-	YolD-like family protein	NA	U3PG23	Staphylococcus_phage	42.9	6.0e-23
>prophage 4
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	42687	44714	2843306		Bacillus_virus(50.0%)	2	NA	NA
WP_000149686.1|42687_43248_-	cysteine hydrolase	NA	G3MA16	Bacillus_virus	41.2	2.0e-32
WP_173896704.1|43616_44714_+	pectate lyase	NA	U5PWM6	Bacillus_phage	34.6	1.9e-47
>prophage 5
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	48744	51028	2843306		Bacillus_virus(100.0%)	2	NA	NA
WP_000284436.1|48744_50214_+	nicotinate phosphoribosyltransferase	NA	G3MA18	Bacillus_virus	45.1	5.9e-108
WP_000040866.1|50206_51028_+	ammonia-dependent NAD(+) synthetase	NA	G3MA24	Bacillus_virus	52.7	2.3e-69
>prophage 6
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	54729	61496	2843306		Gordonia_phage(33.33%)	5	NA	NA
WP_000572878.1|54729_56025_+	adenylosuccinate lyase	NA	A0A1B3B081	Gordonia_phage	32.9	1.6e-16
WP_001165363.1|56133_56436_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000272056.1|56607_57300_+	heptaprenylglyceryl phosphate synthase	NA	NA	NA	NA	NA
WP_000992924.1|57296_59489_+	DNA helicase PcrA	NA	A7KV33	Bacillus_phage	42.2	1.0e-135
WP_000774556.1|59492_61496_+	NAD-dependent DNA ligase LigA	NA	A0A0K2QQN8	Ralstonia_phage	36.2	1.2e-114
>prophage 7
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	68670	73699	2843306		Catovirus(33.33%)	5	NA	NA
WP_173896708.1|68670_69618_+	diacylglycerol kinase	NA	A0A1V0SBJ0	Catovirus	27.8	1.5e-16
WP_001147865.1|69698_71060_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	A0A1X9I6F4	Streptococcus_phage	43.6	1.4e-103
WP_000548781.1|71229_71760_+	DUF3267 domain-containing protein	NA	NA	NA	NA	NA
WP_000140172.1|72006_73077_+	DNA polymerase IV	NA	NA	NA	NA	NA
WP_000613738.1|73144_73699_-	3'-5' exonuclease	NA	B5WZL1	Staphylococcus_phage	35.7	1.2e-29
>prophage 8
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	77151	77565	2843306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001557448.1|77151_77565_+	hypothetical protein	NA	A0A1Q1PVU5	Staphylococcus_phage	38.3	6.7e-17
>prophage 9
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	82619	83249	2843306		Bacillus_phage(100.0%)	1	NA	NA
WP_000153535.1|82619_83249_+	two-component system response regulator VraR	NA	W8CYM9	Bacillus_phage	30.8	8.1e-06
>prophage 10
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	89278	166014	2843306	tRNA,head,plate,transposase,holin,tail,integrase,capsid,terminase,portal	Staphylococcus_phage(75.71%)	92	85798:85815	121238:121255
85798:85815	attL	GTTAATCAAGGATTATTA	NA	NA	NA	NA
WP_001145723.1|89278_90325_-|integrase	site-specific integrase	integrase	Q4ZB10	Staphylococcus_virus	99.1	2.3e-199
WP_000392109.1|90535_91216_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A2H4PQQ5	Staphylococcus_phage	100.0	5.1e-123
WP_000705238.1|91355_91523_-	hypothetical protein	NA	Q4ZDJ4	Staphylococcus_virus	100.0	1.7e-24
WP_173896710.1|91592_92363_-	helix-turn-helix domain-containing protein	NA	A0A1X9H0P5	Staphylococcus_phage	97.7	6.4e-138
WP_000338187.1|92522_92744_+	DUF739 family protein	NA	A0A1X9H090	Staphylococcus_phage	100.0	7.6e-36
WP_000435360.1|92767_93211_+	hypothetical protein	NA	W5R971	Staphylococcus_phage	100.0	1.5e-75
WP_000939495.1|93225_93366_+	hypothetical protein	NA	A0A2I6PDT8	Staphylococcus_phage	100.0	1.9e-16
WP_000772137.1|93358_93568_-	hypothetical protein	NA	A0A2I6PDR8	Staphylococcus_phage	100.0	9.1e-31
WP_001148338.1|93624_94374_+	phage antirepressor KilAC domain-containing protein	NA	B7T097	Staphylococcus_virus	99.6	3.4e-136
WP_001148568.1|94389_95178_+	phage antirepressor KilAC domain-containing protein	NA	R9QSV3	Staphylococcus_phage	99.6	3.6e-144
WP_016528750.1|95193_95397_+	hypothetical protein	NA	A0A0E3XBM9	Staphylococcus_phage	98.5	5.2e-31
WP_000395455.1|95734_95965_-	hypothetical protein	NA	C8CGY3	Staphylococcus_phage	100.0	2.3e-35
WP_000594789.1|96035_96257_+	hypothetical protein	NA	B2ZYU8	Staphylococcus_phage	100.0	8.7e-32
WP_000066011.1|96249_96411_+	DUF1270 domain-containing protein	NA	Q4ZAZ7	Staphylococcus_virus	100.0	2.5e-20
WP_000291089.1|96507_96768_+	DUF1108 family protein	NA	Q4ZBM7	Staphylococcus_phage	100.0	1.2e-43
WP_000815400.1|96777_96999_+	DUF2483 family protein	NA	A0A2H4PQR5	Staphylococcus_phage	100.0	4.2e-34
WP_070856932.1|96991_97771_+	ATP-binding protein	NA	Q9G028	Staphylococcus_virus	99.2	2.8e-141
WP_000704713.1|97800_98355_+	single-stranded DNA-binding protein	NA	A7TWM8	Staphylococcus_phage	100.0	1.0e-100
WP_061389143.1|98367_99039_+	hypothetical protein	NA	Q9G025	Staphylococcus_virus	97.8	1.1e-125
WP_000132054.1|99031_99745_+	helix-turn-helix domain-containing protein	NA	A0A1J0MGB2	Staphylococcus_phage	79.3	9.2e-91
WP_064134395.1|99754_100534_+	ATP-binding protein	NA	A7YGR0	Staphylococcus_virus	98.8	2.7e-144
WP_000237154.1|100527_100689_+	hypothetical protein	NA	A0A0H4IU12	Staphylococcus_phage	100.0	1.0e-21
WP_001123688.1|100701_100923_+	DUF3269 family protein	NA	Q9G021	Staphylococcus_phage	100.0	1.3e-35
WP_173896712.1|100932_101340_+	RusA family crossover junction endodeoxyribonuclease	NA	A9CR74	Staphylococcus_phage	99.3	3.8e-73
WP_001187259.1|101339_101525_+	DUF3113 family protein	NA	A0A1X9H053	Staphylococcus_phage	95.1	3.5e-26
WP_000907341.1|101525_102143_+	hypothetical protein	NA	A0A0H3U4U9	Staphylococcus_phage	99.5	1.2e-83
WP_000022722.1|102142_102397_+	DUF3310 domain-containing protein	NA	A0A2K9VBW1	Staphylococcus_phage	100.0	1.6e-42
WP_001802342.1|102396_102645_+	hypothetical protein	NA	A0A2I6PDB4	Staphylococcus_phage	95.1	1.3e-39
WP_000693989.1|102658_102865_+	hypothetical protein	NA	A0A2K9VBT9	Staphylococcus_phage	100.0	3.0e-34
WP_000695753.1|102867_103272_+	hypothetical protein	NA	A0A0E3T8H9	Staphylococcus_phage	98.5	1.0e-70
WP_173896714.1|103268_103616_+	hypothetical protein	NA	D2JGL4	Staphylococcus_phage	99.1	1.7e-58
WP_000144703.1|103612_103921_+	hypothetical protein	NA	Q6R826	Staphylococcus_virus	96.1	8.4e-49
WP_173896715.1|103913_104162_+	DUF1024 family protein	NA	Q9B0F3	Staphylococcus_virus	96.3	7.7e-37
WP_000185653.1|104154_104685_+	dUTP pyrophosphatase	NA	C8CH05	Staphylococcus_phage	100.0	1.7e-94
WP_000195803.1|104721_104928_+	DUF1381 domain-containing protein	NA	A0A0H3U2R7	Staphylococcus_phage	100.0	1.3e-29
WP_173896717.1|104924_105308_+	hypothetical protein	NA	A0A0H3U465	Staphylococcus_phage	97.6	8.2e-62
WP_000595244.1|105307_105481_+	transcriptional activator RinB	NA	S4SVE4	Staphylococcus_phage	100.0	6.4e-22
WP_000286968.1|105481_105883_+	hypothetical protein	NA	A0A2H4PQK5	Staphylococcus_phage	100.0	5.6e-69
WP_000594087.1|106235_106730_+|terminase	terminase small subunit	terminase	A0A0N9BAX3	Staphylococcus_phage	99.4	2.2e-83
WP_001037578.1|106722_107946_+|terminase	PBSX family phage terminase large subunit	terminase	A0A0N9BAX9	Staphylococcus_phage	100.0	7.5e-242
WP_173896719.1|107942_109367_+|portal	phage portal protein	portal	Q4ZBZ7	Staphylococcus_virus	99.4	1.3e-269
WP_000184133.1|109335_110289_+|head	phage head morphogenesis protein	head	A0A0N7E0U6	Staphylococcus_phage	99.7	6.6e-177
WP_000346033.1|110290_110497_+	hypothetical protein	NA	A0A0N9BB04	Staphylococcus_phage	100.0	3.2e-28
WP_001019219.1|110599_111184_+	DUF4355 domain-containing protein	NA	A0A0N7E0U8	Staphylococcus_phage	100.0	1.3e-77
WP_000235168.1|111200_112115_+|capsid	phage major capsid protein	capsid	A0A0H3U2U7	Staphylococcus_phage	100.0	1.2e-170
WP_000002931.1|112126_112270_+	hypothetical protein	NA	A0A0E3XC49	Staphylococcus_phage	100.0	4.6e-18
WP_016528745.1|112275_112626_+|head,tail	phage gp6-like head-tail connector family protein	head,tail	A0A0H3U2R5	Staphylococcus_phage	99.1	4.1e-60
WP_000483041.1|112637_112973_+|head	phage head closure protein	head	A0A0E3TAH8	Staphylococcus_phage	100.0	8.8e-60
WP_001151330.1|112959_113373_+	HK97 gp10 family phage protein	NA	A0A0N9BAY5	Staphylococcus_phage	100.0	1.1e-75
WP_000270192.1|113385_113811_+	DUF3168 domain-containing protein	NA	Q4ZBQ9	Staphylococcus_phage	100.0	5.5e-75
WP_000057582.1|113811_114369_+|tail	tail protein	tail	Q4ZBQ8	Staphylococcus_phage	100.0	8.2e-103
WP_000134337.1|114435_114942_+	hypothetical protein	NA	Q4ZBQ7	Staphylococcus_phage	100.0	2.7e-92
WP_000880587.1|114986_115271_+	hypothetical protein	NA	A0A0N7E0V9	Staphylococcus_phage	100.0	8.8e-45
WP_016528744.1|115274_118418_+	hypothetical protein	NA	Q4ZBY3	Staphylococcus_virus	100.0	0.0e+00
WP_000560181.1|118432_119374_+|tail	phage tail family protein	tail	Q4ZBQ4	Staphylococcus_phage	100.0	5.2e-182
WP_001122001.1|119384_121271_+|tail	phage tail protein	tail	Q4ZBQ3	Staphylococcus_phage	100.0	0.0e+00
121238:121255	attR	GTTAATCAAGGATTATTA	NA	NA	NA	NA
WP_031833105.1|121283_123182_+	hypothetical protein	NA	A0A0H3U448	Staphylococcus_phage	97.3	0.0e+00
WP_016528742.1|123181_125005_+|plate	phage baseplate upper protein	plate	W5R8J5	Staphylococcus_phage	95.2	8.2e-277
WP_000705914.1|125004_125382_+	DUF2977 domain-containing protein	NA	W5R9M2	Staphylococcus_phage	99.2	3.4e-60
WP_001790193.1|125385_125559_+	XkdX family protein	NA	Q8LTH6	Staphylococcus_phage	100.0	1.7e-27
WP_000466769.1|125599_125899_+	DUF2951 domain-containing protein	NA	Q4ZBP8	Staphylococcus_phage	100.0	1.3e-46
WP_000524040.1|126035_127910_+	glucosaminidase domain-containing protein	NA	Q4ZBX1	Staphylococcus_virus	100.0	0.0e+00
WP_000276647.1|127922_129095_+|plate	BppU family phage baseplate upper protein	plate	A0EWU8	Staphylococcus_virus	100.0	4.1e-197
WP_000398862.1|129100_129496_+	hypothetical protein	NA	Q4ZBW9	Staphylococcus_virus	100.0	1.6e-68
WP_000354132.1|129551_129989_+|holin	phage holin	holin	A0A2H4PQP0	Staphylococcus_phage	100.0	4.1e-73
WP_016528741.1|129969_131415_+	SH3 domain-containing protein	NA	Q4ZAM7	Staphylococcus_virus	99.0	8.5e-293
WP_000344116.1|131811_132123_+	DUF3467 domain-containing protein	NA	A0A2H4PQQ9	Staphylococcus_phage	100.0	4.1e-51
WP_001251276.1|132109_132493_+	hypothetical protein	NA	A0A2H4PQP6	Staphylococcus_phage	99.2	6.1e-65
WP_106875183.1|132589_132670_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001005407.1|133016_133178_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000163283.1|133308_133824_+	type 1 glutamine amidotransferase	NA	NA	NA	NA	NA
WP_000830384.1|134163_134973_+	monofunctional peptidoglycan glycosyltransferase SgtB	NA	NA	NA	NA	NA
WP_001124422.1|135232_136051_+	recombination regulator RecX	NA	NA	NA	NA	NA
WP_000435806.1|136028_136343_+	YfhH family protein	NA	NA	NA	NA	NA
WP_000535834.1|136357_137875_+	ABC transporter ATP-binding protein	NA	NA	NA	NA	NA
WP_000886462.1|137883_138720_+	membrane protein	NA	NA	NA	NA	NA
WP_001557163.1|139093_140413_+|transposase	ISL3-like element IS1181 family transposase	transposase	NA	NA	NA	NA
WP_000379098.1|140500_141478_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000284765.1|141629_142667_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000251253.1|142969_143512_+	DUF402 domain-containing protein	NA	NA	NA	NA	NA
WP_000597238.1|143802_145539_+	SAV1866 family putative multidrug efflux ABC transporter	NA	W8CYL7	Bacillus_phage	30.4	1.7e-53
WP_001236371.1|145728_146823_-	aromatic acid exporter family protein	NA	NA	NA	NA	NA
WP_001011595.1|147115_148405_-	glutamate-1-semialdehyde 2,1-aminomutase	NA	NA	NA	NA	NA
WP_000939528.1|148485_148941_+	thioredoxin-dependent thiol peroxidase	NA	NA	NA	NA	NA
WP_000869447.1|148946_149897_+	2-hydroxyacid dehydrogenase	NA	NA	NA	NA	NA
WP_000110007.1|149993_150440_+	peroxide-responsive transcriptional repressor PerR	NA	NA	NA	NA	NA
WP_001557163.1|158866_160186_-|transposase	ISL3-like element IS1181 family transposase	transposase	NA	NA	NA	NA
WP_000063582.1|160769_161831_+	PTS transporter subunit IIC	NA	NA	NA	NA	NA
WP_000649915.1|162088_163546_+	ABC transporter permease subunit	NA	NA	NA	NA	NA
WP_000590809.1|163538_164261_+	amino acid ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.7	1.3e-36
WP_000379980.1|164411_165539_+|tRNA	tRNA epoxyqueuosine(34) reductase QueG	tRNA	NA	NA	NA	NA
WP_000181395.1|165543_166014_+|tRNA	tRNA (uridine(34)/cytosine(34)/5- carboxymethylaminomethyluridine(34)-2'-O)- methyltransferase TrmL	tRNA	NA	NA	NA	NA
>prophage 11
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	174858	175203	2843306		Streptococcus_phage(100.0%)	1	NA	NA
WP_000290301.1|174858_175203_+	YlbF/YmcA family competence regulator	NA	A0A1X9I5Y8	Streptococcus_phage	29.7	7.5e-06
>prophage 12
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	184833	185574	2843306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000216874.1|184833_185574_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	29.8	1.2e-24
>prophage 13
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	193358	197623	2843306		Staphylococcus_phage(100.0%)	4	NA	NA
WP_010922839.1|193358_194141_+	staphylococcal enterotoxin type O	NA	A0A1X9H080	Staphylococcus_phage	36.7	1.1e-31
WP_000821658.1|194421_195141_+	staphylococcal enterotoxin type M	NA	A0A1X9H080	Staphylococcus_phage	35.8	2.3e-25
WP_000713847.1|195175_195904_+	staphylococcal enterotoxin type I	NA	A0A1X9H080	Staphylococcus_phage	39.2	1.1e-27
WP_001236362.1|196867_197623_+	staphylococcal enterotoxin type N	NA	A0A075M4C7	Staphylococcus_phage	41.4	6.0e-40
>prophage 14
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	201672	267418	2843306	protease,tRNA	Staphylococcus_phage(95.65%)	59	NA	NA
WP_000206343.1|201672_202461_-	DUF1828 domain-containing protein	NA	A0A2H4PQI0	Staphylococcus_phage	98.5	3.6e-144
WP_000878802.1|203838_204759_+	bi-component leukocidin LukED subunit E	NA	A0A2H4PQI5	Staphylococcus_phage	100.0	2.3e-174
WP_000782463.1|204760_205744_+	bi-component leukocidin LukED subunit D	NA	A0A2H4PQH7	Staphylococcus_phage	99.4	1.8e-185
WP_000543854.1|206113_206905_-	DUF1828 domain-containing protein	NA	NA	NA	NA	NA
WP_000550252.1|206909_207383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001092780.1|208329_208911_-	DUF4888 domain-containing protein	NA	A0A2H4PQH6	Staphylococcus_phage	64.8	9.6e-54
WP_001039427.1|209874_210582_+|protease	serine protease SplA	protease	A0A2H4PQN3	Staphylococcus_phage	97.0	7.9e-127
WP_001039454.1|210706_211429_+|protease	serine protease SplB	protease	A0A2H4PQN0	Staphylococcus_phage	98.3	3.5e-130
WP_001038872.1|211486_212206_+|protease	serine protease SplC	protease	A0A2H4PQP7	Staphylococcus_phage	98.7	1.3e-129
WP_001038704.1|212326_213046_+|protease	serine protease SplD	protease	A0A2H4PQP9	Staphylococcus_phage	99.6	4.6e-130
WP_011447030.1|212994_213102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001791797.1|213985_214120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000028669.1|214283_215840_+	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	100.0	1.6e-289
WP_000072627.1|215832_217062_+	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	64.7	4.0e-134
WP_001792025.1|218137_218239_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001801861.1|218361_218457_-	type I toxin-antitoxin system Fst family toxin PepA1	NA	NA	NA	NA	NA
WP_000414216.1|219811_220384_-	hypothetical protein	NA	A0A2H4PQN4	Staphylococcus_phage	93.1	2.3e-23
WP_000627540.1|220484_220826_-	DUF3969 family protein	NA	A0A2H4PQN6	Staphylococcus_phage	94.7	1.1e-54
WP_000669024.1|220866_221493_-	hypothetical protein	NA	A0A2H4PQM7	Staphylococcus_phage	79.8	3.1e-74
WP_000070642.1|221567_222563_-	DUF4352 domain-containing protein	NA	A0A2H4PQN2	Staphylococcus_phage	97.9	2.6e-67
WP_001795210.1|222643_223294_-	excalibur calcium-binding domain-containing protein	NA	A0A2H4PQM8	Staphylococcus_phage	94.0	2.9e-51
WP_012840523.1|223597_224053_+	DUF4909 domain-containing protein	NA	A0A2H4PQN7	Staphylococcus_phage	99.3	3.6e-80
WP_000348364.1|224211_225690_+	o-succinylbenzoate--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	97.6	2.8e-283
WP_000778528.1|225694_226696_+	o-succinylbenzoate synthase	NA	A0A2H4PQM0	Staphylococcus_phage	97.3	5.3e-185
WP_000718107.1|226692_226950_-	membrane protein insertion efficiency factor YidD	NA	A0A2H4PQM5	Staphylococcus_phage	100.0	7.2e-46
WP_000672013.1|227015_227489_+	nucleoside triphosphatase YtkD	NA	A0A2H4PQM4	Staphylococcus_phage	98.7	7.2e-84
WP_001822900.1|227493_228240_+	S9 family peptidase	NA	A0A2H4PQM6	Staphylococcus_phage	98.8	1.4e-142
