The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP052070	Ralstonia solanacearum strain FJAT454.F1 chromosome, complete genome	3944010	215325	248278	3944010	transposase,head,terminase,capsid,portal	Acidithiobacillus_phage(56.25%)	43	NA	NA
WP_064047878.1|215325_215802_-	hypothetical protein	NA	K4I1C7	Acidithiobacillus_phage	53.2	2.2e-40
WP_016722451.1|215798_216173_-	hypothetical protein	NA	K4HZX2	Acidithiobacillus_phage	65.4	3.2e-42
WP_064047877.1|216169_217558_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	81.4	8.1e-216
WP_016722453.1|217554_218004_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	71.6	8.8e-55
WP_016722454.1|218306_218714_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086005097.1|218801_219951_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	60.7	5.9e-95
WP_016722457.1|219967_220720_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016722458.1|220879_223117_-	hypothetical protein	NA	K4I1D0	Acidithiobacillus_phage	65.7	7.0e-286
WP_016722459.1|223166_223628_-	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	64.7	2.4e-47
WP_173877469.1|223856_224120_+	DNA-binding protein	NA	K4I3X3	Acidithiobacillus_phage	75.4	1.1e-20
WP_016722461.1|224130_224613_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	59.4	1.4e-45
WP_038962121.1|224609_225470_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	68.6	3.4e-108
WP_038962122.1|225466_226108_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	73.3	3.0e-80
WP_038962123.1|226115_226592_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	65.6	8.7e-53
WP_071893031.1|226591_227329_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	77.0	4.9e-111
WP_016725337.1|227325_227586_+	DNA-binding protein	NA	K4I1D6	Acidithiobacillus_phage	76.8	1.4e-17
WP_021154677.1|227582_229871_+	bacteriophage-related protein	NA	K4HZY1	Acidithiobacillus_phage	63.2	8.4e-287
WP_016725339.1|230001_230466_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	67.6	1.0e-53
WP_011003115.1|230467_230677_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725340.1|230669_231053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725341.1|231107_231374_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_011003112.1|231373_231673_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_071893036.1|232223_233624_+	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	62.8	1.3e-165
WP_071893040.1|233620_234841_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	80.7	2.7e-191
WP_016723619.1|235020_235986_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_071893043.1|236061_236427_-	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	58.8	2.9e-32
WP_016725347.1|236594_236789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725348.1|236950_237319_+	hypothetical protein	NA	A0A2H4JI44	uncultured_Caudovirales_phage	45.0	3.8e-16
WP_016726852.1|237473_237662_-	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	66.0	1.2e-13
WP_016725351.1|237783_238278_-	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	56.3	2.4e-21
WP_011000804.1|238367_238640_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038962858.1|238733_239270_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	79.8	4.2e-72
WP_071893046.1|239269_241237_+|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	85.6	0.0e+00
WP_071893050.1|241280_241790_+	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	47.1	1.3e-25
WP_064047640.1|241800_242193_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020833008.1|242193_242415_+	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	57.5	1.3e-11
WP_069079297.1|242414_243962_+|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.1	7.3e-149
WP_023470378.1|243971_245222_+	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	45.0	2.4e-62
WP_021154688.1|245231_245609_+|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	49.6	6.1e-25
WP_021154689.1|245617_246622_+|capsid	major capsid protein	capsid	A0A1B2LRS0	Wolbachia_phage	67.2	2.5e-110
WP_021154690.1|246624_246927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016727774.1|246932_247379_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058908386.1|247504_248278_+	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	43.6	3.1e-47
>prophage 2
NZ_CP052070	Ralstonia solanacearum strain FJAT454.F1 chromosome, complete genome	3944010	253306	335481	3944010	tail,transposase,protease	Ralstonia_phage(33.33%)	60	NA	NA
WP_071893060.1|253306_257410_+|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	29.1	1.7e-27
WP_071893063.1|257415_257811_+	hypothetical protein	NA	A0A0M4UTA7	Ralstonia_phage	52.3	2.9e-30
WP_071893067.1|257797_258370_-	rloe protein	NA	NA	NA	NA	NA
WP_071893071.1|258399_261990_+	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	53.6	0.0e+00
WP_071893075.1|262012_263179_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071893078.1|263182_263665_+	hypothetical protein	NA	A0A0M4TU90	Ralstonia_phage	42.7	1.5e-12
WP_071893082.1|263661_264060_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071893085.1|264064_265909_+	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	45.9	4.5e-105
WP_016724634.1|265918_266143_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016724633.1|266210_266501_+	membrane protein	NA	K4I011	Acidithiobacillus_phage	48.8	2.4e-13
WP_058908401.1|266497_266974_+	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	84.8	6.4e-72
WP_071893089.1|266970_267432_+	lysozyme	NA	K4I410	Acidithiobacillus_phage	81.0	1.7e-66
WP_016723628.1|267499_267799_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028852787.1|267861_268200_-	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
WP_016723616.1|277486_277846_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155773148.1|277970_278705_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071893092.1|279465_282006_+	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.8	1.7e-17
WP_071893096.1|282017_283769_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_071893100.1|283781_284627_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_071893102.1|284824_285916_+	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_071893105.1|286637_287459_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016724611.1|287608_289126_-	ATP-binding protein	NA	NA	NA	NA	NA
WP_071654022.1|289351_290176_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016725373.1|290201_290537_-	DUF861 domain-containing protein	NA	NA	NA	NA	NA
WP_016725374.1|290567_291185_-	DJ-1/PfpI family protein	NA	NA	NA	NA	NA
WP_016725375.1|291221_291665_-	cyanase	NA	NA	NA	NA	NA
WP_016725376.1|291806_293141_+	PLP-dependent aminotransferase family protein	NA	A0A1X9I5H2	Streptococcus_phage	21.8	6.7e-10
WP_019718995.1|293461_294826_+	amidohydrolase family protein	NA	NA	NA	NA	NA
WP_020371902.1|295194_295695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021156161.1|296205_298011_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_011003055.1|298189_298768_-	adenylyl-sulfate kinase	NA	A0A2P1ELS9	Moumouvirus	38.7	4.5e-19
WP_016724441.1|298764_299667_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_016724440.1|299679_300843_-	glycosyl transferase family 8	NA	NA	NA	NA	NA
WP_016724439.1|300839_302942_-	sulfotransferase family protein	NA	NA	NA	NA	NA
WP_016727280.1|303104_306137_-	autotransporter domain-containing protein	NA	NA	NA	NA	NA
WP_016724436.1|306301_306997_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_016724435.1|307062_308994_+	sensor histidine kinase	NA	NA	NA	NA	NA
WP_016724434.1|309320_310451_+	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016724433.1|310491_311769_-	TIGR03862 family flavoprotein	NA	NA	NA	NA	NA
WP_011003046.1|312054_312891_+	SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_016725726.1|313383_314712_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011003045.1|314764_314968_-	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.6	2.1e-16