WP_000109906.1|228617_230210_-	phosphoenolpyruvate carboxykinase (ATP)	NA	A0A2H4PQN1	Staphylococcus_phage	100.0	0.0e+00
WP_000933820.1|230581_231778_+	methionine adenosyltransferase	NA	A0A2H4PQS6	Staphylococcus_phage	99.5	4.3e-218
WP_000366163.1|231899_232808_+	NERD domain-containing protein	NA	A0A2H4PQQ8	Staphylococcus_phage	100.0	3.4e-138
WP_000453306.1|233019_233853_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	99.3	7.8e-158
WP_000623470.1|235849_236203_-	CrcB family protein	NA	A0A2H4PQQ7	Staphylococcus_phage	94.0	3.8e-21
WP_001200542.1|236199_236565_-	fluoride efflux transporter CrcB	NA	A0A2H4PQR0	Staphylococcus_phage	100.0	3.6e-59
WP_000091442.1|236820_237123_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001096494.1|237382_238096_+	transaldolase	NA	M1PR54	Cyanophage	35.3	5.5e-19
WP_001168903.1|238535_239171_-|protease	CPBP family intramembrane metalloprotease SdpA	protease	NA	NA	NA	NA
WP_001030469.1|239466_239910_+	hypothetical protein	NA	A0A2H4PQT8	Staphylococcus_phage	98.6	2.4e-57
WP_001153742.1|239896_240340_-	competence protein ComK	NA	NA	NA	NA	NA
WP_000671057.1|240452_240923_-	RNA polymerase sigma factor	NA	A0A2H4PQT5	Staphylococcus_phage	98.1	8.8e-82
WP_000384171.1|241121_241346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001032833.1|241621_242476_+	glucosaminidase domain-containing protein	NA	Q4ZCC7	Staphylococcus_virus	38.6	9.8e-39
WP_000989121.1|242562_243855_-	arsenite efflux transporter membrane subunit ArsB	NA	A0A2H4PQU3	Staphylococcus_phage	99.5	5.0e-228
WP_000221177.1|243854_244169_-	winged helix-turn-helix transcriptional regulator	NA	A0A2H4PQT4	Staphylococcus_phage	98.1	9.8e-53
WP_001261668.1|244691_246194_+	FAD/NAD(P)-binding protein	NA	A0A2H4PQX2	Staphylococcus_phage	98.6	1.9e-29
WP_000077358.1|246674_247718_+	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A2H4PQS8	Staphylococcus_phage	98.8	5.3e-196
WP_000493887.1|247724_248357_+	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	98.6	5.5e-111
WP_001159037.1|248367_249549_+	3,4-dihydroxy-2-butanone-4-phosphate synthase	NA	A0A2H4PQS2	Staphylococcus_phage	99.5	5.6e-226
WP_001008549.1|249561_250026_+	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	100.0	4.5e-70
WP_001196362.1|250147_251149_-	proline dehydrogenase	NA	A0A2H4PQT6	Staphylococcus_phage	99.4	2.6e-184
WP_001790712.1|251259_251379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266096.1|251381_252209_+	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_000757543.1|252780_253182_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000764419.1|253304_253868_-	class I SAM-dependent methyltransferase	NA	A0A2H4PQV0	Staphylococcus_phage	99.5	8.3e-103
WP_000526539.1|253864_254818_-	TIGR01212 family radical SAM protein	NA	A0A2H4PQV5	Staphylococcus_phage	100.0	2.2e-79
WP_001025067.1|254927_256109_+	MFS transporter	NA	A0A2H4PQR6	Staphylococcus_phage	99.7	7.3e-218
WP_001557386.1|256396_258814_+|tRNA	leucine--tRNA ligase	tRNA	A0A2H4PQS0	Staphylococcus_phage	99.5	0.0e+00
WP_000836461.1|258835_259147_+	rhodanese-like domain-containing protein	NA	A0A2H4PQR9	Staphylococcus_phage	99.0	4.8e-52
WP_001050568.1|259472_266033_+	LPXTG-anchored repetitive surface protein SasC	NA	A0A2H4PQU6	Staphylococcus_phage	98.3	6.1e-306
WP_000285020.1|266149_267418_-	NAD(P)/FAD-dependent oxidoreductase	NA	A0A2H4PQX1	Staphylococcus_phage	99.1	9.1e-57
>prophage 15
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	278709	284037	2843306		Staphylococcus_phage(50.0%)	3	NA	NA
WP_001091387.1|278709_279567_+	DUF1444 domain-containing protein	NA	A0A2H4PQY3	Staphylococcus_phage	100.0	6.8e-72
WP_001048368.1|279595_280192_+	DUF4479 domain-containing protein	NA	NA	NA	NA	NA
WP_000118314.1|280212_284037_+	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	47.0	2.6e-83
>prophage 16
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	292777	294484	2843306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000862096.1|292777_294484_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	99.6	8.0e-274
>prophage 17
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	301087	303718	2843306	tRNA	Cronobacter_phage(50.0%)	2	NA	NA
WP_000186029.1|301087_302350_+|tRNA	tyrosine--tRNA ligase	tRNA	K4F5T3	Cronobacter_phage	42.1	2.7e-85
WP_001279338.1|302443_303718_-	trypsin-like peptidase domain-containing protein	NA	A0A1B1IRD3	uncultured_Mediterranean_phage	29.0	1.7e-10
>prophage 18
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	307487	311620	2843306		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000808849.1|307487_309092_-	phosphoglycerate dehydrogenase	NA	A0A2H4PQU8	Staphylococcus_phage	100.0	1.2e-114
WP_000291420.1|309078_310236_-	alanine--glyoxylate aminotransferase family protein	NA	NA	NA	NA	NA
WP_000553924.1|310350_310797_-	OsmC family protein	NA	NA	NA	NA	NA
WP_000174280.1|310876_311620_+	glycerophosphoryl diester phosphodiesterase	NA	M1HTS7	Paramecium_bursaria_Chlorella_virus	30.0	4.9e-18
>prophage 19
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	329212	332410	2843306		Streptomyces_phage(100.0%)	1	NA	NA
WP_000226919.1|329212_332410_+	DNA polymerase III subunit alpha	NA	A0A2L1IZ23	Streptomyces_phage	30.5	4.2e-135
>prophage 20
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	337343	339101	2843306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001232648.1|337343_339101_+	pyruvate kinase	NA	A0A2H4PQU5	Staphylococcus_phage	100.0	2.6e-41
>prophage 21
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	343985	352149	2843306		Feldmannia_irregularis_virus(25.0%)	5	NA	NA
WP_000080028.1|343985_344690_+	response regulator transcription factor	NA	Q6XM27	Feldmannia_irregularis_virus	28.7	1.6e-07
WP_015445861.1|344689_346351_+	HAMP domain-containing sensor histidine kinase	NA	W8CYF6	Bacillus_phage	39.4	5.8e-35
WP_000849428.1|346849_348337_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001038317.1|348630_351261_+	DNA polymerase I	NA	A8E2B3	Enterococcus_phage	33.0	6.1e-47
WP_001114454.1|351276_352149_+	bifunctional DNA-formamidopyrimidine glycosylase/DNA-(apurinic or apyrimidinic site) lyase	NA	G3MA33	Bacillus_virus	39.1	2.6e-42
>prophage 22
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	356064	367217	2843306	protease,tRNA	Brevibacillus_phage(20.0%)	12	NA	NA
WP_000808621.1|356064_356985_+	primosomal protein DnaI	NA	S5MU12	Brevibacillus_phage	29.4	8.1e-31
WP_001790562.1|357077_357200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000435132.1|357397_359335_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L6B6	Tupanvirus	36.0	7.8e-116
WP_000049145.1|359760_361254_+	amino acid permease	NA	NA	NA	NA	NA
WP_001791162.1|361482_362010_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	33.1	4.1e-11
WP_001125540.1|362038_362239_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_001138360.1|362285_362642_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_000032657.1|362783_363392_+	NUDIX domain-containing protein	NA	A0A060AB76	Staphylococcus_phage	35.9	6.6e-21
WP_001280022.1|363410_364340_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001790560.1|364344_364455_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000127573.1|364502_365804_+	trigger factor	NA	NA	NA	NA	NA
WP_000472302.1|365954_367217_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	62.0	5.0e-140
>prophage 23
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	376784	383431	2843306	integrase,tRNA	Catovirus(50.0%)	4	377756:377772	389961:389977
WP_000425353.1|376784_379415_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0S951	Catovirus	40.7	3.7e-153
377756:377772	attL	TTTAAAAGAACAAGATT	NA	NA	NA	NA
WP_001108346.1|379427_380699_+	bifunctional folylpolyglutamate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
WP_000261115.1|380968_381676_+	prepilin peptidase	NA	NA	NA	NA	NA
WP_000868132.1|382345_383431_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0A8WIF9	Clostridium_phage	28.3	4.5e-12
389961:389977	attR	TTTAAAAGAACAAGATT	NA	NA	NA	NA
>prophage 24
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	386762	387494	2843306		Streptococcus_phage(100.0%)	1	NA	NA
WP_001072201.1|386762_387494_-	23S rRNA (adenine(2058)-N(6))-methyltransferase Erm(A)	NA	E4ZFQ0	Streptococcus_phage	47.5	1.9e-51
>prophage 25
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	396036	431648	2843306	tRNA	uncultured_Mediterranean_phage(18.75%)	30	NA	NA
WP_001005768.1|396036_397041_+	Holliday junction branch migration DNA helicase RuvB	NA	B3GAM6	uncultured_virus	29.1	1.7e-05
WP_001019178.1|397042_398068_+|tRNA	tRNA preQ1(34) S-adenosylmethionine ribosyltransferase-isomerase QueA	tRNA	NA	NA	NA	NA
WP_001112045.1|398090_399230_+|tRNA	tRNA guanosine(34) transglycosylase Tgt	tRNA	A0A1B1IVQ4	uncultured_Mediterranean_phage	44.7	5.4e-85
WP_001160682.1|399248_399509_+	preprotein translocase subunit YajC	NA	A0A1B1IVR5	uncultured_Mediterranean_phage	35.3	8.2e-05
WP_173896723.1|399783_402063_+	protein translocase subunit SecDF	NA	A0A1B1IVP7	uncultured_Mediterranean_phage	35.8	1.1e-31
WP_000595011.1|402265_404539_+	single-stranded-DNA-specific exonuclease RecJ	NA	A7KV88	Bacillus_phage	29.3	8.1e-64
WP_000364542.1|404560_405079_+	adenine phosphoribosyltransferase	NA	A0A1V0SKE5	Klosneuvirus	46.5	5.6e-29
WP_001058587.1|405506_407696_+	bifunctional (p)ppGpp synthetase/guanosine-3',5'-bis(diphosphate) 3'-pyrophosphohydrolase	NA	A0A2I2L310	Orpheovirus	37.7	6.9e-12
WP_000717800.1|408155_409031_+	N-acetylmuramoyl-L-alanine amidase	NA	A0A0N9SGH1	Paenibacillus_phage	33.7	4.7e-12
WP_000590826.1|409491_410754_+|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_000044799.1|410769_412536_+|tRNA	aspartate--tRNA ligase	tRNA	A0A2K9L0E9	Tupanvirus	27.3	1.3e-16
WP_001790559.1|412868_412997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000682646.1|412996_413770_+|tRNA	tRNA threonylcarbamoyladenosine dehydratase	tRNA	NA	NA	NA	NA
WP_000102726.1|413930_415205_-	replication-associated recombination protein A	NA	A0A127AWE7	Bacillus_phage	50.5	3.1e-105
WP_000704122.1|415289_415712_+	Rrf2 family transcriptional regulator	NA	NA	NA	NA	NA
WP_000752909.1|415811_415994_+	CsbD family protein	NA	NA	NA	NA	NA
WP_000009238.1|416033_416180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000985878.1|416416_417430_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_000409157.1|417741_418884_+	cysteine desulfurase	NA	A0A1X7QGF3	Faustovirus	30.8	5.4e-32
WP_000066097.1|418884_420003_+|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_000567017.1|420697_421366_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_001283312.1|421367_423845_+	ATP-dependent RecD-like DNA helicase	NA	A0A0K2FLP8	Brevibacillus_phage	29.0	1.1e-66
WP_000734075.1|424187_426818_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	34.4	3.2e-64
WP_000426912.1|426880_427141_+	IreB family regulatory phosphoprotein	NA	NA	NA	NA	NA
WP_000939059.1|427144_427573_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_000134779.1|427587_427896_+	DUF1292 domain-containing protein	NA	NA	NA	NA	NA
WP_000342258.1|428180_428819_+	O-methyltransferase	NA	A0A2P1JQT7	Mycobacterium_phage	28.8	3.2e-10
WP_000137774.1|428821_429745_+	U32 family peptidase	NA	NA	NA	NA	NA
WP_000848304.1|429756_431025_+	U32 family peptidase	NA	Q6DW11	Phage_TP	31.7	4.0e-36
WP_000648617.1|431024_431648_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	41.1	2.8e-35
>prophage 26
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	448328	454492	2843306		Bacillus_phage(33.33%)	5	NA	NA
WP_000439693.1|448328_448790_+	ComE operon protein 2	NA	A7KUY9	Bacillus_phage	58.8	3.6e-35
WP_001557362.1|448794_450996_+	DNA internalization-related competence protein ComEC/Rec2	NA	Q332C0	Clostridium_botulinum_C_phage	32.2	1.6e-32
WP_001282563.1|451052_452027_+	DNA polymerase III subunit delta	NA	NA	NA	NA	NA
WP_001274017.1|452071_452323_-	30S ribosomal protein S20	NA	NA	NA	NA	NA
WP_000368338.1|452668_454492_+	elongation factor 4	NA	A0A1S5SF82	Streptococcus_phage	25.1	6.1e-22
>prophage 27
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	457986	461094	2843306		Micromonas_pusilla_virus(50.0%)	2	NA	NA
WP_000034716.1|457986_459819_+	molecular chaperone DnaK	NA	G8DDB7	Micromonas_pusilla_virus	46.5	4.4e-137
WP_001119021.1|459954_461094_+	molecular chaperone DnaJ	NA	A0A1V0SBY2	Catovirus	25.8	1.2e-26
>prophage 28
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	467564	468512	2843306		Rhizobium_phage(100.0%)	1	NA	NA
WP_001117767.1|467564_468512_+	PhoH family protein	NA	L7TP00	Rhizobium_phage	46.8	6.4e-47
>prophage 29
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	471565	485311	2843306	tRNA	Klosneuvirus(28.57%)	13	NA	NA
WP_001030080.1|471565_472957_-|tRNA	glycine--tRNA ligase	tRNA	A0A1V0SIF1	Klosneuvirus	27.4	4.7e-46
WP_001797828.1|473291_473915_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000411298.1|473925_474744_+	kinase/pyrophosphorylase	NA	NA	NA	NA	NA
WP_001217241.1|474804_476622_+	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	36.3	1.4e-53
WP_001283055.1|476845_477952_+	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	38.1	1.1e-37
WP_000624577.1|478082_478760_+|tRNA	tRNA (adenine-N(1))-methyltransferase	tRNA	NA	NA	NA	NA
WP_000683940.1|478762_479863_+	Nif3-like dinuclear metal center hexameric protein	NA	NA	NA	NA	NA
WP_001062177.1|479976_481323_+	DEAD/DEAH box helicase	NA	A0A1V0SIR5	Klosneuvirus	34.0	2.4e-55
WP_000924220.1|481332_482223_+	deoxyribonuclease IV	NA	A0A2H4UU70	Bodo_saltans_virus	36.0	3.4e-26
WP_001213908.1|482348_483134_+	metal ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	28.3	8.0e-19
WP_000564315.1|483175_484039_+	metal ABC transporter permease	NA	NA	NA	NA	NA
WP_001095260.1|484025_484436_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000863556.1|484711_485311_+	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	54.7	9.2e-60
>prophage 30
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	491484	492108	2843306		Streptococcus_phage(100.0%)	1	NA	NA
WP_001223008.1|491484_492108_+	MBL fold metallo-hydrolase	NA	A0A1X9I5D3	Streptococcus_phage	37.1	1.6e-30
>prophage 31
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	497652	500464	2843306		Prochlorococcus_phage(100.0%)	2	NA	NA
WP_000019691.1|497652_498999_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPA	NA	E3SN07	Prochlorococcus_phage	39.2	1.7e-61
WP_000202188.1|498991_500464_+	aminomethyl-transferring glycine dehydrogenase subunit GcvPB	NA	E3SN07	Prochlorococcus_phage	41.3	2.8e-81
>prophage 32
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	507964	514535	2843306		Indivirus(66.67%)	6	NA	NA
WP_001286924.1|507964_509302_+	exodeoxyribonuclease VII large subunit	NA	A0A1V0SD82	Indivirus	37.7	1.6e-43
WP_000159865.1|509294_509525_+	exodeoxyribonuclease VII small subunit	NA	NA	NA	NA	NA
WP_000183383.1|509502_510384_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	25.8	2.0e-10
WP_001124985.1|510815_511268_+	transcriptional regulator ArgR	NA	NA	NA	NA	NA
WP_000942210.1|511283_512963_+	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001291533.1|513113_514535_+	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	26.3	5.1e-40
>prophage 33
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	521364	522771	2843306		Synechococcus_phage(100.0%)	1	NA	NA
WP_000193707.1|521364_522771_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A222YX62	Synechococcus_phage	31.1	4.3e-31
>prophage 34
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	529197	530682	2843306		Cyanophage(100.0%)	1	NA	NA
WP_000105070.1|529197_530682_-	glucose-6-phosphate dehydrogenase	NA	M4SIY3	Cyanophage	37.8	2.4e-80
>prophage 35
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	534209	628589	2843306	tRNA,head,plate,protease,holin,tail,integrase,capsid,terminase,portal	Staphylococcus_phage(76.47%)	118	545615:545643	591287:591315
WP_001171335.1|534209_535118_-	aldo/keto reductase	NA	A0A1V0SKP9	Klosneuvirus	32.0	4.4e-05
WP_000365240.1|535199_535742_+	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_000392691.1|535846_536296_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_000447733.1|536344_537232_+	site-specific tyrosine recombinase XerD	NA	A0A0K2CP59	Brevibacillus_phage	31.1	5.6e-37