WP_016724432.1|315295_315502_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016724430.1|316089_317268_+	antibiotic hydrolase	NA	NA	NA	NA	NA
WP_016724429.1|317704_318541_+	cytochrome c	NA	NA	NA	NA	NA
WP_016721735.1|319251_320217_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|320213_320363_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016724428.1|320600_322091_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038938383.1|322087_322930_+	NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_021154949.1|323113_325237_-	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_011003039.1|325977_326409_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016724425.1|327453_327795_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_173651675.1|327941_328385_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071893108.1|328384_329533_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011003035.1|329660_330053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_021154951.1|330383_331289_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011003033.1|331342_332722_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	32.4	1.8e-13
WP_016727287.1|333037_333637_+	undecaprenyl-diphosphatase	NA	NA	NA	NA	NA
WP_016724421.1|333895_334450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038938388.1|334521_335481_+|protease	serine protease	protease	A0A0F6R5W6	Sinorhizobium_phage	30.0	1.3e-07
>prophage 3
NZ_CP052070	Ralstonia solanacearum strain FJAT454.F1 chromosome, complete genome	3944010	868972	922446	3944010	coat,transposase,protease	Lactobacillus_phage(16.67%)	51	NA	NA
WP_016725726.1|868972_870301_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011002610.1|870813_871140_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002609.1|871233_871518_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020832642.1|872601_872739_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002608.1|872856_873174_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002607.1|873326_873623_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723697.1|873719_874580_+	transglutaminase family protein	NA	NA	NA	NA	NA
WP_016723696.1|874596_874857_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002605.1|876202_876706_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_011002604.1|876755_877259_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_016723694.1|877377_878097_+	molecular chaperone	NA	NA	NA	NA	NA
WP_016723693.1|878146_880411_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_016723692.1|880428_880917_+|coat	spore coat protein U domain-containing protein	coat	NA	NA	NA	NA
WP_016723691.1|880986_881529_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723690.1|882134_883079_+	hydrogen peroxide-inducible genes activator	NA	A0A2P0ZL89	Lactobacillus_phage	23.9	4.0e-09
WP_016723689.1|883297_883546_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002597.1|883604_883847_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003271865.1|884006_884507_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	36.2	2.1e-20
WP_069079120.1|884580_885456_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_011002595.1|885452_885731_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002594.1|885752_886577_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_011002593.1|886611_887334_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011002592.1|887458_888502_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_011002591.1|888554_889694_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_016723685.1|889888_890329_+	type IV pilin protein	NA	NA	NA	NA	NA
WP_016723684.1|890332_890821_+	GspH/FimT family pseudopilin	NA	NA	NA	NA	NA
WP_011002588.1|890817_891408_+	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
WP_016723683.1|891404_892433_+	PilW family protein	NA	NA	NA	NA	NA
WP_011002586.1|892436_892973_+	pilus assembly PilX N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_016723682.1|893004_896217_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_016723681.1|896312_896810_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	40.0	3.3e-26
WP_016723680.1|896826_897525_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_016723679.1|897567_898047_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_016723678.1|898097_898493_-	VOC family protein	NA	NA	NA	NA	NA
WP_020832616.1|898651_899374_-	LrgB family protein	NA	NA	NA	NA	NA
WP_016723676.1|899370_899748_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_069079119.1|899799_901047_-	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_069079118.1|901056_902175_-	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_028853584.1|902185_903679_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_016723672.1|903849_904740_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011002574.1|904750_906169_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_020832612.1|906289_906847_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_016723670.1|906919_907816_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_016723669.1|908100_908436_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011002570.1|908559_909639_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	45.0	1.1e-76
WP_020832609.1|910031_911492_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_028860942.1|911519_912389_-	carbon-nitrogen hydrolase family protein	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	25.3	6.3e-09
WP_071895426.1|912394_916675_-	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_071895427.1|916854_919722_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_011002565.1|919718_920339_+	rhombosortase	NA	NA	NA	NA	NA
WP_020832604.1|920394_922446_-|protease	MprA protease, GlyGly-CTERM protein-sorting domain-containing form	protease	A0A1B0T6A2	Bacillus_phage	34.7	6.1e-10
>prophage 4
NZ_CP052070	Ralstonia solanacearum strain FJAT454.F1 chromosome, complete genome	3944010	939452	949591	3944010		Hokovirus(14.29%)	9	NA	NA
WP_021155204.1|939452_941414_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.8	1.4e-149
WP_011002544.1|941548_942691_+	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	32.7	2.9e-22
WP_019718314.1|942726_944607_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	A0A0B5J984	Pandoravirus	37.3	6.1e-57
WP_011002542.1|944562_945249_-	energy-coupling factor ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.2	1.5e-13
WP_016724068.1|945256_945964_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_016724069.1|945975_946800_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	31.3	2.4e-34
WP_016724070.1|946856_947501_-	deoxynucleoside kinase	NA	M1IA15	Paramecium_bursaria_Chlorella_virus	27.3	8.3e-06
WP_003271964.1|947534_948044_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_021155205.1|948043_949591_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	33.6	3.6e-23
>prophage 5
NZ_CP052070	Ralstonia solanacearum strain FJAT454.F1 chromosome, complete genome	3944010	1560152	1637957	3944010	tRNA,transposase,integrase,head,terminase,tail,plate,portal,capsid,holin	Ralstonia_phage(44.23%)	83	1565895:1565914	1650115:1650134
WP_016727020.1|1560152_1560977_+|tRNA	tRNA pseudouridine(38-40) synthase TruA	tRNA	NA	NA	NA	NA
WP_019718613.1|1560973_1561678_+	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_016722990.1|1561773_1562967_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_016727018.1|1562971_1563784_+	site-specific DNA-methyltransferase	NA	R4THJ7	Phaeocystis_globosa_virus	37.0	6.5e-32
WP_011001917.1|1563798_1564596_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_011001916.1|1564633_1565506_+	acetyl-CoA carboxylase carboxyltransferase subunit beta	NA	NA	NA	NA	NA
WP_011001915.1|1565587_1566886_+	bifunctional tetrahydrofolate synthase/dihydrofolate synthase	NA	NA	NA	NA	NA
1565895:1565914	attL	AGGCGGTCGAGCGCGCCCGC	NA	NA	NA	NA
WP_021155237.1|1566972_1567794_+	SPOR domain-containing protein	NA	NA	NA	NA	NA