WP_001183429.1|537309_537816_-	DUF309 domain-containing protein	NA	NA	NA	NA	NA
WP_000273371.1|537907_538639_+	segregation/condensation protein A	NA	A0A1B1IVW1	uncultured_Mediterranean_phage	21.8	7.9e-05
WP_000368656.1|538631_539174_+	SMC-Scp complex subunit ScpB	NA	NA	NA	NA	NA
WP_000159577.1|539166_539904_+	rRNA pseudouridine synthase	NA	NA	NA	NA	NA
WP_000064078.1|540036_540762_+	two-component system response regulator SrrA	NA	W8CYM9	Bacillus_phage	43.0	3.5e-45
WP_000987774.1|540742_542494_+	two-component system sensor histidine kinase SrrB	NA	A0A1V0SGX0	Hokovirus	33.2	2.2e-21
WP_001557355.1|542737_543664_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001558502.1|543656_545684_+	hypothetical protein	NA	B5WZK7	Staphylococcus_phage	100.0	1.6e-116
545615:545643	attL	ACCATCACATTATGATGATATGTTTATTT	NA	NA	NA	NA
WP_000264751.1|545726_546932_-|integrase	site-specific integrase	integrase	A0A2I6PEN0	Staphylococcus_phage	100.0	7.7e-223
WP_000191466.1|547057_547672_+	hypothetical protein	NA	A0A2I6PEZ0	Staphylococcus_phage	100.0	6.7e-106
WP_001794606.1|547668_547815_-	hypothetical protein	NA	A0A2I6PEK8	Staphylococcus_phage	97.9	2.6e-16
WP_000705240.1|547850_548033_-	hypothetical protein	NA	A0A2I6PDR4	Staphylococcus_phage	100.0	5.3e-27
WP_000511090.1|548102_548834_-	helix-turn-helix transcriptional regulator	NA	S4SVC5	Staphylococcus_phage	99.2	1.3e-132
WP_000213811.1|548985_549198_+	helix-turn-helix transcriptional regulator	NA	A7TWF1	Staphylococcus_phage	100.0	1.6e-30
WP_000435357.1|549245_549689_+	hypothetical protein	NA	A7TWF2	Staphylococcus_phage	100.0	8.9e-76
WP_000771849.1|549703_549853_+	hypothetical protein	NA	D2JGJ0	Staphylococcus_phage	100.0	1.4e-20
WP_000362644.1|549893_550106_-	hypothetical protein	NA	D2JGJ1	Staphylococcus_phage	100.0	7.6e-33
WP_031898325.1|550175_550373_+	hypothetical protein	NA	A7TWF5	Staphylococcus_phage	84.6	5.9e-24
WP_000773059.1|550359_550740_-	DUF2513 domain-containing protein	NA	Q4ZCQ5	Staphylococcus_virus	100.0	5.8e-68
WP_001025401.1|550806_551052_+	DUF2829 domain-containing protein	NA	A0A2I6PF15	Staphylococcus_phage	100.0	5.1e-41
WP_001128433.1|551020_551386_-	hypothetical protein	NA	A0A2I6PF07	Staphylococcus_phage	100.0	2.4e-63
WP_001097552.1|551440_551656_+	hypothetical protein	NA	A0A2I6PF01	Staphylococcus_phage	100.0	1.9e-31
WP_001124160.1|551680_551944_+	helix-turn-helix domain-containing protein	NA	A7TWG0	Staphylococcus_phage	100.0	5.7e-46
WP_001285954.1|551956_552118_+	DUF1270 domain-containing protein	NA	A7TWM3	Staphylococcus_phage	100.0	8.6e-21
WP_000174998.1|552196_552520_+	hypothetical protein	NA	A0A2I6PE70	Staphylococcus_phage	100.0	6.5e-52
WP_000985971.1|552534_552897_+	hypothetical protein	NA	A0A2I6PEM7	Staphylococcus_phage	99.2	1.9e-55
WP_000762538.1|552893_554060_+	DUF2800 domain-containing protein	NA	R4WAL0	Staphylococcus_phage	98.7	1.5e-218
WP_000645045.1|554085_554643_+	DUF2815 family protein	NA	A0A2K9VBT2	Staphylococcus_phage	100.0	1.8e-97
WP_075339477.1|554711_556664_+	DNA polymerase	NA	A0A2K9VBT3	Staphylococcus_phage	99.7	0.0e+00
WP_001164629.1|556676_556862_+	DUF3113 family protein	NA	A0A2I6PEM8	Staphylococcus_phage	100.0	7.0e-27
WP_000022719.1|557260_557515_+	DUF3310 domain-containing protein	NA	A7TWG9	Staphylococcus_phage	100.0	2.2e-42
WP_060474161.1|557514_557763_+	hypothetical protein	NA	A0A2K9VBX5	Staphylococcus_phage	100.0	1.2e-40
WP_000693989.1|557776_557983_+	hypothetical protein	NA	A0A2K9VBT9	Staphylococcus_phage	100.0	3.0e-34
WP_000695753.1|557985_558390_+	hypothetical protein	NA	A0A0E3T8H9	Staphylococcus_phage	98.5	1.0e-70
WP_000979209.1|558386_558734_+	hypothetical protein	NA	D2JGL4	Staphylococcus_phage	100.0	5.9e-59
WP_000144698.1|558730_559039_+	hypothetical protein	NA	Q4ZBK6	Staphylococcus_phage	99.0	3.1e-51
WP_001065104.1|559031_559286_+	DUF1024 family protein	NA	A7TWH5	Staphylococcus_phage	92.9	6.1e-37
WP_000714407.1|559272_559443_+	hypothetical protein	NA	A0A1W6JQ22	Staphylococcus_phage	100.0	5.7e-23
WP_001066454.1|559435_559972_+	dUTP diphosphatase	NA	A0A1W6JPM9	Staphylococcus_phage	99.4	4.6e-95
WP_000195832.1|560008_560215_+	DUF1381 domain-containing protein	NA	A7TWH8	Staphylococcus_phage	97.1	4.9e-29
WP_000141259.1|560211_560415_+	hypothetical protein	NA	A7TWH9	Staphylococcus_phage	100.0	8.8e-31
WP_000608283.1|560407_560644_+	hypothetical protein	NA	A7TWI0	Staphylococcus_phage	100.0	3.6e-36
WP_001596346.1|560633_561023_+	hypothetical protein	NA	A7TWI1	Staphylococcus_phage	100.0	3.6e-65
WP_000595269.1|561019_561172_+	transcriptional activator RinB	NA	A7TWI2	Staphylococcus_phage	98.0	1.3e-18
WP_000265258.1|561239_561440_+	DUF1514 family protein	NA	A0A2I6PF41	Staphylococcus_phage	100.0	2.9e-26
WP_000884860.1|561492_563940_+	virulence-associated E family protein	NA	M1RZC5	Staphylococcus_phage	99.5	0.0e+00
WP_015978074.1|564042_564147_-	hypothetical protein	NA	A0A2I6PDP6	Staphylococcus_phage	100.0	2.7e-12
WP_000665205.1|564280_564571_+	VRR-NUC domain-containing protein	NA	U5U7A3	Staphylococcus_phage	100.0	4.9e-51
WP_001795330.1|564551_565919_+	DEAD/DEAH box helicase	NA	Q4ZCF6	Staphylococcus_virus	100.0	4.6e-264
WP_000513702.1|565931_566369_+	transcriptional regulator	NA	B7T0I6	Staphylococcus_virus	100.0	6.1e-77
WP_000166884.1|566525_566846_+	HNH endonuclease	NA	A0A2K9VBV6	Staphylococcus_phage	99.1	1.1e-56
WP_000778935.1|566970_567276_+|terminase	P27 family phage terminase small subunit	terminase	U5U414	Staphylococcus_phage	100.0	2.9e-49
WP_000152858.1|567265_568957_+|terminase	terminase large subunit	terminase	A0A2K9VBQ1	Staphylococcus_phage	100.0	0.0e+00
WP_001100660.1|568961_570200_+|portal	phage portal protein	portal	A0A2K9VBP0	Staphylococcus_phage	99.5	2.0e-234
WP_000061872.1|570183_570957_+|protease	Clp protease ClpP	protease	M1TAZ4	Staphylococcus_phage	100.0	9.2e-137
WP_001142739.1|570968_572132_+|capsid	phage major capsid protein	capsid	A0A2I6PDD7	Staphylococcus_phage	100.0	9.4e-218
WP_000050973.1|572200_572479_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A2I6PEQ1	Staphylococcus_phage	100.0	2.1e-46
WP_000395495.1|572490_572823_+	hypothetical protein	NA	A0A2I6PDD6	Staphylococcus_phage	99.1	8.2e-58
WP_000110020.1|572819_573221_+	hypothetical protein	NA	A0A2I6PDD3	Staphylococcus_phage	100.0	6.2e-68
WP_001023802.1|573221_573617_+	DUF3168 domain-containing protein	NA	A0A2I6PDD8	Staphylococcus_phage	100.0	2.6e-66
WP_000807536.1|573651_574293_+|tail	tail protein	tail	A0A2I6PEP6	Staphylococcus_phage	100.0	5.9e-121
WP_000169128.1|574384_574840_+	Ig domain-containing protein	NA	A0A2I6PF45	Staphylococcus_phage	100.0	1.3e-77
WP_000589165.1|574897_575248_+	hypothetical protein	NA	A0A2I6PDE6	Staphylococcus_phage	100.0	1.1e-55
WP_000438833.1|575289_575448_+	hypothetical protein	NA	A0A2I6PES8	Staphylococcus_phage	100.0	1.2e-19
WP_001003456.1|575461_581662_+|tail	phage tail tape measure protein	tail	A0A2I6PE73	Staphylococcus_phage	99.3	0.0e+00
WP_001190533.1|581661_582486_+|tail	phage tail family protein	tail	A0A2I6PER3	Staphylococcus_phage	100.0	4.1e-159
WP_000384474.1|582494_584078_+|tail	phage tail protein	tail	A0A2I6PEQ5	Staphylococcus_phage	100.0	9.3e-309
WP_000179858.1|584077_584368_+	hypothetical protein	NA	U5U457	Staphylococcus_phage	100.0	2.1e-49
WP_000429558.1|584383_586294_+	minor structural protein	NA	A0A2I6PEQ9	Staphylococcus_phage	100.0	0.0e+00
WP_173896725.1|586293_587760_+|plate	phage baseplate upper protein	plate	A0A2I6PES7	Staphylococcus_phage	99.6	2.2e-272
WP_001166599.1|587759_588149_+	DUF2977 domain-containing protein	NA	A0A2I6PER1	Staphylococcus_phage	100.0	2.2e-62
WP_000916020.1|588141_588306_+	XkdX family protein	NA	A0A2I6PES4	Staphylococcus_phage	100.0	4.9e-24
WP_000466784.1|588351_588651_+	DUF2951 domain-containing protein	NA	A0A2I6PER2	Staphylococcus_phage	100.0	2.0e-31
WP_000339146.1|588786_589089_+|holin	phage holin	holin	A0A2I6PET6	Staphylococcus_phage	100.0	7.0e-48
WP_000909213.1|589099_590554_+	N-acetylmuramoyl-L-alanine amidase	NA	U5U7D2	Staphylococcus_phage	100.0	2.6e-289
WP_000126130.1|591275_591491_+	hypothetical protein	NA	A0ZS61	Staphylococcus_virus	100.0	2.0e-25
591287:591315	attR	ACCATCACATTATGATGATATGTTTATTT	NA	NA	NA	NA
WP_000476865.1|591580_592486_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_000476354.1|592543_593440_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001557351.1|593515_593770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000913227.1|593910_594867_+	DUF1672 domain-containing protein	NA	NA	NA	NA	NA
WP_001186912.1|595268_595814_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_001151997.1|595919_596168_-	ferredoxin	NA	A0A127AYY7	Bacillus_phage	48.0	8.3e-15
WP_001163801.1|596275_597229_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000902099.1|597218_598598_+	ATP-dependent DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	33.6	1.4e-55
WP_000069291.1|598750_600211_+	elastin-binding protein EbpS	NA	NA	NA	NA	NA
WP_001792205.1|600335_600452_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001174258.1|600612_601599_+	YpdA family putative bacillithiol disulfide reductase	NA	NA	NA	NA	NA
WP_000681757.1|601713_602682_-	asparaginase	NA	NA	NA	NA	NA
WP_000644391.1|602758_603418_+	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001795818.1|603448_603601_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001792202.1|603681_603873_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000133961.1|604129_605305_+	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_153174329.1|605526_606837_+	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_000161745.1|606853_607852_+	NAD(P)H-dependent glycerol-3-phosphate dehydrogenase	NA	NA	NA	NA	NA
WP_001043863.1|608022_608295_+	HU family DNA-binding protein	NA	A7KV42	Bacillus_phage	73.3	4.2e-28
WP_000450555.1|608709_609282_+	heptaprenyl diphosphate synthase component 1	NA	NA	NA	NA	NA
WP_000774684.1|609284_610010_+	demethylmenaquinone methyltransferase	NA	NA	NA	NA	NA
WP_001096471.1|610011_610971_+	polyprenyl synthetase family protein	NA	A0A1V0SE37	Indivirus	24.4	1.3e-10
WP_000442480.1|611062_611512_+	nucleoside-diphosphate kinase	NA	D2E8E1	Anguillid_herpesvirus	43.8	2.4e-28
WP_000789522.1|611720_611921_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001269921.1|612306_613473_+	chorismate synthase	NA	A0A291AU41	Pandoravirus	31.8	5.8e-34
WP_000776312.1|613498_614563_+	3-dehydroquinate synthase	NA	NA	NA	NA	NA
WP_000253232.1|614572_615871_+	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000389524.1|615877_617122_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000005212.1|617135_617711_+	YpiB family protein	NA	G3MAV7	Bacillus_virus	27.2	2.1e-08
WP_000154683.1|617700_618288_+	DUF1405 domain-containing protein	NA	NA	NA	NA	NA
WP_001827022.1|618359_619040_+	zinc metallopeptidase	NA	NA	NA	NA	NA
WP_000839926.1|619375_619693_+	nucleotide pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000690025.1|619936_621079_+	N-acetyl-alpha-D-glucosaminyl L-malate synthase BshA	NA	NA	NA	NA	NA
WP_000361540.1|621083_622286_+|tRNA	CCA tRNA nucleotidyltransferase	tRNA	H7BUW3	unidentified_phage	43.3	4.2e-35
WP_000049921.1|622272_623244_+	biotin--[acetyl-CoA-carboxylase] ligase	NA	NA	NA	NA	NA
WP_000525078.1|623267_625961_+	ATP-dependent helicase DinG	NA	A0A1X9I5C8	Streptococcus_phage	34.4	8.2e-47
WP_000858779.1|626282_627575_+|tRNA	asparagine--tRNA ligase	tRNA	M1PB22	Moumouvirus	31.3	8.7e-55
WP_000362218.1|627902_628589_+	DnaD domain-containing protein	NA	Q938N2	Temperate_phage	32.6	1.2e-07
>prophage 36
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	632329	633007	2843306		Bacillus_phage(100.0%)	1	NA	NA
WP_001795446.1|632329_633007_-	Holliday junction resolvase RecU	NA	A0A1C8E9C3	Bacillus_phage	35.5	1.9e-24
>prophage 37
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	642281	643160	2843306		Bacillus_phage(100.0%)	1	NA	NA
WP_001133021.1|642281_643160_+	5'-3' exonuclease	NA	S5M4P0	Bacillus_phage	29.5	1.4e-19
>prophage 38
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	682119	691509	2843306		Staphylococcus_phage(60.0%)	13	NA	NA
WP_000282171.1|682119_682824_-	queuosine precursor transporter	NA	A0A2H4J2N7	uncultured_Caudovirales_phage	23.8	8.4e-12
WP_001795441.1|683068_683263_+	zinc-finger domain-containing protein	NA	NA	NA	NA	NA
WP_000691942.1|683274_683526_+	NifU N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000404645.1|683563_684688_+	virulence factor C	NA	NA	NA	NA	NA
WP_000995287.1|684703_685141_+	BrxA/BrxB family bacilliredoxin	NA	NA	NA	NA	NA
WP_000934894.1|685564_686521_+	thymidylate synthase	NA	A0A0N9SH48	Staphylococcus_phage	85.2	1.6e-167
WP_000175746.1|686720_687200_+	dihydrofolate reductase	NA	A0A0N9S8H6	Staphylococcus_phage	79.9	2.0e-73
WP_000166059.1|687214_688054_+	fatty acid kinase FakB2	NA	A0A0N9SI50	Staphylococcus_phage	77.3	2.3e-48
WP_000159900.1|688139_688673_+	peptide-methionine (S)-S-oxide reductase MsrA	NA	NA	NA	NA	NA
WP_000913317.1|688665_689094_+	peptide-methionine (R)-S-oxide reductase MsrB	NA	NA	NA	NA	NA
WP_000473653.1|689105_689606_+	PTS glucose transporter subunit IIA	NA	NA	NA	NA	NA
WP_000801007.1|689605_689827_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000342132.1|690018_691509_+	S41 family peptidase	NA	A0A0R6PIZ1	Moraxella_phage	30.5	2.9e-22
>prophage 39
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	694918	696930	2843306		Bacillus_phage(50.0%)	2	NA	NA
WP_000192137.1|694918_695578_+	response regulator transcription factor ArlR	NA	W8CYM9	Bacillus_phage	33.8	1.1e-34
WP_000166801.1|695574_696930_+	sensor histidine kinase ArlS	NA	A0A1V0SGX0	Hokovirus	27.8	3.5e-14
>prophage 40
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	703095	703887	2843306		Halovirus(100.0%)	1	NA	NA
WP_001185421.1|703095_703887_+	MoxR family ATPase	NA	R4TG24	Halovirus	34.2	3.3e-12
>prophage 41
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	707427	712458	2843306	lysis	Lactobacillus_phage(33.33%)	7	NA	NA
WP_000138413.1|707427_708564_-	toxic anion resistance protein	NA	A0A291I9K4	Lactobacillus_phage	28.3	7.4e-34
WP_001788788.1|708595_709225_-|lysis	5-bromo-4-chloroindolyl phosphate hydrolysis family protein	lysis	NA	NA	NA	NA
WP_001215907.1|709243_709513_-	acylphosphatase	NA	NA	NA	NA	NA
WP_000269923.1|709675_709984_+	DUF1033 family protein	NA	NA	NA	NA	NA
WP_000809131.1|710154_710355_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	66.2	8.4e-18
WP_000876201.1|710551_710953_+	sarA expression modulator protein Msa	NA	NA	NA	NA	NA
WP_000216946.1|711192_712458_-	diaminopimelate decarboxylase	NA	A0A0P0YM38	Yellowstone_lake_phycodnavirus	23.2	6.2e-13
>prophage 42
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	720505	722107	2843306		Klosneuvirus(100.0%)	1	NA	NA
WP_000942303.1|720505_722107_-	ATP-binding cassette domain-containing protein	NA	A0A1V0SKJ1	Klosneuvirus	25.7	5.5e-51
>prophage 43
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	727196	730650	2843306		Indivirus(50.0%)	3	NA	NA
WP_000079447.1|727196_728048_+	phosphate ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	8.9e-16
WP_000974847.1|728054_728696_+	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_000077555.1|728835_730650_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	47.3	1.4e-154
>prophage 44
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	734064	734766	2843306		Tupanvirus(100.0%)	1	NA	NA
WP_000571259.1|734064_734766_+	ABC transporter ATP-binding protein	NA	A0A2K9L3Z8	Tupanvirus	30.3	2.0e-13
>prophage 45
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	742864	745219	2843306		Acinetobacter_phage(100.0%)	3	NA	NA
WP_047211978.1|742864_743647_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	35.9	3.5e-27
WP_000173833.1|743648_744647_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	34.9	8.5e-34
WP_000604816.1|744652_745219_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	32.1	1.3e-23
>prophage 46
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	749537	750800	2843306		Bacillus_phage(100.0%)	1	NA	NA
WP_000283016.1|749537_750800_-	Y-family DNA polymerase	NA	O64031	Bacillus_phage	44.3	2.6e-96