WP_011001913.1|1567866_1568364_+	CvpA family protein	NA	NA	NA	NA	NA
WP_011001912.1|1568458_1569994_+	amidophosphoribosyltransferase	NA	A0A0M3SGR2	Mollivirus	42.4	1.0e-86
WP_020832236.1|1570120_1570942_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011001910.1|1570965_1571931_-	nodulation factor ABC transporter ATP-binding protein NodI	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	25.6	1.6e-24
WP_003264057.1|1572086_1572287_-	glycine zipper 2TM domain-containing protein	NA	NA	NA	NA	NA
WP_011001909.1|1572709_1573201_+	phasin family protein	NA	NA	NA	NA	NA
WP_011001907.1|1573477_1573717_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001906.1|1573860_1574181_+	membrane protein	NA	NA	NA	NA	NA
WP_021155235.1|1574390_1575188_+	YdcF family protein	NA	NA	NA	NA	NA
WP_011001904.1|1575215_1575629_+	heme-binding protein	NA	NA	NA	NA	NA
WP_011001903.1|1575822_1576101_-	hemin uptake protein HemP	NA	NA	NA	NA	NA
WP_011001902.1|1576296_1576710_-	biopolymer transporter ExbD	NA	NA	NA	NA	NA
WP_011001901.1|1576719_1577451_-	MotA/TolQ/ExbB proton channel family protein	NA	NA	NA	NA	NA
WP_019718620.1|1577487_1578147_-	energy transducer TonB	NA	NA	NA	NA	NA
WP_016725286.1|1578657_1580973_+	ATP-binding protein	NA	A0A0K1Y7P8	Apis_mellifera_filamentous_virus	30.7	5.2e-10
WP_011001897.1|1581100_1581457_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016725285.1|1581440_1582400_+	SRPBCC domain-containing protein	NA	NA	NA	NA	NA
WP_016725284.1|1582445_1582787_-	DHCW motif cupin fold protein	NA	NA	NA	NA	NA
WP_011001894.1|1583249_1584536_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_011001893.1|1584656_1585490_-	glutamate racemase	NA	NA	NA	NA	NA
WP_016725283.1|1585510_1587034_-	fumarate hydratase	NA	NA	NA	NA	NA
WP_011001891.1|1587213_1587753_-	TIGR00645 family protein	NA	NA	NA	NA	NA
WP_021155233.1|1587836_1588847_-	DMT family transporter	NA	NA	NA	NA	NA
WP_016725281.1|1589011_1590994_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	37.4	1.3e-78
WP_021155232.1|1591015_1593082_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_016721870.1|1594610_1595597_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_058907201.1|1597513_1600174_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	100.0	0.0e+00
WP_016721870.1|1600816_1601803_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_081049899.1|1602340_1603102_+	hypothetical protein	NA	A0A077KEQ4	Ralstonia_phage	100.0	1.9e-142
WP_058907204.1|1603107_1605348_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	100.0	0.0e+00
WP_071895446.1|1605414_1606500_-|portal	phage portal protein	portal	A0A077K9Q8	Ralstonia_phage	99.4	1.4e-210
WP_071895447.1|1606496_1608278_-|terminase	terminase ATPase subunit family protein	terminase	A0A077K8Q7	Ralstonia_phage	98.5	0.0e+00
WP_016721963.1|1608421_1609261_+|capsid	GPO family capsid scaffolding protein	capsid	A0A077K9W8	Ralstonia_phage	95.0	5.9e-145
WP_011001874.1|1609314_1610331_+|capsid	phage major capsid protein, P2 family	capsid	A0A077KEQ8	Ralstonia_phage	100.0	4.7e-189
WP_058907207.1|1610327_1611050_+|terminase	terminase endonuclease subunit	terminase	A0A077K804	Ralstonia_phage	98.8	4.4e-125
WP_058907235.1|1611147_1611627_+|head	head completion/stabilization protein	head	A0A077K9R2	Ralstonia_phage	100.0	1.0e-85
WP_011001871.1|1611626_1611833_+|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	100.0	1.8e-31
WP_015985092.1|1611848_1612253_+|holin	phage holin family protein	holin	A0A077K9X1	Ralstonia_phage	100.0	2.8e-28
WP_071895448.1|1612249_1612561_+|holin	phage holin family protein	holin	A0A077KER0	Ralstonia_phage	100.0	1.7e-49
WP_016727332.1|1612557_1613364_+	DUF3380 domain-containing protein	NA	A4PE36	Ralstonia_virus	99.6	4.2e-148
WP_058907209.1|1613360_1613861_+	hypothetical protein	NA	A4PE37	Ralstonia_virus	98.2	6.1e-81
WP_071895449.1|1613857_1614304_+|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	98.6	3.6e-77
WP_058907236.1|1614297_1614705_+	phage virion morphogenesis protein	NA	A0A077K9X5	Ralstonia_phage	85.8	1.2e-55
WP_080606388.1|1614876_1616112_+	DUF262 domain-containing protein	NA	A0A0R6PKN1	Moraxella_phage	27.5	2.5e-11
WP_016721978.1|1616104_1616881_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895450.1|1616997_1617615_+|plate	phage baseplate assembly protein V	plate	A4PE41	Ralstonia_virus	96.1	2.4e-111
WP_058907212.1|1617611_1617959_+	GPW/gp25 family protein	NA	A4PE42	Ralstonia_virus	93.9	3.0e-55
WP_069079171.1|1617961_1618870_+|plate	baseplate assembly protein	plate	A0A077K9X9	Ralstonia_phage	97.4	5.0e-158
WP_071895451.1|1618862_1619480_+|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	98.9	3.1e-103
WP_071895452.1|1619484_1621149_+|tail	phage tail protein	tail	A4PE45	Ralstonia_virus	95.8	6.3e-308
WP_058907215.1|1621161_1621914_+	hypothetical protein	NA	A4PE47	Ralstonia_virus	94.4	6.7e-124
WP_058907216.1|1621910_1622375_+	hypothetical protein	NA	A0A077K8R9	Ralstonia_phage	99.4	1.5e-86
WP_058907217.1|1622473_1623649_+|tail	phage tail sheath protein	tail	A0A077K9Y4	Ralstonia_phage	98.7	1.4e-224
WP_011001854.1|1623680_1624190_+|tail	phage major tail tube protein	tail	A0A077KER7	Ralstonia_phage	100.0	8.3e-94
WP_058907237.1|1624265_1624592_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	98.1	2.3e-49
WP_003267618.1|1624588_1624690_+|tail	GpE family phage tail protein	tail	A0A077K821	Ralstonia_phage	93.9	2.7e-09
WP_071895453.1|1624686_1627350_+|tail	phage tail protein	tail	A4PE52	Ralstonia_virus	96.4	0.0e+00
WP_058907219.1|1627352_1627775_+|tail	phage tail protein	tail	A4PE53	Ralstonia_virus	97.9	8.8e-73
WP_058907220.1|1627771_1628896_+	phage late control D family protein	NA	A4PE54	Ralstonia_virus	97.1	7.5e-204
WP_071895454.1|1629208_1629418_+	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	70.4	2.4e-15
WP_016722215.1|1629368_1630118_+	site-specific DNA-methyltransferase	NA	A0A1S5NPU0	Burkholderia_phage	67.2	7.9e-93
WP_071895455.1|1630830_1631181_-	zinc ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_051048313.1|1631243_1631702_-	helix-turn-helix transcriptional regulator	NA	K4NXA8	Burkholderia_phage	52.3	5.8e-22
WP_157798370.1|1631760_1631958_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016722219.1|1631984_1632176_+	hypothetical protein	NA	E5E3U0	Burkholderia_phage	50.9	2.6e-08
WP_016722220.1|1632204_1632399_+	hypothetical protein	NA	A4PE59	Ralstonia_virus	95.3	1.3e-23
WP_028853260.1|1632395_1632644_+	ogr/Delta-like zinc finger family protein	NA	A4PE60	Ralstonia_virus	98.8	3.0e-41
WP_038961828.1|1632758_1632992_+	hypothetical protein	NA	A4PE62	Ralstonia_virus	54.8	9.5e-13
WP_016721654.1|1632988_1633153_+	hypothetical protein	NA	A4PE63	Ralstonia_virus	81.5	1.1e-15
WP_058907222.1|1633149_1633356_+	hypothetical protein	NA	A4PE64	Ralstonia_virus	92.6	4.3e-25
WP_016721678.1|1633355_1633592_+	hypothetical protein	NA	A4PE65	Ralstonia_virus	98.7	3.5e-39
WP_015985122.1|1633584_1633797_+	hypothetical protein	NA	A4PE66	Ralstonia_virus	100.0	6.4e-32
WP_058907223.1|1633829_1636535_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	99.8	0.0e+00
WP_016721680.1|1636531_1636747_+	AlpA family phage regulatory protein	NA	A0A077K9Z8	Ralstonia_phage	100.0	2.4e-34
WP_038961838.1|1636721_1637957_-|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	A0A077KET4	Ralstonia_phage	99.3	8.1e-236
1650115:1650134	attR	GCGGGCGCGCTCGACCGCCT	NA	NA	NA	NA
>prophage 6
NZ_CP052070	Ralstonia solanacearum strain FJAT454.F1 chromosome, complete genome	3944010	1830246	1969806	3944010	transposase,tRNA,integrase,head,terminase,protease,tail,plate,portal,capsid	Pseudomonas_phage(12.96%)	150	1840087:1840103	1901705:1902920
WP_011001577.1|1830246_1831227_+|tRNA	tRNA-dihydrouridine synthase	tRNA	NA	NA	NA	NA
WP_011001578.1|1831293_1832655_+	30S ribosomal protein S12 methylthiotransferase RimO	NA	NA	NA	NA	NA
WP_011001579.1|1832750_1833935_+	acetyl-CoA C-acyltransferase family protein	NA	NA	NA	NA	NA
WP_021154999.1|1833939_1834647_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721794.1|1834689_1835904_+	cystathionine beta-lyase	NA	NA	NA	NA	NA
WP_016721795.1|1835931_1836789_-	phosphoserine phosphatase SerB	NA	NA	NA	NA	NA
WP_016721796.1|1836900_1838094_-	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_023470185.1|1838128_1841560_-	transcription-repair coupling factor	NA	NA	NA	NA	NA
1840087:1840103	attL	CGATGCCGTGCTCGCTG	NA	NA	NA	NA
WP_043885765.1|1841731_1842493_+	2-C-methyl-D-erythritol 4-phosphate cytidylyltransferase	NA	NA	NA	NA	NA
1840087:1840103	attL	CGATGCCGTGCTCGCTG	NA	NA	NA	NA
WP_011001586.1|1842489_1842996_+	2-C-methyl-D-erythritol 2,4-cyclodiphosphate synthase	NA	NA	NA	NA	NA
WP_011001587.1|1843075_1843603_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_016721800.1|1843661_1844210_-	peroxiredoxin	NA	NA	NA	NA	NA
WP_016721801.1|1844386_1845748_-	HAMP domain-containing protein	NA	NA	NA	NA	NA
WP_003267785.1|1845785_1846508_-	two-component system response regulator OmpR	NA	W8CYM9	Bacillus_phage	35.8	1.4e-33
WP_021154996.1|1846787_1847138_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895468.1|1847209_1848826_+	DUF1800 family protein	NA	NA	NA	NA	NA
WP_016721804.1|1848853_1850038_+	DUF1501 domain-containing protein	NA	NA	NA	NA	NA
WP_011001593.1|1850038_1850911_-	presqualene diphosphate synthase HpnD	NA	NA	NA	NA	NA
WP_016721806.1|1851047_1852256_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_016721807.1|1852322_1855442_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_071895469.1|1855681_1856908_-|integrase	site-specific integrase	integrase	A0A1W6JTA0	Pseudomonas_phage	55.0	5.1e-113
WP_016721809.1|1857065_1857260_-	hypothetical protein	NA	W6MWX6	Pseudomonas_phage	74.1	8.0e-05
WP_016721810.1|1857252_1857615_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895470.1|1857611_1859420_-	DNA cytosine methyltransferase	NA	H9C171	Pectobacterium_phage	47.4	1.2e-163
WP_016721813.1|1859416_1859656_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721814.1|1859652_1860177_-	hypothetical protein	NA	A0A2D1GNL9	Pseudomonas_phage	55.5	4.8e-44
WP_071895471.1|1860173_1860650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721816.1|1860646_1861201_-	deoxynucleotide monophosphate kinase	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	48.3	2.8e-34
1860763:1860779	attR	CGATGCCGTGCTCGCTG	NA	NA	NA	NA
WP_071895472.1|1861253_1862105_-	DUF2303 family protein	NA	I6WAZ8	Burkholderia_virus	36.3	1.6e-28
1860763:1860779	attR	CGATGCCGTGCTCGCTG	NA	NA	NA	NA
WP_071091286.1|1862137_1862482_-	hypothetical protein	NA	C5IHK2	Burkholderia_virus	36.5	8.6e-10
WP_016721820.1|1862532_1862739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155773164.1|1862735_1863362_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721822.1|1863358_1863739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155773165.1|1863747_1863903_-	hypothetical protein	NA	NA	NA	NA	NA
WP_081369067.1|1864065_1864554_-	DUF2335 domain-containing protein	NA	NA	NA	NA	NA
WP_016721824.1|1864522_1864765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721825.1|1864866_1865739_-	LexA family transcriptional regulator	NA	A0A0D4DBI5	Acinetobacter_phage	35.6	2.6e-18
WP_016721826.1|1865821_1866046_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016721827.1|1866272_1866782_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721828.1|1866774_1866999_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043945175.1|1866995_1867280_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895474.1|1867276_1869703_+	hypothetical protein	NA	A0A2D1GN57	Marinobacter_phage	39.9	1.3e-75
WP_155773166.1|1870293_1870701_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155773167.1|1870747_1871392_+	hypothetical protein	NA	A0A0K1Y721	Rhodobacter_phage	38.7	2.0e-31
WP_016721870.1|1871667_1872654_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_069079018.1|1872768_1873275_+|terminase	terminase small subunit	terminase	NA	NA	NA	NA
WP_071895476.1|1873297_1875256_+|terminase	phage terminase large subunit family protein	terminase	R9TMM4	Vibrio_phage	42.6	3.4e-127
WP_064048049.1|1875268_1875490_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069079016.1|1875491_1876937_+|portal	phage portal protein	portal	Q75QM9	Wolbachia_phage	41.2	3.9e-80
WP_069079015.1|1877011_1879084_+|head	Mu-like prophage major head subunit gpT family protein	head	B7SYD7	Stenotrophomonas_phage	32.3	2.2e-68
WP_071895477.1|1879167_1879500_+	DUF2190 family protein	NA	A0A2I7QRW1	Vibrio_phage	38.7	1.5e-06
WP_016721840.1|1879499_1879808_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069079013.1|1879804_1880383_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721841.1|1880403_1880634_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_069079012.1|1880633_1882115_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A0C4UQS0	Shigella_phage	45.3	2.0e-103
WP_020371381.1|1882163_1882526_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_016721844.1|1882525_1882855_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_069079011.1|1882934_1884662_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895631.1|1884770_1885010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895478.1|1885267_1886224_+	DNA circularization N-terminal domain-containing protein	NA	Q8SBG8	Shigella_phage	37.3	2.4e-25
WP_016721735.1|1886228_1887194_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155773168.1|1887405_1887624_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895480.1|1887620_1888805_+	hypothetical protein	NA	B5TK72	Pseudomonas_phage	32.6	1.1e-43
WP_081365199.1|1888858_1889377_+|plate	phage baseplate assembly protein	plate	Q8HAB9	Salmonella_phage	48.8	5.8e-34
WP_069079008.1|1889376_1889835_+	phage GP46 family protein	NA	A0A2P9JZK5	Alteromonadaceae_phage	47.4	6.0e-27
WP_071895481.1|1889836_1890889_+|plate	baseplate J/gp47 family protein	plate	B5TK75	Pseudomonas_phage	45.7	1.5e-65
WP_071895482.1|1890879_1891476_+	DUF2313 domain-containing protein	NA	NA	NA	NA	NA
WP_071895483.1|1891472_1892672_+	hypothetical protein	NA	O22004	Shigella_phage	49.3	8.4e-12
WP_016721856.1|1892675_1893161_+	DUF4376 domain-containing protein	NA	NA	NA	NA	NA
WP_016721857.1|1893284_1893776_+	glycoside hydrolase family protein	NA	D5LH07	Escherichia_phage	66.0	3.0e-56
WP_071895484.1|1893776_1894085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069079003.1|1894087_1894354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069079002.1|1894350_1894710_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721915.1|1894833_1895160_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895485.1|1896329_1897367_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_071895486.1|1897803_1898808_+|integrase	site-specific integrase	integrase	A0A0A0YR56	Pseudomonas_phage	50.5	1.7e-66
WP_016721863.1|1898808_1899117_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721865.1|1899628_1900183_-	hypothetical protein	NA	A0A2H4J8A1	uncultured_Caudovirales_phage	46.4	1.1e-33
WP_016721866.1|1900202_1900418_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721867.1|1900423_1900576_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721868.1|1900572_1901013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721869.1|1901009_1901384_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721870.1|1901842_1902829_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_080606383.1|1903496_1904357_-	trypsin-like peptidase domain-containing protein	NA	S5FV10	Shigella_phage	30.4	3.1e-16
WP_016721872.1|1904636_1905332_-	hypothetical protein	NA	A0A2H4J0J9	uncultured_Caudovirales_phage	39.5	6.8e-22
WP_071895489.1|1905406_1905682_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016721873.1|1905951_1906188_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721874.1|1906399_1906915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721875.1|1906911_1907322_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721876.1|1907330_1907528_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895490.1|1907524_1908559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895491.1|1908555_1908852_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895492.1|1908875_1909475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721879.1|1909658_1910033_+	HNH endonuclease	NA	Q38456	Bacillus_phage	52.9	3.1e-29