>prophage 47
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	760459	764853	2843306		Bacillus_phage(50.0%)	2	NA	NA
WP_001289590.1|760459_762862_-	DNA topoisomerase IV subunit A	NA	A0A172JHV7	Bacillus_phage	32.2	1.1e-92
WP_001557340.1|762861_764853_-	DNA topoisomerase IV subunit B	NA	G3M9Z3	Bacillus_virus	40.5	1.0e-115
>prophage 48
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	770844	772491	2843306		Vibrio_phage(100.0%)	1	NA	NA
WP_001088978.1|770844_772491_-	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.4	2.5e-22
>prophage 49
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	776160	777282	2843306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000691301.1|776160_777282_-	exonuclease SbcCD subunit D	NA	A0A1X9I9U0	Staphylococcus_phage	22.7	4.3e-10
>prophage 50
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	781432	787088	2843306		Phage_Wrath(25.0%)	6	NA	NA
WP_001208755.1|781432_782056_+	transcriptional repressor LexA	NA	A0A1B2APZ1	Phage_Wrath	63.8	5.9e-17
WP_001797872.1|782435_783452_-	CAP domain-containing protein	NA	U5Q0C0	Bacillus_phage	41.5	1.1e-15
WP_000688122.1|783473_784451_-	GMP reductase	NA	Q4ZCY7	Staphylococcus_virus	99.7	8.0e-186
WP_001085655.1|784607_784877_-	30S ribosomal protein S14	NA	NA	NA	NA	NA
WP_001265708.1|785330_785480_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000082539.1|785570_787088_-	catalase	NA	A0A2K9L0T1	Tupanvirus	43.2	2.3e-91
>prophage 51
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	797226	801502	2843306		Bacillus_phage(50.0%)	6	NA	NA
WP_000841351.1|797226_797760_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	43.5	3.4e-21
WP_001027143.1|797898_798087_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000202390.1|798199_798802_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000670307.1|798798_799890_-	sensor histidine kinase	NA	NA	NA	NA	NA
WP_000603970.1|799893_800625_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000593436.1|800593_801502_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.9	3.1e-22
>prophage 52
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	807161	810189	2843306		Staphylococcus_phage(100.0%)	5	NA	NA
WP_000006110.1|807161_807347_-	hypothetical protein	NA	A0A0F6N3H3	Staphylococcus_phage	78.7	2.4e-19
WP_001788716.1|807770_807881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001002340.1|808580_808787_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	59.7	1.3e-13
WP_001071314.1|809080_809293_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	72.5	4.8e-19
WP_001791958.1|809991_810189_-	hypothetical protein	NA	A0A1W6JNK0	Staphylococcus_phage	48.4	1.1e-09
>prophage 53
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	815258	815735	2843306		Fowlpox_virus(100.0%)	1	NA	NA
WP_000448078.1|815258_815735_+	glutathione peroxidase	NA	Q70H87	Fowlpox_virus	38.0	1.2e-22
>prophage 54
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	821677	828159	2843306		Acanthocystis_turfacea_Chlorella_virus(33.33%)	4	NA	NA
WP_001103743.1|821677_822496_-	aquaporin family protein	NA	M1H4F4	Acanthocystis_turfacea_Chlorella_virus	35.1	2.4e-26
WP_001077635.1|822970_823513_-	glycerol-3-phosphate responsive antiterminator	NA	NA	NA	NA	NA
WP_000516269.1|823518_825528_-	DNA mismatch repair endonuclease MutL	NA	A0A1B2LRQ5	Wolbachia_phage	30.0	4.8e-60
WP_000073352.1|825540_828159_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	23.7	8.5e-41
>prophage 55
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	837573	838617	2843306		Bacillus_phage(100.0%)	1	NA	NA
WP_000368166.1|837573_838617_-	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	69.2	9.3e-124
>prophage 56
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	842815	848482	2843306		Bacillus_virus(33.33%)	4	NA	NA
WP_000664775.1|842815_844102_-	insulinase family protein	NA	G3MBJ8	Bacillus_virus	28.4	7.9e-16
WP_000089941.1|844101_845367_-	insulinase family protein	NA	A0A1X9I714	Streptococcus_phage	26.8	1.2e-40
WP_001293306.1|845397_846111_-	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000035746.1|846115_848482_-	DNA translocase FtsK	NA	S5VNE3	Mycobacterium_phage	47.7	7.3e-84
>prophage 57
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	853497	865310	2843306	tRNA	Klosneuvirus(33.33%)	9	NA	NA
WP_000864190.1|853497_854469_-	riboflavin biosynthesis protein RibF	NA	A0A1V0SJE1	Klosneuvirus	32.1	1.7e-07
WP_000282298.1|854483_855401_-|tRNA	tRNA pseudouridine(55) synthase TruB	tRNA	NA	NA	NA	NA
WP_000097322.1|855569_855920_-	30S ribosome-binding factor RbfA	NA	NA	NA	NA	NA
WP_000043635.1|856305_858423_-	translation initiation factor IF-2	NA	E3T4N3	Cafeteria_roenbergensis_virus	25.1	2.4e-25
WP_000020853.1|858427_858745_-	YlxQ family RNA-binding protein	NA	NA	NA	NA	NA
WP_000727423.1|858741_859026_-	YlxR family protein	NA	NA	NA	NA	NA
WP_000097460.1|859046_860222_-	transcription termination/antitermination protein NusA	NA	NA	NA	NA	NA
WP_000036633.1|860242_860710_-	ribosome maturation factor RimP	NA	NA	NA	NA	NA
WP_001801936.1|860999_865310_-	DNA polymerase III subunit alpha	NA	A0A0A8WJ41	Clostridium_phage	41.2	3.5e-23
>prophage 58
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	869583	870354	2843306		Flavobacterium_phage(100.0%)	1	NA	NA
WP_000473699.1|869583_870354_-	isoprenyl transferase	NA	R9W0U9	Flavobacterium_phage	41.5	7.3e-25
>prophage 59
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	875133	888807	2843306	protease,tRNA	Erwinia_phage(16.67%)	10	NA	NA
WP_000379054.1|875133_876537_-|protease	ATP-dependent protease ATPase subunit HslU	protease	A0A1B2IDZ7	Erwinia_phage	25.6	4.9e-27
WP_000072681.1|876602_877148_-|protease	ATP-dependent protease subunit HslV	protease	NA	NA	NA	NA
WP_001015601.1|877144_878041_-	tyrosine recombinase XerC	NA	A0A0K2CP59	Brevibacillus_phage	31.9	3.6e-31
WP_000195254.1|878458_879766_-|tRNA	methylenetetrahydrofolate--tRNA-(uracil(54)- C(5))-methyltransferase (FADH(2)-oxidizing) TrmFO	tRNA	NA	NA	NA	NA
WP_001557331.1|879921_881997_-	type I DNA topoisomerase	NA	A0A1V0SCS0	Indivirus	39.2	1.7e-105
WP_000672869.1|883217_884462_-	FemA/FemB family glycyltransferase FmhC	NA	NA	NA	NA	NA
WP_001041666.1|884489_885608_-	LysM peptidoglycan-binding domain-containing protein	NA	A0A1W6JQB6	Staphylococcus_phage	61.1	9.5e-50
WP_000110253.1|885834_886743_-	succinate--CoA ligase subunit alpha	NA	A0A2K9L1S3	Tupanvirus	33.2	3.0e-17
WP_001020801.1|886764_887931_-	ADP-forming succinate--CoA ligase subunit beta	NA	NA	NA	NA	NA
WP_000176393.1|888039_888807_-	ribonuclease HII	NA	G9E3X7	Emiliania_huxleyi_virus	44.1	2.5e-25
>prophage 60
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	902191	904441	2843306		Acanthamoeba_polyphaga_mimivirus(33.33%)	3	NA	NA
WP_000043237.1|902191_902923_-	ribonuclease III	NA	A0A0G2Y7P9	Acanthamoeba_polyphaga_mimivirus	28.8	5.9e-24
WP_000426914.1|903038_903272_-	acyl carrier protein	NA	E3SSM9	Prochlorococcus_phage	63.3	1.6e-07
WP_000167269.1|903706_904441_-	3-oxoacyl-[acyl-carrier-protein] reductase	NA	Q06VL0	Trichoplusia_ni_ascovirus	30.3	3.1e-17
>prophage 61
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	914811	916806	2843306		Moumouvirus(100.0%)	1	NA	NA
WP_000579563.1|914811_916806_-	serine/threonine protein kinase Stk1	NA	M1PCM5	Moumouvirus	34.8	5.5e-24
>prophage 62
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	919953	920889	2843306	tRNA	Prochlorococcus_phage(100.0%)	1	NA	NA
WP_000161291.1|919953_920889_-|tRNA	methionyl-tRNA formyltransferase	tRNA	E3SNR5	Prochlorococcus_phage	28.0	4.7e-10
>prophage 63
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	925901	928158	2843306		Methanothermobacter_phage(50.0%)	3	NA	NA
WP_000722165.1|925901_927101_-	bifunctional phosphopantothenoylcysteine decarboxylase/phosphopantothenate--cysteine ligase CoaBC	NA	Q9HH70	Methanothermobacter_phage	32.9	1.2e-42
WP_000933956.1|927316_927535_-	DNA-directed RNA polymerase subunit omega	NA	NA	NA	NA	NA
WP_000368226.1|927534_928158_-	guanylate kinase	NA	A0A143DIC6	Abalone_herpesvirus	34.1	1.0e-21
>prophage 64
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	931472	932084	2843306		Pandoravirus(100.0%)	1	NA	NA
WP_001040248.1|931472_932084_-	orotate phosphoribosyltransferase	NA	S4VS55	Pandoravirus	33.8	1.6e-27
>prophage 65
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	936051	940662	2843306		Halovirus(33.33%)	4	NA	NA
WP_001190913.1|936051_937152_-	glutamine-hydrolyzing carbamoyl-phosphate synthase small subunit	NA	R4TGJ8	Halovirus	36.7	5.6e-63
WP_000767028.1|937153_938428_-	dihydroorotase	NA	NA	NA	NA	NA
WP_001016166.1|938445_939327_-	aspartate carbamoyltransferase catalytic subunit	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	33.9	4.6e-31
WP_001178619.1|939354_940662_-	uracil permease	NA	Q9KX94	Enterobacteria_phage	34.0	3.3e-54
>prophage 66
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	945126	947880	2843306	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000384691.1|945126_947880_-|tRNA	isoleucine--tRNA ligase	tRNA	A0A2I2L3Y0	Orpheovirus	28.0	3.6e-90
>prophage 67
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	967463	967652	2843306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001245796.1|967463_967652_-	hypothetical protein	NA	A0A0K1LL29	Staphylococcus_phage	85.2	2.5e-19
>prophage 68
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	976668	978628	2843306		Staphylococcus_phage(100.0%)	3	NA	NA
WP_001802045.1|976668_976893_-	hypothetical protein	NA	A0A2H4PQT0	Staphylococcus_phage	71.4	5.6e-18
WP_000765708.1|976849_976996_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000857488.1|977668_978628_+	alpha-hemolysin	NA	A0A2H4PQH7	Staphylococcus_phage	30.3	7.4e-35
>prophage 69
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	994265	998823	2843306		Staphylococcus_phage(33.33%)	3	NA	NA
WP_001018928.1|994265_994580_-	thioredoxin	NA	A0A1X9I9P5	Staphylococcus_phage	46.6	6.6e-25
WP_001249272.1|994752_997101_-	endonuclease MutS2	NA	F2QAF8	Phaeocystis_pouchetii_virus	25.1	3.2e-15
WP_000161938.1|997110_998823_-	DNA polymerase/3'-5' exonuclease PolX	NA	A0A2H4UV14	Bodo_saltans_virus	24.0	6.8e-15
>prophage 70
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1003825	1004884	2843306	tRNA	Orpheovirus(100.0%)	1	NA	NA
WP_000003566.1|1003825_1004884_-|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2I2L4E3	Orpheovirus	35.5	1.9e-31
>prophage 71
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1016830	1019738	2843306		uncultured_Mediterranean_phage(50.0%)	5	NA	NA
WP_000401377.1|1016830_1017313_-	pantetheine-phosphate adenylyltransferase	NA	A0A1B1IVQ3	uncultured_Mediterranean_phage	46.2	2.6e-28
WP_173896735.1|1017314_1017857_-	16S rRNA (guanine(966)-N(2))-methyltransferase RsmD	NA	NA	NA	NA	NA
WP_000814565.1|1017926_1018316_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001049150.1|1018318_1018573_-	YlbG family protein	NA	NA	NA	NA	NA
WP_000757575.1|1018811_1019738_+	glycerophosphodiester phosphodiesterase	NA	M1I1K8	Paramecium_bursaria_Chlorella_virus	26.2	2.2e-12
>prophage 72
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1031255	1033103	2843306		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000182653.1|1031255_1033103_-	translational GTPase TypA	NA	A0A2K5B2A5	Erysipelothrix_phage	26.2	1.8e-21
>prophage 73
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1041231	1050064	2843306		Mycoplasma_phage(25.0%)	9	NA	NA
WP_000433551.1|1041231_1042326_-	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	44.3	1.4e-37
WP_001020621.1|1042338_1042878_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000455597.1|1043021_1043297_-	UPF0223 family protein	NA	NA	NA	NA	NA
WP_000260117.1|1043464_1044871_-	dihydrolipoyl dehydrogenase	NA	A0A2K5B2C5	Erysipelothrix_phage	29.1	1.2e-46
WP_000863439.1|1044874_1046167_-	2-oxo acid dehydrogenase subunit E2	NA	NA	NA	NA	NA
WP_000068176.1|1046257_1047235_-	alpha-ketoacid dehydrogenase subunit beta	NA	NA	NA	NA	NA
WP_000035320.1|1047238_1048351_-	pyruvate dehydrogenase (acetyl-transferring) E1 component subunit alpha	NA	A0A0K0KW14	Prochlorococcus_phage	27.8	1.4e-05
WP_000668336.1|1048521_1049148_-	YkyA family protein	NA	NA	NA	NA	NA
WP_000957037.1|1049512_1050064_+	peptide deformylase	NA	E3SLL2	Synechococcus_phage	42.0	1.6e-13
>prophage 74
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1056076	1126434	2843306	protease,transposase,bacteriocin	Bacillus_virus(11.11%)	67	NA	NA
WP_001289618.1|1056076_1056310_+	glutaredoxin-like protein NrdH	NA	G3MBF0	Bacillus_virus	38.7	8.4e-09
WP_000040051.1|1056546_1058265_-	phosphoenolpyruvate--protein phosphotransferase	NA	NA	NA	NA	NA
WP_000437472.1|1058267_1058534_-	phosphocarrier protein HPr	NA	NA	NA	NA	NA
WP_000505966.1|1058687_1059230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000685067.1|1059283_1060456_-	class I SAM-dependent rRNA methyltransferase	NA	W6LLI2	Streptococcus_phage	42.8	4.0e-75
WP_001557163.1|1060844_1062164_-|transposase	ISL3-like element IS1181 family transposase	transposase	NA	NA	NA	NA
WP_000009069.1|1062400_1063696_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000064214.1|1063847_1063982_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000033477.1|1064754_1065330_+	ECF transporter S component	NA	NA	NA	NA	NA
WP_000921965.1|1065344_1066745_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	26.3	1.1e-10
WP_000273253.1|1066737_1067544_+	energy-coupling factor transporter transmembrane protein EcfT	NA	NA	NA	NA	NA
WP_001101899.1|1067810_1069058_-	phosphoribosylamine--glycine ligase	NA	NA	NA	NA	NA
WP_000709277.1|1069079_1070558_-	bifunctional phosphoribosylaminoimidazolecarboxamide formyltransferase/IMP cyclohydrolase	NA	Q58MG4	Prochlorococcus_phage	51.8	3.2e-77
WP_000238669.1|1070572_1071139_-	phosphoribosylglycinamide formyltransferase	NA	M4QRX9	Synechococcus_phage	40.1	6.1e-29
WP_000030811.1|1071141_1072170_-	phosphoribosylformylglycinamidine cyclo-ligase	NA	Q58MH8	Prochlorococcus_phage	41.7	3.4e-62
WP_000483720.1|1072162_1073647_-	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	31.7	1.9e-45
WP_000032740.1|1073625_1075815_-	phosphoribosylformylglycinamidine synthase subunit PurL	NA	A6N228	Microbacterium_phage	39.8	3.5e-141
WP_000666806.1|1075807_1076479_-	phosphoribosylformylglycinamidine synthase I	NA	NA	NA	NA	NA
WP_150344384.1|1076480_1076744_-	phosphoribosylformylglycinamidine synthase subunit PurS	NA	NA	NA	NA	NA
WP_000174053.1|1076743_1077448_-	phosphoribosylaminoimidazolesuccinocarboxamide synthase	NA	M4R1E8	Synechococcus_phage	42.1	7.3e-48
WP_001010413.1|1077451_1078576_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_000861573.1|1078562_1079045_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	A0A2P0VNU7	Tetraselmis_virus	44.7	8.0e-22
WP_000225836.1|1079245_1080106_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	38.8	4.4e-39
WP_001037831.1|1080969_1081287_+	DUF5011 domain-containing protein	NA	NA	NA	NA	NA
WP_031761471.1|1081427_1081553_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000032836.1|1081857_1082958_+	cytochrome aa3 quinol oxidase subunit II	NA	NA	NA	NA	NA
WP_001010762.1|1082957_1084946_+	cytochrome aa3 quinol oxidase subunit I	NA	NA	NA	NA	NA
WP_000017736.1|1084935_1085541_+	cytochrome aa3 quinol oxidase subunit III	NA	NA	NA	NA	NA
WP_001797236.1|1085549_1085828_+	cytochrome aa3 quinol oxidase subunit IV	NA	NA	NA	NA	NA
WP_000671245.1|1086364_1087558_-	teichoic acid D-Ala esterase FmtA	NA	NA	NA	NA	NA
WP_001031978.1|1088008_1089226_+	polyisoprenyl-teichoic acid--peptidoglycan teichoic acid transferase	NA	NA	NA	NA	NA
WP_000088431.1|1089273_1089744_+	DUF2538 family protein	NA	NA	NA	NA	NA
WP_000491986.1|1089898_1090333_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_001074534.1|1090560_1094307_+	bifunctional autolysin	NA	A0A1J0MFB0	Staphylococcus_phage	37.6	1.1e-54
WP_001788579.1|1094376_1094487_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000278015.1|1094513_1094933_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000202433.1|1095085_1096096_+	acyltransferase family protein	NA	NA	NA	NA	NA
WP_000777577.1|1096291_1097446_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_000676539.1|1097973_1099002_+	Glu-specific serine endopeptidase SspA	NA	A0A2H4PQP7	Staphylococcus_phage	32.3	6.3e-16
WP_001089094.1|1099083_1100265_+|protease	cysteine protease staphopain B	protease	NA	NA	NA	NA
WP_000284458.1|1100302_1100632_+	staphostatin B	NA	NA	NA	NA	NA
WP_000184945.1|1100869_1101691_-	1,4-dihydroxy-2-naphthoyl-CoA synthase	NA	NA	NA	NA	NA
WP_000150197.1|1101683_1102487_-	2-succinyl-6-hydroxy-2, 4-cyclohexadiene-1-carboxylate synthase	NA	NA	NA	NA	NA
WP_000526694.1|1102473_1104147_-	2-succinyl-5-enolpyruvyl-6-hydroxy-3- cyclohexene-1-carboxylic-acid synthase	NA	NA	NA	NA	NA
WP_000190622.1|1104133_1105495_-	isochorismate synthase MenF	NA	NA	NA	NA	NA
WP_000070966.1|1105676_1106615_+	1,4-dihydroxy-2-naphthoate polyprenyltransferase	NA	NA	NA	NA	NA
WP_000620949.1|1106666_1107218_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000867357.1|1107382_1107598_+	TM2 domain-containing protein	NA	A0A060AN66	Enterococcus_phage	49.1	1.5e-07
WP_001790177.1|1107661_1107793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001081351.1|1107838_1108798_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_001792054.1|1109731_1109869_-	poly(glycerol-phosphate) alpha-glucosyltransferase	NA	NA	NA	NA	NA
WP_001795266.1|1110009_1110300_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000571167.1|1110387_1111029_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.0	1.7e-19
WP_000668627.1|1111025_1111346_-	YxeA family protein	NA	NA	NA	NA	NA
WP_000870829.1|1111348_1113313_-|bacteriocin	bacteriocin-associated integral membrane family protein	bacteriocin	NA	NA	NA	NA
WP_001797239.1|1113356_1113629_-|bacteriocin	lactococcin 972 family bacteriocin	bacteriocin	NA	NA	NA	NA
WP_001792055.1|1113638_1113740_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001033865.1|1114655_1115258_-|protease	CPBP family intramembrane metalloprotease	protease	NA	NA	NA	NA
WP_000214898.1|1115272_1115449_-	YkvS family protein	NA	NA	NA	NA	NA
WP_000668818.1|1115647_1116634_+	lipoate--protein ligase	NA	NA	NA	NA	NA
WP_000876826.1|1116714_1116933_-	IDEAL domain-containing protein	NA	NA	NA	NA	NA
WP_000287265.1|1117142_1117712_+	competence protein ComK	NA	NA	NA	NA	NA
WP_000414165.1|1118198_1119710_-	bifunctional metallophosphatase/5'-nucleotidase	NA	NA	NA	NA	NA
WP_000021865.1|1119848_1121207_-	TrkH family potassium uptake protein	NA	NA	NA	NA	NA
WP_001795272.1|1121223_1123548_-|protease	serine protease	protease	W5SAB9	Pithovirus	27.4	2.8e-11
WP_000928413.1|1123766_1124570_-	TerC family protein	NA	S5MAL1	Bacillus_phage	40.5	1.6e-30
WP_001049950.1|1124871_1126434_-	peptide chain release factor 3	NA	A0A1S5SF82	Streptococcus_phage	28.2	1.7e-36
>prophage 75
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1145366	1147175	2843306		Streptococcus_phage(100.0%)	1	NA	NA
WP_000082725.1|1145366_1147175_-	oligoendopeptidase F	NA	A0A1X9I5X5	Streptococcus_phage	24.5	5.5e-47
>prophage 76
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1152987	1154957	2843306		Bacillus_virus(100.0%)	2	NA	NA
WP_000427767.1|1152987_1153968_-	dipeptide ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	1.3e-15
WP_001067052.1|1153970_1154957_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	29.6	1.4e-15
>prophage 77
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1158608	1160622	2843306		Organic_Lake_phycodnavirus(50.0%)	2	NA	NA
WP_000786734.1|1158608_1159550_-	ATP-binding cassette domain-containing protein	NA	F2Y1V6	Organic_Lake_phycodnavirus	26.9	1.6e-05
WP_000140050.1|1159539_1160622_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	28.8	8.4e-19
>prophage 78
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1169213	1176023	2843306		Micromonas_sp._RCC1109_virus(33.33%)	4	NA	NA
WP_000619360.1|1169213_1170359_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	26.0	1.5e-05
WP_001047069.1|1170468_1171338_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000353951.1|1171396_1174006_-	ATP-dependent chaperone ClpB	NA	A0A223W0B1	Agrobacterium_phage	34.2	8.0e-116
WP_001044230.1|1174208_1176023_-	acetyltransferase	NA	B5WZU0	Pseudomonas_phage	33.9	6.7e-37
>prophage 79
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1181142	1184796	2843306		Bacillus_phage(100.0%)	1	NA	NA
WP_000154921.1|1181142_1184796_-	helicase-exonuclease AddAB subunit AddA	NA	A7KV33	Bacillus_phage	24.5	2.0e-24
>prophage 80
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1194950	1202132	2843306		Staphylococcus_phage(33.33%)	6	NA	NA
WP_000185319.1|1194950_1195880_+	glycerophosphodiester phosphodiesterase	NA	A0A220BYK6	Staphylococcus_phage	37.9	3.7e-39
WP_000138487.1|1196406_1197651_-	Glu/Leu/Phe/Val dehydrogenase	NA	NA	NA	NA	NA
WP_000167309.1|1197759_1198950_-	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	29.7	1.0e-33
WP_000838029.1|1199257_1200385_-	NADH-dependent flavin oxidoreductase	NA	NA	NA	NA	NA
WP_001067294.1|1200746_1201124_-	S1 RNA-binding domain-containing protein	NA	NA	NA	NA	NA
WP_000035058.1|1201538_1202132_-	peptidylprolyl isomerase	NA	A0A076FI46	Aureococcus_anophage	41.3	1.1e-25
>prophage 81
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1212052	1215680	2843306		Mycoplasma_phage(50.0%)	3	NA	NA
WP_001009692.1|1212052_1213528_-	cytosol aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	34.9	4.5e-47
WP_000046076.1|1213658_1214867_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_001143495.1|1215320_1215680_-	iron-sulfur cluster assembly accessory protein	NA	A0A2H4N7M3	Lake_Baikal_phage	38.6	2.7e-14
>prophage 82
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1219723	1222392	2843306		Pseudomonas_phage(50.0%)	2	NA	NA
WP_000613541.1|1219723_1220938_-	PG:teichoic acid D-alanyltransferase DltB	NA	A0A125RNP0	Pseudomonas_phage	26.1	8.5e-20
WP_000129659.1|1220934_1222392_-	D-alanine--poly(phosphoribitol) ligase subunit DltA	NA	A0A2K9L3I8	Tupanvirus	28.5	2.6e-39
>prophage 83
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1237206	1240729	2843306		environmental_halophage(50.0%)	3	NA	NA
WP_001006450.1|1237206_1238457_-	cysteine desulfurase	NA	Q2XUY6	environmental_halophage	44.8	1.1e-110
WP_000205567.1|1238562_1239870_-	Fe-S cluster assembly protein SufD	NA	NA	NA	NA	NA
WP_000168845.1|1239967_1240729_-	Fe-S cluster assembly ATPase SufC	NA	A0A1V0SE00	Indivirus	23.3	4.4e-06
>prophage 84
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1244216	1245242	2843306		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571213.1|1244216_1245242_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	36.8	9.4e-28
>prophage 85
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1248562	1253761	2843306		Streptococcus_phage(50.0%)	8	NA	NA
WP_000589549.1|1248562_1248919_-	arsenate reductase family protein	NA	M1PLC0	Streptococcus_phage	46.6	4.7e-19
WP_001147952.1|1249062_1249383_+	thioredoxin family protein	NA	A0A1X9I9P5	Staphylococcus_phage	36.4	3.1e-06
WP_000422908.1|1249533_1250073_-	nitroreductase	NA	NA	NA	NA	NA
WP_000150011.1|1250155_1250872_-	type I 3-dehydroquinate dehydratase	NA	W6LP76	Streptococcus_phage	30.1	1.5e-16
WP_000974460.1|1251019_1251442_+	organic hydroperoxide resistance protein	NA	NA	NA	NA	NA
WP_000569883.1|1251840_1252335_+	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000255551.1|1252489_1253107_+	amino acid transporter	NA	NA	NA	NA	NA
WP_001140693.1|1253179_1253761_-	histidine phosphatase family protein	NA	A0A1X9IGJ2	Lactococcus_phage	40.9	5.5e-33
>prophage 86
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1257140	1258384	2843306		Lactococcus_phage(50.0%)	2	NA	NA
WP_001059082.1|1257140_1257341_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	70.8	1.4e-20
WP_000141557.1|1257697_1258384_-	thermonuclease family protein	NA	A0A1P8CWK6	Bacillus_phage	54.2	1.7e-33
>prophage 87
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1267445	1276322	2843306		Staphylococcus_phage(50.0%)	8	NA	NA
WP_000757397.1|1267445_1268174_+	DUF5067 domain-containing protein	NA	H9A0X8	Staphylococcus_phage	37.5	1.3e-18
WP_001058299.1|1268527_1268851_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001085183.1|1270172_1270637_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	98.7	1.6e-80
WP_001050048.1|1270658_1273031_-	ribonuclease R	NA	Q0GXV6	Lactococcus_phage	38.8	4.3e-92
WP_001165959.1|1273064_1273805_-	carboxylesterase	NA	NA	NA	NA	NA
WP_000556760.1|1273920_1274154_-	preprotein translocase subunit SecG	NA	NA	NA	NA	NA
WP_000785252.1|1274220_1274679_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001121760.1|1275017_1276322_-	phosphopyruvate hydratase	NA	W6LP63	Streptococcus_phage	80.7	6.7e-196
>prophage 88
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1285549	1291480	2843306		Streptococcus_phage(40.0%)	5	NA	NA
WP_001049165.1|1285549_1286137_-	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	55.3	8.2e-53
WP_000006551.1|1286700_1287645_-	DNA-binding protein WhiA	NA	Q7AWZ3	Streptococcus_phage	40.6	3.1e-54
WP_001248939.1|1287755_1288751_-	YvcK family protein	NA	A1IMD5	Streptococcus_phage	41.9	4.8e-53
WP_000369722.1|1288747_1289659_-	RNase adapter RapZ	NA	A0A0R8VB27	Thermobifida_phage	36.1	1.1e-08
WP_000134963.1|1290544_1291480_-	thioredoxin-disulfide reductase	NA	G3MA85	Bacillus_virus	49.2	2.9e-84
>prophage 89
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1295927	1298774	2843306		uncultured_Mediterranean_phage(100.0%)	1	NA	NA
WP_000662677.1|1295927_1298774_-	excinuclease ABC subunit UvrA	NA	A0A1B1IVR3	uncultured_Mediterranean_phage	57.2	0.0e+00
>prophage 90
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1302092	1302932	2843306		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000753319.1|1302092_1302932_-	CHAP domain-containing protein	NA	A0A2H4J675	uncultured_Caudovirales_phage	42.2	3.5e-12
>prophage 91
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1309010	1314716	2843306		Streptococcus_phage(66.67%)	5	NA	NA
WP_001557172.1|1309010_1310093_-	DEAD/DEAH box helicase	NA	A0A1X9I5S6	Streptococcus_phage	35.2	9.9e-44
WP_000686344.1|1310456_1311323_-	DegV family protein	NA	NA	NA	NA	NA
WP_000192949.1|1311466_1312108_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	47.7	5.3e-37
WP_000258150.1|1312272_1313328_-	undecaprenyl/decaprenyl-phosphate alpha-N-acetylglucosaminyl 1-phosphate transferase	NA	NA	NA	NA	NA
WP_000460983.1|1313645_1314716_+	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	33.5	1.3e-16
>prophage 92
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1323995	1347468	2843306		uncultured_Caudovirales_phage(35.71%)	19	NA	NA
WP_000616840.1|1323995_1324757_-	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	31.6	6.5e-18
WP_001245577.1|1324753_1325710_-	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4J116	uncultured_Caudovirales_phage	57.8	1.2e-05
WP_000876318.1|1325696_1326668_-	ABC transporter permease	NA	A0A2H4IY97	uncultured_Caudovirales_phage	78.9	4.3e-139
WP_000499195.1|1326706_1326862_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000562498.1|1327042_1328014_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	A0A2H4J4P3	uncultured_Caudovirales_phage	91.3	4.2e-171
WP_000855514.1|1328131_1330237_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	A0A2H4J2N6	uncultured_Caudovirales_phage	91.7	0.0e+00
WP_000692521.1|1330199_1330598_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	A0A2H4J545	uncultured_Caudovirales_phage	72.0	1.2e-52
WP_001068501.1|1331398_1332265_+	DMT family transporter	NA	NA	NA	NA	NA
WP_000930014.1|1332284_1332785_+	NADPH-dependent 7-cyano-7-deazaguanine reductase QueF	NA	E7DN65	Pneumococcus_phage	71.5	5.9e-52
WP_000193751.1|1333125_1334631_+	peptide MFS transporter	NA	A0A0P0IY73	Acinetobacter_phage	32.2	2.0e-58
WP_031760357.1|1334708_1334810_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000429006.1|1334900_1335818_+	diacylglycerol kinase family lipid kinase	NA	A0A1V0SBJ0	Catovirus	22.0	2.1e-07
WP_000197262.1|1336696_1337239_-	5'-3'-deoxyribonucleotidase	NA	NA	NA	NA	NA
WP_000663030.1|1337577_1338636_-	histidinol-phosphate transaminase	NA	A0A1X6WGT4	Pacmanvirus	26.7	7.9e-22
WP_000180991.1|1338875_1340390_-	ABC transporter permease/substrate-binding protein	NA	NA	NA	NA	NA
WP_000589247.1|1340382_1341360_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.3	5.4e-25
WP_000983677.1|1341581_1343363_-	DNA helicase RecQ	NA	A0A2P1EM61	Moumouvirus	37.0	6.5e-77
WP_000525106.1|1343374_1345258_-	ABC-F family ATP-binding cassette domain-containing protein	NA	A0A2K9L3Z8	Tupanvirus	30.6	2.0e-55
WP_000098285.1|1345527_1347468_-	polyglycerol-phosphate lipoteichoic acid synthase LtaS	NA	W6LM83	Streptococcus_phage	39.5	1.3e-110
>prophage 93
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1350607	1360454	2843306		Pandoravirus(12.5%)	12	NA	NA
WP_001217796.1|1350607_1351759_-	anthranilate synthase component I family protein	NA	S4VNU7	Pandoravirus	35.7	6.0e-23
WP_000604514.1|1351742_1352336_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	42.9	4.4e-38
WP_000446724.1|1352686_1353355_+	7-cyano-7-deazaguanine synthase QueC	NA	A0A2H4J8Q7	uncultured_Caudovirales_phage	57.5	9.6e-66
WP_000941336.1|1353356_1353776_+	6-carboxytetrahydropterin synthase QueD	NA	S4U060	uncultured_phage	28.7	6.3e-07
WP_001062972.1|1353779_1354493_+	7-carboxy-7-deazaguanine synthase QueE	NA	A0A1U9WRB6	Streptococcus_virus	43.5	6.5e-52
WP_000604990.1|1354591_1355176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001093562.1|1355455_1355896_+	DM13 domain-containing protein	NA	NA	NA	NA	NA
WP_001037807.1|1356238_1356712_+	DoxX family protein	NA	NA	NA	NA	NA
WP_000149344.1|1356686_1357373_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_000244415.1|1357372_1358428_+	two-component system sensor histidine kinase SaeS	NA	A0A1V0SGX0	Hokovirus	29.8	3.6e-14
WP_000702781.1|1358499_1359483_-	lipoteichoic acid-specific glycosylation protein CsbB	NA	A0A192Y8W7	Salmonella_phage	43.3	1.5e-62
WP_000931238.1|1359614_1360454_-	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	41.5	9.6e-55
>prophage 94
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1372070	1373444	2843306		Powai_lake_megavirus(100.0%)	1	NA	NA
WP_000952038.1|1372070_1373444_-	deoxyribodipyrimidine photo-lyase	NA	A0A167RC11	Powai_lake_megavirus	33.6	2.3e-45
>prophage 95
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1378421	1384701	2843306		Bacillus_phage(33.33%)	6	NA	NA
WP_000857598.1|1378421_1380095_-	amino acid ABC transporter ATP-binding/permease protein	NA	W8CYL7	Bacillus_phage	23.2	3.4e-11
WP_000737160.1|1380091_1381723_-	ABC transporter ATP-binding protein/permease	NA	W5SAS9	Pithovirus	27.8	6.7e-12
WP_000469894.1|1381941_1382817_+	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_000358498.1|1382988_1383672_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000148826.1|1383674_1384133_+	YaiI/YqxD family protein	NA	NA	NA	NA	NA
WP_000820897.1|1384134_1384701_+	TIGR00730 family Rossman fold protein	NA	A0A1G5S9X4	Enterococcus_phage	36.9	4.7e-21
>prophage 96
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1391491	1391965	2843306		Pandoravirus(100.0%)	1	NA	NA
WP_000833486.1|1391491_1391965_-	cupin domain-containing protein	NA	A0A291AU44	Pandoravirus	39.4	1.6e-14
>prophage 97
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1397227	1398025	2843306		Bacillus_phage(100.0%)	1	NA	NA
WP_000731644.1|1397227_1398025_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A223LD43	Bacillus_phage	30.2	1.2e-06
>prophage 98
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1404376	1405138	2843306		Planktothrix_phage(100.0%)	1	NA	NA
WP_000985996.1|1404376_1405138_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	34.8	7.2e-33
>prophage 99
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1409512	1410556	2843306		Acanthamoeba_polyphaga_mimivirus(100.0%)	1	NA	NA
WP_001030772.1|1409512_1410556_-	alpha/beta hydrolase	NA	A0A0G2YDK2	Acanthamoeba_polyphaga_mimivirus	26.6	2.0e-17
>prophage 100
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1417079	1417877	2843306		Planktothrix_phage(100.0%)	1	NA	NA
WP_001080809.1|1417079_1417877_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	30.7	1.1e-18
>prophage 101