WP_049832880.1|1910424_1910766_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721881.1|1910810_1912481_+|terminase	terminase large subunit	terminase	C7BGG7	Burkholderia_phage	61.3	6.5e-204
WP_020371382.1|1912482_1912641_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721883.1|1912637_1913861_+|portal	phage portal protein	portal	A0A1J0GUY8	Halomonas_phage	68.8	3.6e-159
WP_016721884.1|1913868_1914480_+|head,protease	HK97 family phage prohead protease	head,protease	A0A1J0GUZ0	Halomonas_phage	63.5	2.1e-59
WP_071895493.1|1914490_1915738_+|capsid	phage major capsid protein	capsid	Q8SBH8	Shigella_phage	56.6	2.4e-126
WP_016721886.1|1915771_1916095_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_016721887.1|1916102_1916429_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_038961918.1|1916431_1916935_+	hypothetical protein	NA	I7GSL4	Xanthomonas_virus	32.7	2.4e-08
WP_016721889.1|1916924_1917278_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016721890.1|1917341_1917995_+|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	50.7	1.4e-53
WP_016721891.1|1918001_1918322_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	41.9	1.9e-11
WP_016721892.1|1918369_1918630_+	DUF1799 domain-containing protein	NA	NA	NA	NA	NA
WP_071895495.1|1918631_1921493_+|tail	phage tail tape measure protein	tail	A0A2H4J107	uncultured_Caudovirales_phage	35.7	8.6e-87
WP_016721894.1|1921495_1921834_+|tail	phage tail protein	tail	Q8W6T5	Burkholderia_virus	47.7	2.1e-21
WP_016721895.1|1921830_1922508_+|tail	tail fiber protein	tail	D5LGZ0	Escherichia_phage	50.6	1.0e-30
WP_016721896.1|1922513_1923110_+|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_071895496.1|1923106_1923808_+|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	62.4	1.0e-78
WP_071895497.1|1923809_1924520_+	C40 family peptidase	NA	D6PG99	uncultured_phage	55.8	2.1e-71
WP_016721899.1|1924523_1925117_+|tail	tail assembly protein	tail	Q8W6T1	Burkholderia_virus	60.4	2.3e-55
WP_038961924.1|1925113_1925452_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_016721901.1|1925444_1925708_-	type II toxin-antitoxin system HicA family toxin	NA	NA	NA	NA	NA
WP_016721902.1|1925760_1928916_+	host specificity protein J	NA	A4JX16	Burkholderia_virus	55.9	0.0e+00
WP_038961925.1|1929252_1929909_+	hypothetical protein	NA	Q7Y5J3	Xanthomonas_virus	28.0	3.1e-08
WP_038961926.1|1929977_1930469_+	glycoside hydrolase family protein	NA	D5LH07	Escherichia_phage	67.1	5.1e-56
WP_016721906.1|1930469_1930778_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895498.1|1930780_1931050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895499.1|1931046_1931406_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895500.1|1931533_1931860_-	type V toxin-antitoxin system endoribonuclease antitoxin GhoS	NA	NA	NA	NA	NA
WP_071895501.1|1932663_1932933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895502.1|1932997_1934035_-	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_155773169.1|1934235_1934469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721870.1|1935194_1936181_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_071895503.1|1937422_1939156_-	AAA family ATPase	NA	NA	NA	NA	NA
WP_011001649.1|1939697_1939892_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020832095.1|1939963_1941937_+|tRNA	bifunctional tRNA (5-methylaminomethyl-2-thiouridine)(34)-methyltransferase MnmD/FAD-dependent 5-carboxymethylaminomethyl-2-thiouridine(34) oxidoreductase MnmC	tRNA	NA	NA	NA	NA
WP_016721979.1|1942191_1943541_+	trigger factor	NA	NA	NA	NA	NA
WP_003267806.1|1943570_1944224_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	54.9	1.8e-53
WP_011001652.1|1944389_1945664_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpX	protease	G3M9Z9	Bacillus_virus	58.9	4.9e-135
WP_011001653.1|1945834_1948255_+	endopeptidase La	NA	A0A0R6PGP8	Moraxella_phage	53.1	4.8e-224
WP_003267811.1|1948428_1948701_+	HU family DNA-binding protein	NA	A4JWM7	Burkholderia_virus	57.3	1.6e-19
WP_011001654.1|1949123_1951070_+	SurA N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_011001655.1|1952573_1953266_-	signal peptidase I	NA	NA	NA	NA	NA
WP_020832084.1|1953342_1953963_-	arylesterase	NA	NA	NA	NA	NA
WP_011001657.1|1954036_1954747_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	42.8	7.4e-40
WP_021156048.1|1954759_1956379_-	glucose-6-phosphate isomerase	NA	NA	NA	NA	NA
WP_069078999.1|1956437_1958033_-	NAD(P)H-hydrate dehydratase	NA	NA	NA	NA	NA
WP_011001660.1|1958108_1958675_+	winged helix DNA-binding protein	NA	NA	NA	NA	NA
WP_016724550.1|1958812_1962922_+	phosphoribosylformylglycinamidine synthase	NA	A9YX36	Burkholderia_phage	72.9	4.4e-177
WP_139233351.1|1963191_1963635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011001663.1|1963804_1963996_+	DUF1843 domain-containing protein	NA	NA	NA	NA	NA
WP_016724551.1|1964062_1964689_+	DUF1842 domain-containing protein	NA	NA	NA	NA	NA
WP_011001665.1|1964740_1965322_+	DUF1842 domain-containing protein	NA	NA	NA	NA	NA
WP_016724552.1|1965418_1966894_+	GDL motif peptide-associated radical SAM/SPASM maturase	NA	NA	NA	NA	NA
WP_069079317.1|1967447_1968581_+	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_071895632.1|1968981_1969806_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
>prophage 7
NZ_CP052070	Ralstonia solanacearum strain FJAT454.F1 chromosome, complete genome	3944010	2153003	2160310	3944010	coat	Ralstonia_phage(100.0%)	12	NA	NA
WP_021155768.1|2153003_2153435_-	DUF29 domain-containing protein	NA	A0A0K2QQ08	Ralstonia_phage	100.0	1.2e-77
WP_074960868.1|2153478_2154192_-	hypothetical protein	NA	A0A097ZIG8	Ralstonia_phage	61.8	2.4e-62
WP_016723073.1|2154325_2155471_-	zonular occludens toxin	NA	E5F074	Ralstonia_phage	99.7	2.9e-219
WP_038962261.1|2155481_2155802_-	DUF2523 domain-containing protein	NA	E5F073	Ralstonia_phage	99.0	2.2e-44
WP_016038713.1|2155798_2157196_-	hypothetical protein	NA	E5F072	Ralstonia_phage	100.0	2.3e-210
WP_016038712.1|2157340_2157550_-|coat	major coat protein	coat	E5F071	Ralstonia_phage	100.0	1.9e-20
WP_016038711.1|2157546_2157786_-	hypothetical protein	NA	E5F070	Ralstonia_phage	100.0	2.0e-37
WP_016038710.1|2157785_2158058_-	hypothetical protein	NA	E5F069	Ralstonia_phage	100.0	7.7e-46
WP_016038709.1|2158057_2158375_-	hypothetical protein	NA	E5F068	Ralstonia_phage	100.0	7.5e-53
WP_038938340.1|2158378_2159512_-	replication initiation factor domain-containing protein	NA	E5F076	Ralstonia_phage	97.4	2.8e-214
WP_043885700.1|2159609_2159816_-	hypothetical protein	NA	S6B968	Ralstonia_phage	97.1	5.6e-33
WP_071895513.1|2159929_2160310_+	Cro/Cl family transcriptional regulator	NA	S6B268	Ralstonia_phage	66.9	4.1e-37
>prophage 8
NZ_CP052070	Ralstonia solanacearum strain FJAT454.F1 chromosome, complete genome	3944010	2536587	2622396	3944010	tRNA,integrase,head,terminase,protease,tail,plate,capsid,portal,holin	Ralstonia_phage(36.96%)	88	2568249:2568273	2610740:2610764
WP_016722163.1|2536587_2537985_-|tRNA	glutamate--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016722164.1|2538158_2539118_+	patatin-like phospholipase family protein	NA	H8ZJB8	Ostreococcus_tauri_virus	28.3	5.0e-07
WP_011001127.1|2539191_2539860_-	C40 family peptidase	NA	NA	NA	NA	NA
WP_021154880.1|2540149_2541814_-	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	32.9	3.2e-17
WP_016722166.1|2541810_2542935_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011001124.1|2542941_2543997_-	microcin C ABC transporter permease YejB	NA	NA	NA	NA	NA
WP_016722167.1|2544015_2545893_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011001122.1|2546158_2546953_+	enoyl-ACP reductase FabI	NA	NA	NA	NA	NA
WP_011001121.1|2547354_2548605_-	aspartate kinase	NA	NA	NA	NA	NA