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1421102	1425061	2843306		Bacillus_phage(33.33%)	3	NA	NA
WP_000817954.1|1421102_1422830_-	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	43.3	9.7e-110
WP_000793067.1|1423250_1424546_+	D-alanyl-D-alanine carboxypeptidase	NA	B6DZZ7	Stx2-converting_phage	26.9	2.0e-14
WP_000832260.1|1424662_1425061_-	glycerol-3-phosphate cytidylyltransferase	NA	A0A222YWT0	Streptomyces_phage	39.9	3.2e-16
>prophage 102
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1431995	1432739	2843306		Indivirus(100.0%)	1	NA	NA
WP_000894464.1|1431995_1432739_+	metal ABC transporter ATP-binding protein	NA	A0A1V0SE00	Indivirus	29.7	1.2e-11
>prophage 103
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1445277	1445838	2843306	integrase	Streptococcus_phage(100.0%)	1	1439431:1439445	1449428:1449442
1439431:1439445	attL	TTTTGATACCATTTC	NA	NA	NA	NA
WP_001044915.1|1445277_1445838_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
WP_001044915.1|1445277_1445838_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A141E172	Streptococcus_phage	35.1	5.7e-19
1449428:1449442	attR	TTTTGATACCATTTC	NA	NA	NA	NA
>prophage 104
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1458666	1462020	2843306		Tupanvirus(50.0%)	3	NA	NA
WP_001200748.1|1458666_1459677_-	alcohol dehydrogenase AdhP	NA	A0A2K9L339	Tupanvirus	27.3	5.6e-33
WP_001792725.1|1460175_1460697_-	YwhD family protein	NA	NA	NA	NA	NA
WP_000180234.1|1460724_1462020_-	HD domain-containing protein	NA	E3T4P8	Cafeteria_roenbergensis_virus	27.9	1.2e-24
>prophage 105
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1469592	1470915	2843306		Erysipelothrix_phage(100.0%)	1	NA	NA
WP_000860592.1|1469592_1470915_+	FAD-containing oxidoreductase	NA	A0A2K5B2C5	Erysipelothrix_phage	46.8	2.6e-107
>prophage 106
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1482219	1482876	2843306		Elephant_endotheliotropic_herpesvirus(100.0%)	1	NA	NA
WP_000455256.1|1482219_1482876_-	uracil-DNA glycosylase	NA	U5U4C1	Elephant_endotheliotropic_herpesvirus	46.4	1.1e-45
>prophage 107
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1486517	1489838	2843306		Staphylococcus_phage(50.0%)	2	NA	NA
WP_001100846.1|1486517_1487894_-	long-chain fatty acid--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	24.2	1.1e-20
WP_173896743.1|1488437_1489838_-	MFS transporter	NA	Q6JIH2	Burkholderia_virus	32.8	9.4e-55
>prophage 108
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1513126	1513789	2843306		Enterococcus_phage(100.0%)	1	NA	NA
WP_001067261.1|1513126_1513789_+	deoxynucleoside kinase	NA	A0A0M3UL55	Enterococcus_phage	37.4	1.4e-24
>prophage 109
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1520371	1521559	2843306		Emiliania_huxleyi_virus(100.0%)	1	NA	NA
WP_000250823.1|1520371_1521559_-	glycine C-acetyltransferase	NA	V5LQ39	Emiliania_huxleyi_virus	30.6	4.4e-45
>prophage 110
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1524587	1535541	2843306		Streptococcus_phage(33.33%)	6	NA	NA
WP_000090315.1|1524587_1526669_-	elongation factor G	NA	E4ZFJ7	Streptococcus_phage	28.3	2.7e-66
WP_001137495.1|1526791_1527262_-	30S ribosomal protein S7	NA	NA	NA	NA	NA
WP_001142337.1|1527327_1527741_-	30S ribosomal protein S12	NA	NA	NA	NA	NA
WP_000031892.1|1527838_1528093_-	ribosomal L7Ae/L30e/S12e/Gadd45 family protein	NA	NA	NA	NA	NA
WP_001788197.1|1528229_1531826_-	DNA-directed RNA polymerase subunit beta'	NA	R4TQM7	Phaeocystis_globosa_virus	24.6	3.3e-67
WP_000918667.1|1531989_1535541_-	DNA-directed RNA polymerase subunit beta	NA	A0A1B1ISA9	uncultured_Mediterranean_phage	24.3	2.1e-50
>prophage 111
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1539223	1544006	2843306	tRNA	Bacillus_virus(50.0%)	8	NA	NA
WP_001288302.1|1539223_1539772_-	transcription termination/antitermination protein NusG	NA	G3MAW2	Bacillus_virus	33.5	8.6e-12
WP_001074473.1|1539784_1539967_-	preprotein translocase subunit SecE	NA	NA	NA	NA	NA
WP_001788193.1|1540022_1540166_-	50S ribosomal protein L33	NA	NA	NA	NA	NA
WP_000872882.1|1540280_1540850_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_000664737.1|1540930_1541455_-	NYN domain-containing protein	NA	NA	NA	NA	NA
WP_000390332.1|1541454_1542201_-	23S rRNA (guanosine(2251)-2'-O)-methyltransferase RlmB	NA	NA	NA	NA	NA
WP_000370182.1|1542208_1542613_-	Mini-ribonuclease 3	NA	NA	NA	NA	NA
WP_000631969.1|1542605_1544006_-|tRNA	cysteine--tRNA ligase	tRNA	A0A1V0SAQ2	Catovirus	31.8	1.2e-54
>prophage 112
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1550017	1552474	2843306	protease	Escherichia_phage(100.0%)	1	NA	NA
WP_000897132.1|1550017_1552474_-|protease	ATP-dependent Clp protease ATP-binding subunit	protease	A0A1C3S747	Escherichia_phage	41.2	1.4e-133
>prophage 113
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1571341	1581612	2843306	tRNA	Catovirus(16.67%)	10	NA	NA
WP_001288202.1|1571341_1572829_-|tRNA	lysine--tRNA ligase	tRNA	A0A1V0SAC0	Catovirus	41.1	2.1e-92
WP_001790128.1|1572881_1572974_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000613722.1|1573367_1573844_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_001154302.1|1573840_1574206_-	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_000167944.1|1574183_1574987_-	dihydropteroate synthase	NA	A0A0B5J4J5	Pandoravirus	29.0	3.0e-21
WP_000057594.1|1575202_1576135_-	cysteine synthase A	NA	A0A1X9I5K7	Streptococcus_phage	65.7	3.7e-108
WP_000148598.1|1576313_1577195_-	Hsp33 family molecular chaperone HslO	NA	NA	NA	NA	NA
WP_001167883.1|1577422_1579516_-	ATP-dependent metallopeptidase FtsH/Yme1/Tma family protein	NA	E5EQ50	Micromonas_sp._RCC1109_virus	42.7	1.2e-109
WP_000551283.1|1579772_1580312_-	hypoxanthine phosphoribosyltransferase	NA	A0A218MMB5	uncultured_virus	29.8	6.5e-12
WP_001176709.1|1580316_1581612_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	A0A1V0SI91	Klosneuvirus	24.5	4.8e-13
>prophage 114
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1590868	1593333	2843306		Hokovirus(50.0%)	2	NA	NA
WP_000933774.1|1590868_1591834_-	ribose-phosphate diphosphokinase	NA	A0A1V0SHF7	Hokovirus	35.4	6.1e-45
WP_001252543.1|1591980_1593333_-	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A2K9L821	Tupanvirus	30.4	8.3e-24
>prophage 115
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1599238	1602336	2843306	tRNA	Klosneuvirus(50.0%)	2	NA	NA
WP_001051136.1|1599238_1601212_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SHR2	Klosneuvirus	36.0	3.2e-93
WP_000279926.1|1601496_1602336_-	16S rRNA (cytidine(1402)-2'-O)-methyltransferase	NA	M1PLC5	Streptococcus_phage	45.8	2.7e-57
>prophage 116
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1606242	1606860	2843306		Streptococcus_phage(100.0%)	1	NA	NA
WP_001272126.1|1606242_1606860_-	dTMP kinase	NA	M1PSC7	Streptococcus_phage	48.3	9.2e-47
>prophage 117
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1615721	1617419	2843306		Streptococcus_virus(100.0%)	1	NA	NA
WP_001109040.1|1615721_1617419_-	DNA polymerase III subunit gamma/tau	NA	A0A1U9WR94	Streptococcus_virus	42.3	1.9e-54
>prophage 118
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1634067	1640307	2843306		Lactobacillus_phage(33.33%)	6	NA	NA
WP_001170264.1|1634067_1635072_-	autolysin/adhesin Aaa	NA	A0A0A7NU10	Lactobacillus_phage	41.2	1.6e-24
WP_000825530.1|1635403_1636246_-	dipeptide ABC transporter glycylmethionine-binding lipoprotein	NA	NA	NA	NA	NA
WP_000467994.1|1636282_1636942_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_000569281.1|1636945_1637971_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.3	3.7e-32
WP_001036648.1|1638266_1639409_-	bifunctional cystathionine gamma-lyase/homocysteine desulfhydrase	NA	NA	NA	NA	NA
WP_000634098.1|1639401_1640307_-	cysteine synthase family protein	NA	A0A1W6JIM2	Lactococcus_phage	39.7	3.8e-49
>prophage 119
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1666253	1669014	2843306		Staphylococcus_phage(100.0%)	2	NA	NA
WP_000072584.1|1666253_1667465_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	35.2	2.2e-44
WP_000028659.1|1667457_1669014_-	type I restriction-modification system subunit M	NA	A0A2H4PQP4	Staphylococcus_phage	99.4	2.3e-288
>prophage 120
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1681551	1687000	2843306	transposase	Paenibacillus_phage(25.0%)	5	NA	NA
WP_000159787.1|1681551_1681824_+|transposase	transposase	transposase	A0A0C5AJ30	Paenibacillus_phage	50.6	1.3e-13
WP_000041880.1|1682222_1682927_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	U5U4R0	Staphylococcus_phage	37.1	5.8e-29
WP_000551643.1|1683318_1683855_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000424963.1|1683967_1685509_-	glutamine-hydrolyzing GMP synthase	NA	A0A1V0SH76	Hokovirus	32.6	1.2e-23
WP_000264071.1|1685533_1687000_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	40.5	5.2e-96
>prophage 121
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1695960	1697484	2843306		Enterococcus_phage(100.0%)	1	NA	NA
WP_000930514.1|1695960_1697484_+	alkyl hydroperoxide reductase subunit F	NA	A0A249XZT7	Enterococcus_phage	33.6	1.4e-40
>prophage 122
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1705798	1712127	2843306		Staphylococcus_phage(50.0%)	8	NA	NA
WP_000934799.1|1705798_1706302_-	single-stranded DNA-binding protein	NA	A0A1W6JPL9	Staphylococcus_phage	74.7	1.2e-60
WP_001261460.1|1706322_1706619_-	30S ribosomal protein S6	NA	NA	NA	NA	NA
WP_001052484.1|1706862_1707054_+	hypothetical protein	NA	U3PCX8	Staphylococcus_phage	80.0	1.1e-22
WP_001218732.1|1707139_1708237_-	redox-regulated ATPase YchF	NA	NA	NA	NA	NA
WP_000157348.1|1708248_1708452_-	DUF951 domain-containing protein	NA	NA	NA	NA	NA
WP_000373073.1|1708481_1709363_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_001557587.1|1709516_1710362_-	ParB/RepB/Spo0J family partition protein	NA	A0A1C9EHW0	Gordonia_phage	34.4	1.6e-12
WP_000655692.1|1711023_1712127_+	aminotransferase class I/II-fold pyridoxal phosphate-dependent enzyme	NA	A0A0B5JD48	Pandoravirus	28.0	3.9e-11
>prophage 123
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1722065	1722908	2843306		Anomala_cuprea_entomopoxvirus(100.0%)	1	NA	NA
WP_000209551.1|1722065_1722908_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	27.2	3.8e-11
>prophage 124
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1744217	1746952	2843306		Bodo_saltans_virus(50.0%)	3	NA	NA
WP_000280799.1|1744217_1745240_-	lipoate--protein ligase	NA	A0A2H4UVX5	Bodo_saltans_virus	30.4	6.7e-10
WP_001191954.1|1745217_1746162_-	NAD-dependent deacetylase	NA	NA	NA	NA	NA
WP_000449069.1|1746151_1746952_-	protein-ADP-ribose hydrolase	NA	A0A2K9L8X2	Tupanvirus	43.4	5.8e-41
>prophage 125
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1765189	1765867	2843306		Planktothrix_phage(100.0%)	1	NA	NA
WP_000911017.1|1765189_1765867_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.9	1.6e-31
>prophage 126
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1778407	1782847	2843306		Mycobacterium_phage(100.0%)	1	NA	NA
WP_000549287.1|1778407_1782847_-	type VII secretion protein EssC	NA	V5UPA0	Mycobacterium_phage	25.6	6.3e-28
>prophage 127
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1793452	1795114	2843306		Amsacta_moorei_entomopoxvirus(50.0%)	2	NA	NA
WP_000570070.1|1793452_1794112_+	ABC transporter ATP-binding protein	NA	Q9EMR9	Amsacta_moorei_entomopoxvirus	37.2	7.6e-23
WP_000736784.1|1794163_1795114_-	glycine-glycine endopeptidase LytM	NA	V5R8R0	Arthrobacter_phage	42.7	1.5e-16
>prophage 128
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1803802	1805239	2843306		Pandoravirus(100.0%)	1	NA	NA
WP_000164003.1|1803802_1805239_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.7	1.1e-29
>prophage 129
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1808999	1813538	2843306		Enterobacteria_phage(50.0%)	3	NA	NA
WP_000950281.1|1808999_1810754_-	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	31.5	9.0e-63
WP_000608818.1|1810998_1811673_-	iron-sulfur cluster repair di-iron protein ScdA	NA	NA	NA	NA	NA
WP_000975351.1|1811816_1813538_-	poly(ribitol-phosphate) beta-N-acetylglucosaminyltransferase	NA	A0A1V0SAH6	Catovirus	37.4	2.1e-11
>prophage 130
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1822865	1823909	2843306		Synechococcus_phage(100.0%)	1	NA	NA
WP_000645608.1|1822865_1823909_-	galactitol-1-phosphate 5-dehydrogenase	NA	E3SJ82	Synechococcus_phage	24.9	3.5e-14
>prophage 131
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1831123	1832653	2843306		Vibrio_phage(100.0%)	1	NA	NA
WP_000838205.1|1831123_1832653_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	50.7	4.5e-10
>prophage 132
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1841528	1843034	2843306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001008400.1|1841528_1843034_+	acyl--CoA ligase	NA	A0A2H4PQM9	Staphylococcus_phage	25.9	6.0e-39
>prophage 133
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1854141	1859500	2843306		Tetraselmis_virus(50.0%)	3	NA	NA
WP_000894660.1|1854141_1856391_-	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	45.1	1.7e-186
WP_000837116.1|1856978_1857947_+	extracellular solute-binding protein	NA	NA	NA	NA	NA
WP_000127990.1|1857943_1859500_+	sensor histidine kinase	NA	Q9EYF3	Enterobacteria_phage	27.2	5.8e-13
>prophage 134
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1869710	1871770	2843306		Planktothrix_phage(50.0%)	2	NA	NA
WP_000818915.1|1869710_1870808_-	sn-glycerol-3-phosphate ABC transporter ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	35.6	1.4e-24
WP_000166920.1|1871191_1871770_-	M23 family metallopeptidase	NA	A0A2K9VGT1	Pontimonas_phage	39.1	9.7e-14
>prophage 135
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1880319	1883507	2843306		Planktothrix_phage(33.33%)	3	NA	NA
WP_000067352.1|1880319_1881912_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	33.6	4.1e-22
WP_000794565.1|1882421_1882619_-	helix-turn-helix transcriptional regulator	NA	A0A1V0E021	Clostridioides_phage	43.3	2.1e-05
WP_000960712.1|1882784_1883507_-	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	34.8	4.1e-22
>prophage 136
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1887379	1888060	2843306		Planktothrix_phage(100.0%)	1	NA	NA
WP_000571407.1|1887379_1888060_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.0	2.9e-33
>prophage 137
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1904865	1906050	2843306		Klosneuvirus(100.0%)	1	NA	NA
WP_001084442.1|1904865_1906050_+	ornithine--oxo-acid transaminase	NA	A0A1V0SKB7	Klosneuvirus	28.9	2.0e-34
>prophage 138
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1910886	1921170	2843306		Tupanvirus(50.0%)	3	NA	NA
WP_000605281.1|1910886_1918062_-	amino acid adenylation domain-containing protein	NA	A0A2K9KZV5	Tupanvirus	29.7	4.5e-68
WP_000826861.1|1918508_1919759_-	MFS transporter	NA	NA	NA	NA	NA
WP_000706135.1|1920144_1921170_-	NAD-dependent formate dehydrogenase	NA	A0A1V0SBV6	Catovirus	33.5	8.5e-29
>prophage 139
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1924706	1927878	2843306		Bacillus_virus(50.0%)	4	NA	NA
WP_000590854.1|1924706_1925447_-	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	40.1	2.5e-38
WP_000171919.1|1925788_1926301_-	DUF4242 domain-containing protein	NA	NA	NA	NA	NA
WP_173896752.1|1926479_1926683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001013485.1|1926918_1927878_-	cation transporter	NA	A0A1V0SED0	Indivirus	34.2	1.2e-11
>prophage 140
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1931219	1933704	2843306		Catovirus(50.0%)	2	NA	NA
WP_000723436.1|1931219_1932365_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	25.9	4.6e-23
WP_000779504.1|1932441_1933704_-	nucleotide sugar dehydrogenase	NA	A0A127AXI2	Bacillus_phage	25.5	4.3e-22
>prophage 141
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1940539	1947104	2843306		Catovirus(50.0%)	6	NA	NA
WP_000413171.1|1940539_1941664_-	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SJE0	Klosneuvirus	59.6	6.7e-128
WP_001028283.1|1941667_1942777_-	capsular polysaccharide biosynthesis protein CapF	NA	NA	NA	NA	NA
WP_000459062.1|1942789_1943818_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	35.3	1.1e-41
WP_000940790.1|1943807_1945631_-	polysaccharide biosynthesis protein	NA	A0A1V0SAI8	Catovirus	29.1	5.2e-29
WP_000565304.1|1945650_1946415_-	tyrosine-protein phosphatase	NA	NA	NA	NA	NA
WP_000037332.1|1946417_1947104_-	tyrosine-protein kinase	NA	A0A1X9I5D6	Streptococcus_phage	36.1	3.7e-28
>prophage 142
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1951124	1952300	2843306		Clostridium_phage(100.0%)	1	NA	NA
WP_000469833.1|1951124_1952300_-	ImmA/IrrE family metallo-endopeptidase	NA	A0A0A7RTT7	Clostridium_phage	27.6	2.0e-29
>prophage 143
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1957739	1958513	2843306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000078092.1|1957739_1958513_+	phosphonate ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	26.1	3.8e-13
>prophage 144
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1966544	1967144	2843306		Bacillus_thuringiensis_phage(100.0%)	1	NA	NA
WP_000874681.1|1966544_1967144_-	superoxide dismutase	NA	Q56AR7	Bacillus_thuringiensis_phage	50.2	7.6e-54
>prophage 145
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1972081	1977178	2843306		Catovirus(50.0%)	6	NA	NA
WP_001793242.1|1972081_1973062_-	NAD-dependent epimerase/dehydratase family protein	NA	A0A1V0SAI6	Catovirus	37.0	1.0e-47
WP_001789407.1|1973131_1973254_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000183771.1|1973397_1974174_-	(S)-acetoin forming diacetyl reductase	NA	NA	NA	NA	NA
WP_000414629.1|1974385_1975012_-	MFS transporter	NA	NA	NA	NA	NA
WP_001015549.1|1975207_1975972_-	bifunctional transcriptional regulator/O-phospho-L-serine synthase SbnI	NA	NA	NA	NA	NA
WP_001223713.1|1975975_1977178_-	staphyloferrin B biosynthesis decarboxylase SbnH	NA	A0A2K9L4I2	Tupanvirus	21.1	3.9e-09
>prophage 146
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	1985444	1989654	2843306		Lactococcus_phage(50.0%)	4	NA	NA
WP_000570808.1|1985444_1986425_-	2,3-diaminopropionate biosynthesis protein SbnA	NA	A0A1W6JHY1	Lactococcus_phage	35.6	2.1e-40
WP_001045111.1|1986655_1987648_+	staphyloferrin B ABC transporter substrate-binding protein SirA	NA	NA	NA	NA	NA
WP_000924990.1|1987663_1988659_+	staphyloferrin B ABC transporter permease subunit SirB	NA	NA	NA	NA	NA
WP_000136633.1|1988655_1989654_+	staphyloferrin B ABC transporter permease subunit SirC	NA	A0A2H4IY97	uncultured_Caudovirales_phage	27.8	5.2e-15
>prophage 147
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2022756	2023821	2843306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000816133.1|2022756_2023821_-	persulfide response sulfurtransferase CstA	NA	A0A2H4PQR9	Staphylococcus_phage	41.8	7.7e-09
>prophage 148
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2034509	2041163	2843306		Streptococcus_phage(50.0%)	4	NA	NA
WP_000852430.1|2034509_2036531_-	K(+)-transporting ATPase subunit B	NA	E4ZFI9	Streptococcus_phage	29.0	6.6e-41
WP_000029430.1|2036549_2038226_-	potassium-transporting ATPase subunit A	NA	NA	NA	NA	NA
WP_000631574.1|2038246_2038327_-	K(+)-transporting ATPase subunit F	NA	NA	NA	NA	NA
WP_000446429.1|2038493_2041163_+	sensor histidine kinase KdpD	NA	A0A2K9L0Z8	Tupanvirus	21.5	6.0e-10
>prophage 149
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2048945	2050295	2843306		Bacillus_phage(100.0%)	1	NA	NA
WP_000815646.1|2048945_2050295_+	recombinase family protein	NA	Q9T200	Bacillus_phage	25.1	1.4e-18
>prophage 150
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2056030	2057233	2843306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001631029.1|2056030_2057233_-	restriction endonuclease subunit S	NA	A0A2H4PQP5	Staphylococcus_phage	34.5	6.2e-39
>prophage 151
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2060963	2070973	2843306		Bacillus_phage(40.0%)	7	NA	NA
WP_000088649.1|2060963_2061764_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	35.9	1.0e-37
WP_001104165.1|2062152_2062941_-	two-component system regulatory protein YycI	NA	NA	NA	NA	NA
WP_001060140.1|2062941_2064276_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000871607.1|2064268_2066095_-	cell wall metabolism sensor histidine kinase WalK	NA	W8CYF6	Bacillus_phage	31.3	1.6e-30
WP_000101976.1|2066107_2066809_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	39.2	3.5e-42
WP_000095328.1|2068011_2069295_-	adenylosuccinate synthase	NA	L7Y4J5	Megavirus	34.6	1.8e-68
WP_000375647.1|2069572_2070973_-	replicative DNA helicase	NA	A0A1P8VVQ6	Streptococcus_phage	48.1	5.4e-111
>prophage 152
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2077663	2086709	2843306	tRNA	Bacillus_virus(50.0%)	5	NA	NA
WP_000884332.1|2077663_2078950_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	50.9	4.5e-88
WP_000177465.1|2079328_2080843_-	histidine ammonia-lyase	NA	A0A1V0S940	Catovirus	38.4	1.2e-90
WP_000449218.1|2081168_2081981_+	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_000819059.1|2082068_2084738_-	DNA gyrase subunit A	NA	G3M9Z5	Bacillus_virus	35.9	3.6e-119
WP_000255578.1|2084774_2086709_-	DNA topoisomerase (ATP-hydrolyzing) subunit B	NA	G3M9Z3	Bacillus_virus	44.9	5.7e-143
>prophage 153
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2096809	2103366	2843306		Faecalibacterium_phage(25.0%)	8	NA	NA
WP_000742837.1|2096809_2097649_+	nucleoid occlusion protein	NA	A0A2K9V477	Faecalibacterium_phage	23.8	2.2e-06
WP_000491382.1|2098099_2098453_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_000779134.1|2098520_2098916_+	DUF3147 family protein	NA	NA	NA	NA	NA
WP_001054128.1|2099175_2099745_+	helix-turn-helix transcriptional regulator	NA	D2XQ11	Bacillus_virus	33.3	6.2e-05
WP_001059079.1|2099862_2100063_-	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	69.8	3.4e-19
WP_000672033.1|2100454_2100646_-	peptide resistance ABC transporter activity modulator VraH	NA	NA	NA	NA	NA
WP_000143647.1|2100737_2102618_-	peptide resistance ABC transporter permease subunit VraE	NA	NA	NA	NA	NA
WP_000154162.1|2102607_2103366_-	peptide resistance ABC transporter ATP-binding subunit VraD	NA	G9BWD6	Planktothrix_phage	39.5	9.0e-36
>prophage 154
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2117619	2119332	2843306		Planktothrix_phage(100.0%)	1	NA	NA
WP_000138654.1|2117619_2119332_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.3	1.4e-20
>prophage 155
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2124960	2125974	2843306		Faustovirus(100.0%)	1	NA	NA
WP_000639184.1|2124960_2125974_+	histidinol-phosphate aminotransferase family protein	NA	A0A1X7QHI1	Faustovirus	25.9	9.6e-09
>prophage 156
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2138311	2139004	2843306		Streptococcus_phage(100.0%)	1	NA	NA
WP_000185863.1|2138311_2139004_+	polysaccharide biosynthesis tyrosine autokinase	NA	A0A1X9I5D6	Streptococcus_phage	38.0	2.2e-28
>prophage 157
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2165102	2166962	2843306		Enterococcus_phage(100.0%)	1	NA	NA
WP_001125628.1|2165102_2166962_-	amidase domain-containing protein	NA	A0A249Y0X5	Enterococcus_phage	37.3	9.7e-15
>prophage 158
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2192645	2194396	2843306		Ectocarpus_siliculosus_virus(50.0%)	2	NA	NA
WP_000143425.1|2192645_2193533_+	nisin susceptibility-associated two-component system sensor histidine kinase NsaS	NA	Q8QNA2	Ectocarpus_siliculosus_virus	22.5	2.5e-05
WP_000923760.1|2193640_2194396_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	37.9	3.0e-31
>prophage 159
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2197816	2198314	2843306		Canarypox_virus(100.0%)	1	NA	NA
WP_001065268.1|2197816_2198314_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	33.1	1.8e-21
>prophage 160
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2203308	2205692	2843306		Enterococcus_phage(100.0%)	2	NA	NA
WP_001071729.1|2203308_2205159_+	anaerobic ribonucleoside-triphosphate reductase	NA	A0A0C5KKX3	Enterococcus_phage	64.3	9.3e-236
WP_000173331.1|2205155_2205692_+	anaerobic ribonucleoside-triphosphate reductase activating protein	NA	A0A288TZV3	Enterococcus_phage	48.0	3.9e-41
>prophage 161
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2210570	2220684	2843306	holin	Klosneuvirus(50.0%)	9	NA	NA
WP_000066521.1|2210570_2212280_+|holin	choline dehydrogenase	holin	A0A1V0SI18	Klosneuvirus	32.3	3.8e-58
WP_000011688.1|2212557_2212770_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001028775.1|2213049_2213493_+	antibiotic biosynthesis monooxygenase	NA	NA	NA	NA	NA
WP_001172341.1|2213686_2215285_+	AMP-binding protein	NA	A0A2H4PQU7	Staphylococcus_phage	36.8	5.3e-78
WP_001791980.1|2215344_2215674_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001130051.1|2215969_2217466_+	malate dehydrogenase (quinone)	NA	NA	NA	NA	NA
WP_001031409.1|2217659_2218550_-	fructose bisphosphate aldolase	NA	A0A0K0KVJ8	Prochlorococcus_phage	29.2	1.2e-07
WP_001237629.1|2218672_2219089_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000030069.1|2219346_2220684_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.4	8.8e-18
>prophage 162
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2251017	2254806	2843306		Staphylococcus_phage(50.0%)	2	NA	NA
WP_000751263.1|2251017_2251719_+	lytic transglycosylase IsaA	NA	Q4Z8Z7	Staphylococcus_phage	46.4	5.2e-38
WP_000379821.1|2252994_2254806_+	acetyltransferase	NA	A0A1R3Y5Q6	Salmonella_virus	31.5	1.3e-35
>prophage 163
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2263240	2267355	2843306		Acanthocystis_turfacea_Chlorella_virus(50.0%)	3	NA	NA
WP_000161369.1|2263240_2264239_+	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	30.2	1.0e-34
WP_000076661.1|2264329_2264536_-	copper chaperone CopZ	NA	NA	NA	NA	NA
WP_000024139.1|2264946_2267355_-	copper-translocating P-type ATPase	NA	A0A218MNH6	uncultured_virus	40.8	3.2e-127
>prophage 164
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2276596	2279632	2843306	protease	Enterobacteria_phage(50.0%)	2	NA	NA
WP_001058993.1|2276596_2278702_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpL	protease	H6X3M6	Enterobacteria_phage	38.5	3.1e-118
WP_000455988.1|2279110_2279632_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	M1PFU9	Streptococcus_phage	41.1	2.0e-26
>prophage 165
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2286058	2292442	2843306		Yellowstone_lake_phycodnavirus(33.33%)	5	NA	NA
WP_001062663.1|2286058_2287798_+	pyruvate oxidase	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	24.1	6.0e-35
WP_000473679.1|2288098_2290165_+	PTS transporter subunit EIIC	NA	A0A2I7SAJ6	Vibrio_phage	43.3	8.3e-07
WP_000206031.1|2290544_2290955_+	acyl-CoA thioesterase	NA	NA	NA	NA	NA
WP_000240663.1|2290996_2291353_+	thioredoxin family protein	NA	NA	NA	NA	NA
WP_001228167.1|2291473_2292442_+	alpha/beta hydrolase	NA	A0A167RJ59	Powai_lake_megavirus	26.5	4.0e-12
>prophage 166
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2301731	2302724	2843306		Acanthocystis_turfacea_Chlorella_virus(100.0%)	1	NA	NA
WP_000161545.1|2301731_2302724_-	D-lactate dehydrogenase	NA	M1HKI4	Acanthocystis_turfacea_Chlorella_virus	32.7	3.7e-37
>prophage 167
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2312004	2312700	2843306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000538625.1|2312004_2312700_-	ATP-binding cassette domain-containing protein	NA	A0A2H4PQG7	Staphylococcus_phage	37.6	3.0e-38
>prophage 168
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2331492	2332359	2843306		Bacillus_phage(100.0%)	1	NA	NA
WP_000721336.1|2331492_2332359_+	UTP--glucose-1-phosphate uridylyltransferase GalU	NA	A0A127AW70	Bacillus_phage	52.6	1.3e-78
>prophage 169
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2340160	2345356	2843306		Streptococcus_phage(50.0%)	3	NA	NA
WP_075339662.1|2340160_2341969_-	phospho-sugar mutase	NA	A0A1X9I671	Streptococcus_phage	37.3	6.6e-93
WP_000755947.1|2342100_2342493_+	(deoxy)nucleoside triphosphate pyrophosphohydrolase	NA	NA	NA	NA	NA
WP_000088733.1|2342494_2345356_+	DUF3427 domain-containing protein	NA	Q5YA94	Bacillus_phage	27.9	3.1e-28
>prophage 170
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2353198	2353894	2843306		Bacillus_phage(100.0%)	1	NA	NA
WP_000217456.1|2353198_2353894_+	SDR family oxidoreductase	NA	W8CYX9	Bacillus_phage	35.6	4.3e-08
>prophage 171
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2358448	2359267	2843306		Acanthamoeba_polyphaga_moumouvirus(100.0%)	1	NA	NA
WP_000824948.1|2358448_2359267_+	SDR family oxidoreductase	NA	L7RG25	Acanthamoeba_polyphaga_moumouvirus	27.2	1.3e-08
>prophage 172
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2367319	2368877	2843306		Planktothrix_phage(50.0%)	2	NA	NA
WP_000173871.1|2367319_2368135_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	29.8	8.8e-13
WP_000598772.1|2368127_2368877_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	32.7	9.0e-20
>prophage 173
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2376148	2380577	2843306		Organic_Lake_phycodnavirus(50.0%)	4	NA	NA
WP_000923526.1|2376148_2376811_+	ATP-binding cassette domain-containing protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	30.8	5.5e-21
WP_000072149.1|2376803_2377580_+	iron export ABC transporter permease subunit FetB	NA	NA	NA	NA	NA
WP_000026189.1|2377975_2379163_+	MFS transporter	NA	NA	NA	NA	NA
WP_000700925.1|2379224_2380577_-	carboxylesterase/lipase family protein	NA	A0A0B5J865	Pandoravirus	34.2	2.5e-12
>prophage 174
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2383971	2385830	2843306		Mycoplasma_phage(50.0%)	2	NA	NA
WP_000948974.1|2383971_2385198_+	ABC transporter ATP-binding protein	NA	Q6GZ03	Mycoplasma_phage	50.5	6.6e-20
WP_000569120.1|2385194_2385830_+	ABC transporter permease	NA	G3M9Y4	Bacillus_virus	26.2	9.0e-05
>prophage 175
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2403557	2409819	2843306		Bacillus_phage(66.67%)	5	NA	NA
WP_001176863.1|2403557_2404700_-	glycerate kinase	NA	W6LM47	Streptococcus_phage	44.3	5.3e-56
WP_000779360.1|2404967_2405354_+	flippase GtxA	NA	NA	NA	NA	NA
WP_000482652.1|2405487_2405595_+	type I toxin-antitoxin system Fst family toxin	NA	NA	NA	NA	NA
WP_001064825.1|2406297_2408061_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	24.7	2.5e-36
WP_000486487.1|2408085_2409819_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	25.7	9.0e-31
>prophage 176
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2413280	2419050	2843306		Staphylococcus_phage(75.0%)	6	NA	NA
WP_000971550.1|2413280_2414396_+	pyridoxal phosphate-dependent aminotransferase family protein	NA	V5LQ39	Emiliania_huxleyi_virus	24.7	1.6e-20
WP_000286875.1|2414406_2415099_+	6-carboxyhexanoate--CoA ligase	NA	NA	NA	NA	NA
WP_000200956.1|2415109_2415577_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000783428.1|2415628_2416606_-	bi-component gamma-hemolysin HlgAB/HlgCB subunit B	NA	A0A2H4PQH7	Staphylococcus_phage	76.2	7.1e-142
WP_000916704.1|2416607_2417555_-	bi-component gamma-hemolysin HlgCB subunit C	NA	A0A2I6PER8	Staphylococcus_phage	77.5	3.2e-139
WP_000594519.1|2418120_2419050_-	bi-component gamma-hemolysin HlgAB subunit A	NA	A0A2H4PQI5	Staphylococcus_phage	71.1	3.2e-120
>prophage 177
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2427106	2427838	2843306		Bacillus_virus(100.0%)	1	NA	NA
WP_000615461.1|2427106_2427838_+	amino acid ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.7	4.1e-25
>prophage 178
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2444487	2446047	2843306		Escherichia_phage(100.0%)	1	NA	NA
WP_000692648.1|2444487_2446047_+	nitrate reductase subunit beta	NA	A0A077SL61	Escherichia_phage	46.8	4.4e-21
>prophage 179
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2467314	2468349	2843306		Bacillus_virus(100.0%)	1	NA	NA
WP_000655971.1|2467314_2468349_+	NAD(P)/FAD-dependent oxidoreductase	NA	G3MA85	Bacillus_virus	26.6	5.8e-17
>prophage 180
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2478194	2482091	2843306		Hokovirus(33.33%)	4	NA	NA
WP_000477338.1|2478194_2479568_-	heme sensor histidine kinase HssS	NA	A0A1V0SGX0	Hokovirus	29.8	2.3e-13
WP_000249497.1|2479560_2480235_-	DNA-binding heme response regulator HssR	NA	W8CYM9	Bacillus_phage	45.2	3.6e-52