WP_021154885.1|2548733_2550122_-|tRNA	tRNA lysidine(34) synthetase TilS	tRNA	NA	NA	NA	NA
WP_011001119.1|2550129_2551098_-	acetyl-CoA carboxylase carboxyltransferase subunit alpha	NA	NA	NA	NA	NA
WP_043885999.1|2551184_2552060_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_020831689.1|2552044_2553442_-|tRNA	cysteine--tRNA ligase	tRNA	A0A2K9L6B7	Tupanvirus	31.3	8.0e-38
WP_016722170.1|2553684_2554344_+	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_016722171.1|2554397_2554970_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_019718005.1|2555008_2555515_+	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_016722173.1|2555511_2556318_+	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_016725822.1|2556339_2557086_-	serine O-acetyltransferase	NA	NA	NA	NA	NA
WP_021154887.1|2557222_2558086_-	RNA methyltransferase	NA	NA	NA	NA	NA
WP_011001110.1|2558199_2559012_+	inositol monophosphatase	NA	NA	NA	NA	NA
WP_011001109.1|2559057_2559606_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_071508223.1|2559698_2560427_+	glutamine amidotransferase	NA	NA	NA	NA	NA
WP_028860446.1|2560423_2561149_+	MOSC domain-containing protein	NA	NA	NA	NA	NA
WP_011001106.1|2561157_2562960_-	Tar ligand binding domain-containing protein	NA	NA	NA	NA	NA
WP_021154889.1|2563035_2564907_-	cache domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	62.3	6.1e-09
WP_016722180.1|2565040_2565856_-	2,5-didehydrogluconate reductase DkgB	NA	A0A1V0SDE7	Indivirus	31.7	2.7e-30
WP_011001103.1|2565888_2567091_-	MFS transporter	NA	NA	NA	NA	NA
WP_016725817.1|2567203_2568097_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
2568249:2568273	attL	CAAGCACACGCCGATGATGCAGCAG	NA	NA	NA	NA
WP_071895526.1|2570160_2573022_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.2	2.7e-40
WP_071895527.1|2573032_2575039_+	phospholipase	NA	NA	NA	NA	NA
WP_016723932.1|2575042_2576350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058907760.1|2576371_2576662_+	PAAR domain-containing protein	NA	R4JMI1	Burkholderia_phage	35.6	4.1e-05
WP_071653990.1|2576698_2577346_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016722186.1|2577791_2578130_+	DUF1484 family protein	NA	NA	NA	NA	NA
WP_071895528.1|2578151_2579231_-|portal	phage portal protein	portal	A0A077K9Q8	Ralstonia_phage	92.0	1.8e-194
WP_071895529.1|2579227_2581009_-|terminase	terminase ATPase subunit family protein	terminase	A0A077K8Q7	Ralstonia_phage	91.2	0.0e+00
WP_071895530.1|2581145_2581988_+|capsid	GPO family capsid scaffolding protein	capsid	A4PE29	Ralstonia_virus	77.9	7.0e-122
WP_016722191.1|2582026_2583079_+|capsid	phage major capsid protein, P2 family	capsid	A4PE30	Ralstonia_virus	74.0	4.0e-143
WP_016722192.1|2583075_2583798_+|terminase	terminase endonuclease subunit	terminase	A4PE31	Ralstonia_virus	77.5	8.7e-97
WP_038962045.1|2583895_2584375_+|head	head completion/stabilization protein	head	A4PE32	Ralstonia_virus	84.3	9.6e-68
WP_058907767.1|2584374_2584578_+|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	86.8	7.2e-25
WP_071895531.1|2584593_2585001_+	hypothetical protein	NA	A0A077K9X1	Ralstonia_phage	91.1	3.4e-21
WP_071895532.1|2584997_2585315_+|holin	phage holin family protein	holin	A4PE35	Ralstonia_virus	94.1	5.2e-46
WP_071895533.1|2585311_2586115_+	DUF3380 domain-containing protein	NA	A4PE36	Ralstonia_virus	84.2	3.2e-124
WP_038961971.1|2586111_2586546_+|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	86.8	1.2e-69
WP_071895534.1|2586542_2587013_+	phage virion morphogenesis protein	NA	A0A077K9X5	Ralstonia_phage	81.6	6.1e-59
WP_135005999.1|2586992_2587406_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155773170.1|2587739_2588387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_127591872.1|2588485_2589508_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895535.1|2589808_2590426_+|plate	phage baseplate assembly protein V	plate	A0A077K9S0	Ralstonia_phage	94.6	1.4e-108
WP_071895536.1|2590422_2590770_+	GPW/gp25 family protein	NA	A4PE42	Ralstonia_virus	98.3	1.9e-57
WP_071895537.1|2590772_2591681_+|plate	baseplate assembly protein	plate	A0A077K9X9	Ralstonia_phage	98.7	4.1e-160
WP_071895538.1|2591673_2592291_+|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	95.7	7.2e-100
WP_071895539.1|2592295_2593960_+|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	97.1	8.0e-311
WP_021155104.1|2593972_2594725_+	hypothetical protein	NA	A4PE47	Ralstonia_virus	90.8	4.1e-121
WP_043885739.1|2594721_2595186_+	hypothetical protein	NA	A4PE48	Ralstonia_virus	98.1	1.1e-84
WP_021155106.1|2595279_2596455_+|tail	phage tail sheath protein	tail	A4PE49	Ralstonia_virus	98.2	5.8e-223
WP_016722208.1|2596486_2596996_+|tail	phage major tail tube protein	tail	A0A077KER7	Ralstonia_phage	79.3	9.2e-77
WP_021155107.1|2597071_2597398_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	99.1	8.0e-50
WP_003267618.1|2597394_2597496_+|tail	GpE family phage tail protein	tail	A0A077K821	Ralstonia_phage	93.9	2.7e-09
WP_173877476.1|2597492_2600156_+|tail	phage tail protein	tail	A4PE52	Ralstonia_virus	96.1	0.0e+00
WP_071895541.1|2600158_2600581_+|tail	phage tail protein	tail	A4PE53	Ralstonia_virus	98.6	3.0e-73
WP_071895542.1|2600577_2601705_+	phage late control D family protein	NA	A4PE54	Ralstonia_virus	96.0	4.6e-201
WP_071654013.1|2601815_2602010_+	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	69.2	1.6e-13
WP_071895543.1|2601972_2602839_+	DNA cytosine methyltransferase	NA	A0A1P8DJM9	Virus_Rctr41k	59.2	5.6e-50
WP_127591879.1|2602987_2603356_-	hypothetical protein	NA	A0A077K8S5	Ralstonia_phage	85.1	2.7e-54
WP_080606373.1|2603479_2603950_-	helix-turn-helix transcriptional regulator	NA	A0A077K9Z1	Ralstonia_phage	60.4	9.8e-41
WP_127591882.1|2604023_2604233_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721650.1|2604294_2604543_+	ogr/Delta-like zinc finger family protein	NA	A0A077K829	Ralstonia_phage	82.9	4.7e-34
WP_071895544.1|2604660_2605215_+	Bro-N domain-containing protein	NA	A0A077K9T3	Ralstonia_phage	85.2	8.5e-84
WP_155773171.1|2605225_2605402_+	hypothetical protein	NA	NA	NA	NA	NA
WP_058907787.1|2605401_2605638_+	hypothetical protein	NA	A4PE65	Ralstonia_virus	80.8	5.1e-30
WP_071895545.1|2605630_2605840_+	hypothetical protein	NA	A4PE66	Ralstonia_virus	72.9	5.5e-20
WP_071895546.1|2606254_2608939_+	toprim domain-containing protein	NA	A0A077K8T2	Ralstonia_phage	92.8	0.0e+00
WP_016721659.1|2608998_2609226_+	AlpA family phage regulatory protein	NA	C7BGF0	Burkholderia_phage	73.1	7.6e-23
WP_071895636.1|2609226_2610510_-|integrase	tyrosine-type recombinase/integrase	integrase	C7BGE7	Burkholderia_phage	55.9	4.0e-137
WP_152532532.1|2611265_2611511_-	hypothetical protein	NA	NA	NA	NA	NA
2610740:2610764	attR	CAAGCACACGCCGATGATGCAGCAG	NA	NA	NA	NA
WP_155772886.1|2611964_2613323_+	DNA mismatch repair protein MutS	NA	A0A1V0SC35	Catovirus	30.1	9.8e-25
WP_021154891.1|2613322_2614387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011001099.1|2614442_2614967_-	peptidylprolyl isomerase	NA	NA	NA	NA	NA
WP_011001098.1|2614978_2616208_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_127591883.1|2616382_2616766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721663.1|2616850_2617636_-	MBL fold metallo-hydrolase	NA	A0A0C5AJ83	Bacteriophage	33.5	6.1e-27
WP_016721664.1|2617670_2618867_-	outer membrane protein assembly factor BamC	NA	NA	NA	NA	NA
WP_011001095.1|2618907_2619792_-	4-hydroxy-tetrahydrodipicolinate synthase	NA	NA	NA	NA	NA
WP_016721665.1|2619910_2620483_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_020831674.1|2620502_2621705_-|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_016721667.1|2621718_2622396_-|protease	site-2 protease family protein	protease	NA	NA	NA	NA
>prophage 9
NZ_CP052070	Ralstonia solanacearum strain FJAT454.F1 chromosome, complete genome	3944010	2686896	2759359	3944010	transposase,protease,head,terminase,integrase,tail,capsid,portal	Ralstonia_phage(30.3%)	74	2695310:2695358	2744122:2744170
WP_071895547.1|2686896_2688225_-|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_011001027.1|2688373_2688622_-	GlsB/YeaQ/YmgE family stress response membrane protein	NA	NA	NA	NA	NA
WP_016725123.1|2688652_2689378_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_071012560.1|2689795_2692150_-	CHASE2 domain-containing protein	NA	NA	NA	NA	NA
WP_021154980.1|2692118_2693825_-	FecR domain-containing protein	NA	NA	NA	NA	NA
WP_011001023.1|2693808_2694522_-	response regulator transcription factor	NA	NA	NA	NA	NA
2695310:2695358	attL	TGGAGGCGGGGGTCGGAATCGAACCGGCGTACACGGCTTTGCAGGCCGC	NA	NA	NA	NA
WP_086005111.1|2696172_2696637_+	lysozyme	NA	A0A1S5R1I9	Pseudomonas_phage	39.6	2.5e-20
WP_016724969.1|2697105_2697303_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016724968.1|2697395_2697734_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038962738.1|2697789_2700168_-	DNA-dependent RNA polymerase	NA	A0A2R2ZGE5	Ralstonia_phage	31.1	3.3e-84
WP_016724966.1|2700177_2700363_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016724965.1|2700385_2700730_-	hypothetical protein	NA	A0A127KNZ2	Pseudomonas_phage	51.3	1.4e-20
WP_016724964.1|2700722_2700947_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016724963.1|2700950_2701778_-	ribonuclease H-like domain-containing protein	NA	A0A2P0VPF6	Ralstonia_phage	61.2	3.9e-93
WP_016724962.1|2701774_2702176_-	DNA endonuclease VII	NA	A0A1L7DQG2	Ralstonia_phage	52.7	7.4e-21
WP_051048331.1|2702147_2702864_-	phosphodiesterase	NA	A0A077KVP0	Ralstonia_phage	51.5	7.9e-66
WP_016724960.1|2703348_2704188_-	hypothetical protein	NA	A0A068Q6Y4	Ralstonia_phage	51.0	1.6e-62
WP_080606461.1|2704210_2706586_-	DNA polymerase A family protein	NA	A0A068Q7T8	Ralstonia_phage	62.8	5.0e-290
WP_038962739.1|2706638_2707184_-	metal-dependent phosphohydrolase	NA	A0A1W6JP41	Morganella_phage	50.3	1.1e-32
WP_016724957.1|2707183_2707369_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080606460.1|2707715_2708696_-	ATP-dependent DNA ligase	NA	A0A2H4GY71	Pseudomonas_phage	50.2	3.0e-68
WP_016724955.1|2709733_2711029_-	AAA family ATPase	NA	A0A068Q6G7	Ralstonia_phage	63.1	5.3e-153
WP_081369073.1|2711018_2711570_-	toprim domain-containing protein	NA	A0A077KVN4	Ralstonia_phage	58.1	2.9e-52
WP_016724953.1|2711837_2712119_-	hypothetical protein	NA	Q9ZX17	Mycobacterium_phage	46.9	2.6e-12
WP_016724952.1|2712115_2712424_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020371639.1|2712432_2712609_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016724951.1|2712615_2712981_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038962733.1|2713183_2713417_-	hypothetical protein	NA	B5BTU9	Ralstonia_phage	67.9	1.6e-23
WP_016724949.1|2713424_2713823_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016724948.1|2713822_2714008_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155738951.1|2714220_2714370_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721735.1|2714366_2715332_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_016724947.1|2716302_2716995_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_155773172.1|2717098_2718391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155773173.1|2718357_2718813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_080606458.1|2719059_2719329_+	HNH endonuclease	NA	A0A0U2C119	Paracoccus_phage	48.1	4.6e-11
WP_016721870.1|2719755_2720742_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_016724943.1|2721480_2723070_+|terminase	terminase large subunit	terminase	Q9MCV7	Escherichia_phage	64.3	1.4e-179
WP_080606456.1|2723078_2723711_+|head,protease	HK97 family phage prohead protease	head,protease	A0A0R6PHN0	Moraxella_phage	42.7	6.4e-35
WP_016724941.1|2723720_2725040_+|capsid	phage major capsid protein	capsid	S4TNE3	Salmonella_phage	41.8	1.4e-76
WP_038962726.1|2725287_2726625_+|portal	phage portal protein	portal	S4TTG7	Salmonella_phage	42.0	2.5e-81
WP_016724939.1|2726621_2726921_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_071895552.1|2727151_2727520_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_016724937.1|2727519_2727870_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_016724936.1|2727882_2728314_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016724934.1|2728453_2728789_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895553.1|2728809_2729196_+	DUF4035 domain-containing protein	NA	A0A1W6JP68	Morganella_phage	34.1	2.5e-05
WP_016724932.1|2729116_2729551_+	HK97 gp10 family phage protein	NA	S4TR46	Salmonella_phage	33.8	3.2e-09
WP_071895554.1|2729540_2732351_+	hypothetical protein	NA	C7BGC8	Burkholderia_phage	39.1	1.0e-12
WP_016724929.1|2732355_2732700_+|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	41.8	1.4e-20
WP_016724984.1|2733925_2734606_+|tail	phage minor tail protein L	tail	Q6JIL5	Burkholderia_virus	58.5	1.8e-72
WP_016724983.1|2734602_2735376_+	C40 family peptidase	NA	Q3HQU3	Burkholderia_phage	54.9	2.4e-68
WP_071895555.1|2735336_2735948_+|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	50.5	5.9e-46
WP_071895556.1|2735970_2739675_+	host specificity protein J	NA	A4JX16	Burkholderia_virus	49.7	8.9e-254
WP_038962744.1|2739671_2740031_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155773174.1|2740400_2740676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895557.1|2741257_2741533_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016721870.1|2741957_2742944_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_081369070.1|2743067_2743967_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_016724974.1|2744629_2745205_-	CDP-diacylglycerol--glycerol-3-phosphate 3-phosphatidyltransferase	NA	NA	NA	NA	NA
2744122:2744170	attR	TGGAGGCGGGGGTCGGAATCGAACCGGCGTACACGGCTTTGCAGGCCGC	NA	NA	NA	NA
WP_016725737.1|2745273_2747283_-	excinuclease ABC subunit UvrC	NA	NA	NA	NA	NA
WP_023470298.1|2747365_2748556_+	elongation factor P maturation arginine rhamnosyltransferase EarP	NA	NA	NA	NA	NA
WP_028852870.1|2748678_2749239_+	elongation factor P	NA	NA	NA	NA	NA
WP_016723241.1|2749353_2750406_-	beta-N-acetylhexosaminidase	NA	NA	NA	NA	NA
WP_016723242.1|2750402_2750846_-	holo-ACP synthase	NA	NA	NA	NA	NA
WP_011001016.1|2750842_2751634_-	pyridoxine 5'-phosphate synthase	NA	NA	NA	NA	NA
WP_011001015.1|2751630_2752449_-	DNA repair protein RecO	NA	NA	NA	NA	NA
WP_023470297.1|2752469_2753417_-	GTPase Era	NA	NA	NA	NA	NA
WP_011001013.1|2753413_2754184_-	ribonuclease III	NA	M1H375	Paramecium_bursaria_Chlorella_virus	32.8	1.8e-15
WP_016723244.1|2754186_2754558_-	DUF4845 domain-containing protein	NA	NA	NA	NA	NA
WP_011001011.1|2754623_2755541_-	signal peptidase I	NA	NA	NA	NA	NA
WP_016723245.1|2755574_2757371_-	elongation factor 4	NA	E4ZFJ7	Streptococcus_phage	24.7	7.1e-23
WP_016723246.1|2757569_2757845_-	glutaredoxin family protein	NA	NA	NA	NA	NA
WP_016723247.1|2757841_2759359_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	27.7	4.8e-20
>prophage 10
NZ_CP052070	Ralstonia solanacearum strain FJAT454.F1 chromosome, complete genome	3944010	2882822	2891058	3944010		Planktothrix_phage(16.67%)	8	NA	NA
WP_011000872.1|2882822_2883875_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	2.6e-33
WP_011000871.1|2884031_2884955_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.9	9.3e-43
WP_028852812.1|2885072_2886185_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_011000869.1|2886265_2887168_-	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.8	8.2e-52
WP_016723340.1|2887271_2887589_-	helix-hairpin-helix domain-containing protein	NA	NA	NA	NA	NA
WP_016723341.1|2887718_2888714_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	32.3	4.1e-28
WP_016723342.1|2888710_2889658_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.6	9.0e-17
WP_016723343.1|2889684_2891058_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.9	1.9e-76
>prophage 11
NZ_CP052070	Ralstonia solanacearum strain FJAT454.F1 chromosome, complete genome	3944010	2933938	2948044	3944010	tail	Ralstonia_phage(55.56%)	12	NA	NA
WP_058907694.1|2933938_2934400_-	lysozyme	NA	K4I410	Acidithiobacillus_phage	80.3	4.8e-64