WP_000761395.1|2480370_2481426_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001229920.1|2481425_2482091_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	38.8	1.6e-36
>prophage 181
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2485827	2487036	2843306		Salmonella_phage(100.0%)	1	NA	NA
WP_000999131.1|2485827_2487036_+	multidrug effflux MFS transporter	NA	S4TR35	Salmonella_phage	26.3	3.9e-33
>prophage 182
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2499127	2500027	2843306		Brazilian_cedratvirus(100.0%)	1	NA	NA
WP_000524830.1|2499127_2500027_+	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.7	1.2e-15
>prophage 183
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2507399	2507819	2843306		Bacillus_phage(100.0%)	1	NA	NA
WP_000920239.1|2507399_2507819_-	FosB1/FosB3 family fosfomycin resistance bacillithiol transferase	NA	Q2LI91	Bacillus_phage	61.9	2.6e-37
>prophage 184
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2513499	2514381	2843306		Diadromus_pulchellus_ascovirus(100.0%)	1	NA	NA
WP_000235289.1|2513499_2514381_+	SDR family oxidoreductase	NA	F2NZ40	Diadromus_pulchellus_ascovirus	46.3	3.8e-62
>prophage 185
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2522259	2522895	2843306		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_000285450.1|2522259_2522895_+	HAD family hydrolase	NA	A7J6N1	Paramecium_bursaria_Chlorella_virus	27.1	1.6e-09
>prophage 186
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2535700	2539818	2843306		Staphylococcus_phage(50.0%)	4	NA	NA
WP_000739224.1|2535700_2536477_+	glucosaminidase domain-containing protein	NA	H9A0P7	Staphylococcus_phage	41.0	3.8e-37
WP_000684147.1|2536787_2537912_+	FAD-dependent monooxygenase	NA	A0A2K9L3K5	Tupanvirus	22.8	9.3e-13
WP_000417018.1|2538003_2538957_-	2-hydroxyacid dehydrogenase	NA	A0A1V0SBV6	Catovirus	28.9	6.4e-31
WP_000737705.1|2539317_2539818_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	39.3	2.0e-07
>prophage 187
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2543735	2544539	2843306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000717381.1|2543735_2544539_-	CHAP domain-containing protein	NA	A0A2R3ZXQ4	Staphylococcus_phage	41.3	9.3e-07
>prophage 188
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2563519	2564125	2843306		Pithovirus(100.0%)	1	NA	NA
WP_000913024.1|2563519_2564125_+	ATP-binding cassette domain-containing protein	NA	W5SAS9	Pithovirus	30.1	4.3e-12
>prophage 189
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2576095	2579263	2843306		Leptospira_phage(100.0%)	1	NA	NA
WP_000592307.1|2576095_2579263_+	efflux RND transporter permease subunit	NA	S5VTK5	Leptospira_phage	21.8	1.1e-61
>prophage 190
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2602946	2604613	2843306		Anomala_cuprea_entomopoxvirus(50.0%)	2	NA	NA
WP_000389658.1|2602946_2603756_+	energy-coupling factor transporter ATPase	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	30.0	1.7e-19
WP_000155387.1|2603752_2604613_+	energy-coupling factor transporter ATPase	NA	A0A2H4PQG7	Staphylococcus_phage	23.9	9.7e-10
>prophage 191
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2613392	2621048	2843306		Enterobacteria_phage(33.33%)	7	NA	NA
WP_000411031.1|2613392_2614409_+	RNA-directed DNA polymerase	NA	Q7M2A9	Enterobacteria_phage	29.7	1.0e-18
WP_000655241.1|2614982_2615165_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000130149.1|2615658_2617323_+	acetolactate synthase AlsS	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	25.9	8.0e-45
WP_000186134.1|2617359_2618064_+	acetolactate decarboxylase	NA	NA	NA	NA	NA
WP_000769705.1|2618447_2618873_-	MAP domain-containing protein	NA	NA	NA	NA	NA
WP_000044362.1|2619167_2619983_+	HAD-IIB family hydrolase	NA	NA	NA	NA	NA
WP_001044441.1|2620193_2621048_+	M23 family metallopeptidase	NA	E5G070	Clostridium_phage	37.9	4.9e-06
>prophage 192
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2624430	2626740	2843306		Staphylococcus_phage(50.0%)	4	NA	NA
WP_001015500.1|2624430_2625279_+	aldo/keto reductase	NA	A0A2H4PQR8	Staphylococcus_phage	39.2	2.0e-44
WP_000875476.1|2625511_2625715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001791678.1|2625801_2625963_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001557494.1|2625999_2626740_-	NAD-dependent protein deacylase	NA	A0A2I2L319	Orpheovirus	29.9	1.5e-14
>prophage 193
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2633060	2634473	2843306		Pandoravirus(100.0%)	1	NA	NA
WP_000169224.1|2633060_2634473_+	6-phospho-beta-galactosidase	NA	A0A0B5JD41	Pandoravirus	28.9	3.0e-48
>prophage 194
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2638436	2639999	2843306		Vibrio_phage(100.0%)	1	NA	NA
WP_000792342.1|2638436_2639999_+	BCCT family transporter	NA	A0A2I7QNT1	Vibrio_phage	24.6	1.2e-18
>prophage 195
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2650201	2651170	2843306		uncultured_Caudovirales_phage(100.0%)	1	NA	NA
WP_000989088.1|2650201_2651170_+	iron chelate uptake ABC transporter family permease subunit	NA	A0A2H4IY97	uncultured_Caudovirales_phage	28.8	1.0e-15
>prophage 196
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2667102	2668011	2843306		Klosneuvirus(100.0%)	1	NA	NA
WP_000167867.1|2667102_2668011_+	arginase	NA	A0A1V0SJM8	Klosneuvirus	32.0	3.2e-27
>prophage 197
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2671602	2679048	2843306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_001048259.1|2671602_2679048_+	DUF1542 domain-containing protein	NA	A0A2H4PQU6	Staphylococcus_phage	31.5	3.9e-22
>prophage 198
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2685304	2688124	2843306		Paramecium_bursaria_Chlorella_virus(50.0%)	2	NA	NA
WP_000334463.1|2685304_2687110_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1H1Z3	Paramecium_bursaria_Chlorella_virus	38.8	5.2e-98
WP_000908182.1|2687341_2688124_+	ABC transporter ATP-binding protein	NA	W8CYL7	Bacillus_phage	30.1	3.3e-09
>prophage 199
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2699304	2703135	2843306		Clostridium_phage(50.0%)	4	NA	NA
WP_000070866.1|2699304_2699748_+	DNA starvation/stationary phase protection protein	NA	A0A0A7RTZ1	Clostridium_phage	53.7	5.6e-38
WP_000160304.1|2699868_2700579_-	purine-nucleoside phosphorylase	NA	NA	NA	NA	NA
WP_001083318.1|2700892_2701555_+	deoxyribose-phosphate aldolase	NA	NA	NA	NA	NA
WP_001242311.1|2701833_2703135_+	pyrimidine-nucleoside phosphorylase	NA	A0A0H3UZD4	Geobacillus_virus	58.9	3.6e-133
>prophage 200
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2711075	2712686	2843306		Only_Syngen_Nebraska_virus(100.0%)	1	NA	NA
WP_000159960.1|2711075_2712686_+	CTP synthase	NA	A0A1J0FA14	Only_Syngen_Nebraska_virus	49.6	2.7e-146
>prophage 201
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2720489	2728239	2843306		Bacillus_virus(25.0%)	9	NA	NA
WP_000273358.1|2720489_2721089_+	thymidine kinase	NA	G3MBK1	Bacillus_virus	42.9	6.2e-32
WP_000460242.1|2721089_2722166_+	peptide chain release factor 1	NA	NA	NA	NA	NA
WP_000248732.1|2722152_2722989_+	peptide chain release factor N(5)-glutamine methyltransferase	NA	NA	NA	NA	NA
WP_000379895.1|2723072_2724119_+	threonylcarbamoyl-AMP synthase	NA	A0A291ATS8	Pandoravirus	35.3	2.2e-40
WP_000697334.1|2724115_2724535_+	low molecular weight protein arginine phosphatase	NA	NA	NA	NA	NA
WP_000654184.1|2724641_2725166_+	TIGR01440 family protein	NA	NA	NA	NA	NA
WP_000120494.1|2725192_2726431_+	serine hydroxymethyltransferase	NA	A0A240F3L3	Aeromonas_phage	53.0	8.2e-103
WP_000048712.1|2726458_2727088_+	uracil phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_000723418.1|2727111_2728239_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	29.9	1.0e-27
>prophage 202
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2738642	2739038	2843306		Staphylococcus_phage(100.0%)	1	NA	NA
WP_000932694.1|2738642_2739038_+	single-stranded DNA-binding protein	NA	A0A1J0MFK5	Staphylococcus_phage	38.5	1.3e-14
>prophage 203
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2745309	2745957	2843306		Moumouvirus(100.0%)	1	NA	NA
WP_001187630.1|2745309_2745957_-	HD domain-containing protein	NA	H2ED17	Moumouvirus	27.0	8.0e-09
>prophage 204
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2753157	2754678	2843306		Diachasmimorpha_longicaudata_entomopoxvirus(100.0%)	1	NA	NA
WP_001178942.1|2753157_2754678_+	DEAD/DEAH box helicase	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.9	2.0e-58
>prophage 205
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2761868	2763896	2843306		Paramecium_bursaria_Chlorella_virus(100.0%)	1	NA	NA
WP_173896767.1|2761868_2763896_+	potassium-transporting ATPase subunit KdpB	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	23.5	1.7e-25
>prophage 206
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2769045	2772430	2843306		Clostridium_botulinum_C_phage(50.0%)	5	NA	NA
WP_000621175.1|2769045_2769408_+	type II toxin-antitoxin system PemK/MazF family toxin	NA	Q332J9	Clostridium_botulinum_C_phage	32.8	4.2e-07
WP_000390827.1|2769757_2770759_+	PP2C family protein-serine/threonine phosphatase	NA	NA	NA	NA	NA
WP_001052491.1|2770877_2771204_+	anti-sigma factor antagonist	NA	NA	NA	NA	NA
WP_001190829.1|2771205_2771685_+	anti-sigma B factor RsbW	NA	NA	NA	NA	NA
WP_001041111.1|2771659_2772430_+	RNA polymerase sigma factor SigB	NA	A0A0A0RNH9	Bacillus_phage	34.9	2.2e-21
>prophage 207
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2786548	2791272	2843306		Micromonas_sp._RCC1109_virus(50.0%)	4	NA	NA
WP_000094583.1|2786548_2788078_-	2-isopropylmalate synthase	NA	E5EQ69	Micromonas_sp._RCC1109_virus	28.1	5.5e-08
WP_072399972.1|2788107_2789127_-	ketol-acid reductoisomerase	NA	NA	NA	NA	NA
WP_000196911.1|2789248_2789503_-	ACT domain-containing protein	NA	NA	NA	NA	NA
WP_000047812.1|2789502_2791272_-	biosynthetic-type acetolactate synthase large subunit	NA	A0A0P0YLY7	Yellowstone_lake_phycodnavirus	30.6	9.1e-63
>prophage 208
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2795032	2809093	2843306	tRNA	Moraxella_phage(16.67%)	12	NA	NA
WP_000159042.1|2795032_2796058_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	40.6	3.4e-62
WP_000106332.1|2796372_2797983_-	MutS family DNA mismatch repair protein	NA	A0A0N9R0S5	Chrysochromulina_ericina_virus	28.1	1.9e-19
WP_001792272.1|2798071_2798200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000602057.1|2798344_2800273_-	ABC-F type ribosomal protection protein	NA	A0A2K9L0W2	Tupanvirus	30.2	9.3e-53
WP_001283612.1|2800525_2801161_+	redox-sensing transcriptional repressor Rex	NA	NA	NA	NA	NA
WP_000266884.1|2801464_2802544_+	YeeE/YedE family protein	NA	NA	NA	NA	NA
WP_000581076.1|2802603_2802828_+	sulfurtransferase TusA family protein	NA	NA	NA	NA	NA
WP_001052270.1|2803035_2804286_+	ammonium transporter	NA	H8ZJB2	Ostreococcus_tauri_virus	31.2	4.5e-40
WP_000790331.1|2804468_2805419_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_000141432.1|2805567_2807052_+	glycoside hydrolase family 32 protein	NA	S6ATV4	Bacillus_phage	26.5	2.3e-19
WP_001253312.1|2807048_2808008_+	carbohydrate kinase	NA	NA	NA	NA	NA
WP_000688492.1|2808376_2809093_-	response regulator transcription factor	NA	A0A2H4J4Z6	uncultured_Caudovirales_phage	32.6	2.3e-25
>prophage 209
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2816274	2818251	2843306		uncultured_virus(100.0%)	2	NA	NA
WP_000917289.1|2816274_2816559_+	co-chaperone GroES	NA	A0A221S386	uncultured_virus	46.2	4.7e-14
WP_000240642.1|2816634_2818251_+	chaperonin GroEL	NA	A0A240F779	uncultured_virus	54.7	3.4e-157
>prophage 210
NZ_CP053640	Staphylococcus aureus strain 14505 chromosome, complete genome	2843306	2822200	2842835	2843306	integrase	Staphylococcus_phage(94.87%)	39	2819042:2819056	2826679:2826693
2819042:2819056	attL	TACTGATAAATAGAA	NA	NA	NA	NA
WP_000791411.1|2822200_2823256_+	bi-component leukocidin LukGH subunit H	NA	A0A1X9IGW5	Staphylococcus_phage	34.3	2.8e-35
WP_000595392.1|2823277_2824294_+	bi-component leukocidin LukGH subunit G	NA	A0A1X9IGW5	Staphylococcus_phage	30.2	6.7e-26
WP_000857200.1|2825412_2826450_-|integrase	site-specific integrase	integrase	Q38086	Staphylococcus_phage	99.7	2.2e-178
WP_001549185.1|2826640_2827354_-	type II toxin-antitoxin system PemK/MazF family toxin	NA	A0A1X9H026	Staphylococcus_phage	100.0	5.0e-129
2826679:2826693	attR	TTCTATTTATCAGTA	NA	NA	NA	NA
WP_000705245.1|2827432_2827615_-	hypothetical protein	NA	A0A0H3U4Z4	Staphylococcus_phage	96.7	6.9e-27
WP_000109189.1|2827685_2827871_-	hypothetical protein	NA	U5U7D6	Staphylococcus_phage	100.0	2.3e-25
WP_000345949.1|2827867_2828014_-	hypothetical protein	NA	A0A1X9H032	Staphylococcus_phage	100.0	3.3e-19
WP_001557601.1|2828087_2828942_-	restriction endonuclease	NA	A0A1X9H037	Staphylococcus_phage	100.0	7.3e-151
WP_001083975.1|2828953_2829670_-	helix-turn-helix domain-containing protein	NA	A0A1X9H038	Staphylococcus_phage	100.0	5.4e-131
WP_000639923.1|2829833_2830076_+	DUF739 family protein	NA	A0A1X9H035	Staphylococcus_phage	100.0	1.6e-39
WP_000435360.1|2830088_2830532_+	hypothetical protein	NA	W5R971	Staphylococcus_phage	100.0	1.5e-75
WP_000939495.1|2830546_2830687_+	hypothetical protein	NA	A0A2I6PDT8	Staphylococcus_phage	100.0	1.9e-16
WP_000772137.1|2830679_2830889_-	hypothetical protein	NA	A0A2I6PDR8	Staphylococcus_phage	100.0	9.1e-31
WP_001148338.1|2830945_2831695_+	phage antirepressor KilAC domain-containing protein	NA	B7T097	Staphylococcus_virus	99.6	3.4e-136
WP_001148862.1|2831710_2831908_+	hypothetical protein	NA	O80075	Staphylococcus_phage	87.7	3.5e-24
WP_000762521.1|2831894_2832275_-	DUF2513 domain-containing protein	NA	Q9T1Z5	Staphylococcus_phage	100.0	1.2e-68
WP_001120201.1|2832329_2832653_+	DUF771 domain-containing protein	NA	A0A075LYF5	Staphylococcus_phage	100.0	3.0e-57
WP_000048129.1|2832649_2832811_+	DUF1270 family protein	NA	A0A1P8L6G0	Staphylococcus_phage	100.0	1.9e-20
WP_001810307.1|2832905_2833193_+	DUF2482 family protein	NA	A0A1P8L6F8	Staphylococcus_phage	100.0	7.1e-42
WP_000291510.1|2833213_2833474_+	DUF1108 family protein	NA	A0A1P8L6F5	Staphylococcus_phage	100.0	5.2e-44
WP_001205732.1|2833482_2833746_+	hypothetical protein	NA	A0A2I6PDG2	Staphylococcus_phage	100.0	7.7e-43
WP_000700554.1|2833754_2835698_+	AAA family ATPase	NA	A0A1P8L6F1	Staphylococcus_phage	100.0	0.0e+00
WP_000180600.1|2835699_2836620_+	recombinase RecT	NA	A0A1P8L6F6	Staphylococcus_phage	100.0	5.1e-166
WP_064135358.1|2836700_2837318_+	MBL fold metallo-hydrolase	NA	A0A1P8L6F7	Staphylococcus_phage	100.0	1.2e-86
WP_000934759.1|2837318_2837789_+	single-stranded DNA-binding protein	NA	A0A1P8L6D9	Staphylococcus_phage	100.0	5.7e-81
WP_000148333.1|2837818_2838712_+	DnaD domain-containing protein	NA	A0A1P8L6F0	Staphylococcus_phage	100.0	3.2e-141
WP_000338528.1|2838718_2838937_+	hypothetical protein	NA	A0A1P8L6E4	Staphylococcus_phage	100.0	1.4e-37
WP_000401969.1|2838945_2839350_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A075M042	Staphylococcus_phage	100.0	8.4e-73
WP_000101279.1|2839362_2839734_+	hypothetical protein	NA	A0A2I6PDG3	Staphylococcus_phage	91.1	1.4e-50
WP_000111491.1|2839733_2839991_+	DUF3310 domain-containing protein	NA	A0A1X9H067	Staphylococcus_phage	98.8	6.3e-42
WP_000178987.1|2839987_2840236_+	hypothetical protein	NA	A0A0K1LL46	Staphylococcus_phage	96.3	7.5e-40
WP_001065108.1|2840250_2840496_+	DUF1024 family protein	NA	Q8SDV5	Staphylococcus_phage	95.1	1.7e-36
WP_000185693.1|2840492_2841029_+	dUTP diphosphatase	NA	Q9MBR0	Staphylococcus_prophage	100.0	1.6e-95
WP_001282077.1|2841065_2841311_+	hypothetical protein	NA	A0A2I6PDW7	Staphylococcus_phage	98.8	2.5e-35
WP_000195784.1|2841307_2841514_+	DUF1381 domain-containing protein	NA	A0A2I6PEA2	Staphylococcus_phage	94.1	1.1e-17
WP_000595265.1|2841510_2841660_+	transcriptional activator RinB	NA	A0A1W6JPZ2	Staphylococcus_phage	100.0	4.8e-18
WP_001557462.1|2841659_2841860_+	DUF1514 family protein	NA	D2JLD9	Staphylococcus_phage	98.5	5.3e-28
WP_000590122.1|2841887_2842304_+	hypothetical protein	NA	G4KNP7	Staphylococcus_phage	100.0	1.3e-76
WP_000988332.1|2842535_2842835_+	HNH endonuclease	NA	A0A2I6PDH9	Staphylococcus_phage	100.0	3.5e-52