WP_028860336.1|2934396_2934873_-	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	84.2	1.4e-71
WP_016724633.1|2934869_2935160_-	membrane protein	NA	K4I011	Acidithiobacillus_phage	48.8	2.4e-13
WP_058907695.1|2935227_2935452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071508023.1|2935461_2937297_-	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	45.1	1.1e-103
WP_071508022.1|2937301_2937700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016727799.1|2937696_2938179_-	hypothetical protein	NA	A0A0M4TU90	Ralstonia_phage	44.0	1.1e-13
WP_071653957.1|2938182_2939349_-	hypothetical protein	NA	A0A0M5TJJ3	Ralstonia_phage	33.3	7.9e-47
WP_071895561.1|2939360_2942951_-	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	53.5	0.0e+00
WP_016727790.1|2942980_2943553_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016727789.1|2943539_2943935_-	hypothetical protein	NA	A0A0M4UTA7	Ralstonia_phage	53.0	1.6e-31
WP_071653956.1|2943940_2948044_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	28.8	1.4e-26
>prophage 12
NZ_CP052070	Ralstonia solanacearum strain FJAT454.F1 chromosome, complete genome	3944010	2955861	3007569	3944010	transposase,head,terminase,portal,capsid	Acidithiobacillus_phage(45.45%)	58	NA	NA
WP_071653954.1|2955861_2956635_-	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	43.6	3.1e-47
WP_071508048.1|2956757_2957204_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020833003.1|2957209_2957512_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653953.1|2957514_2958519_-|capsid	major capsid protein	capsid	A0A1B2LRS0	Wolbachia_phage	67.5	1.9e-110
WP_071653952.1|2958525_2958903_-|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	48.0	6.7e-24
WP_071653951.1|2958912_2960172_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	43.4	4.6e-61
WP_016725355.1|2960181_2961708_-|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.7	3.4e-151
WP_016725356.1|2961707_2961929_-	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	57.5	1.3e-11
WP_016727772.1|2961929_2962322_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653949.1|2962332_2962842_-	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	44.4	4.8e-25
WP_172833506.1|2962885_2964868_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	86.0	0.0e+00
WP_038962858.1|2964867_2965404_-	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	79.8	4.2e-72
WP_038938655.1|2965423_2965762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624100.1|2965868_2966375_+	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	72.3	4.0e-24
WP_016727890.1|2966504_2967011_+	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	32.9	2.9e-14
WP_038938808.1|2967138_2967489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162904291.1|2967586_2967751_+	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	56.1	1.1e-07
WP_143102330.1|2967799_2968129_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725010.1|2968125_2968506_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_071653948.1|2968488_2969763_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	81.1	6.3e-199
WP_071508043.1|2969759_2971163_-	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	60.5	8.3e-160
WP_058908853.1|2971560_2971968_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016725004.1|2971957_2972167_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895562.1|2972401_2974699_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	72.1	0.0e+00
WP_021156153.1|2974682_2975072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038938742.1|2975077_2975545_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	53.5	5.9e-38
WP_016727900.1|2975554_2976187_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	61.0	3.8e-64
WP_016727901.1|2976205_2977078_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	66.4	2.9e-102
WP_071653946.1|2977074_2977572_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653945.1|2977568_2977859_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_071615617.1|2978606_2980271_+	hypothetical protein	NA	NA	NA	NA	NA
WP_139274347.1|2980288_2981104_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071653944.1|2981272_2982247_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071654078.1|2982243_2983467_-	glycine hydroxymethyltransferase	NA	NA	NA	NA	NA
WP_016722471.1|2984212_2984506_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016722470.1|2984517_2984859_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016722469.1|2984868_2985120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143102314.1|2985726_2986206_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016722467.1|2986260_2986839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155772881.1|2986862_2987078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143102316.1|2987197_2987518_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653943.1|2987601_2988132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071507981.1|2988177_2989002_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143102317.1|2989442_2989763_-	hypothetical protein	NA	NA	NA	NA	NA
WP_143102318.1|2989759_2990389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071615194.1|2992244_2992559_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081369074.1|2993024_2993465_-	LacI family transcriptional regulator	NA	NA	NA	NA	NA
WP_021154705.1|2993497_2994880_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	59.9	4.5e-134
WP_038938302.1|2994876_2995374_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	38.8	9.2e-21
WP_173877478.1|2996387_2997479_-	DUF746 domain-containing protein	NA	NA	NA	NA	NA
WP_071895565.1|2997676_2998513_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_071895566.1|2998530_3000282_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_071895567.1|3000293_3002834_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.8	1.8e-16
WP_071895641.1|3002886_3003255_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723621.1|3003317_3003605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071508020.1|3003898_3005224_+|transposase	IS4 family transposase	transposase	NA	NA	NA	NA
WP_074960860.1|3005564_3006056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723619.1|3006603_3007569_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
>prophage 13
NZ_CP052070	Ralstonia solanacearum strain FJAT454.F1 chromosome, complete genome	3944010	3794086	3857573	3944010	protease,tail,transposase,holin	Klosneuvirus(22.22%)	48	NA	NA
WP_071895614.1|3794086_3795106_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_016722562.1|3795278_3795614_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_043885957.1|3796072_3797797_+	GMC family oxidoreductase N-terminal domain-containing protein	NA	A0A1V0SI18	Klosneuvirus	31.9	1.8e-60
WP_016722564.1|3797814_3798714_-	amino acid ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_016722565.1|3799089_3800763_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_016722566.1|3800849_3801344_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016722567.1|3801364_3801667_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011000085.1|3801741_3802263_-|tail	phage tail protein	tail	A0A2R4A082	Microbacterium_phage	36.0	1.6e-15
WP_016722568.1|3802277_3802811_-|tail	phage tail protein	tail	A0A2R3ZZT3	Microbacterium_phage	32.7	2.6e-13
WP_016722569.1|3802820_3803369_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_071895615.1|3803872_3808891_+	autotransporter domain-containing protein	NA	A0A1W6JQC9	Corynebacterium_phage	52.9	3.9e-10
WP_016722571.1|3808930_3810127_-	nitronate monooxygenase	NA	NA	NA	NA	NA
WP_173877489.1|3810586_3812440_+	phosphomethylpyrimidine synthase ThiC	NA	NA	NA	NA	NA
WP_071895616.1|3812453_3813593_+	FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_013213874.1|3813589_3813817_+	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_011000076.1|3813826_3814654_+	thiazole synthase	NA	NA	NA	NA	NA
WP_028852448.1|3814650_3815802_+	thiamine phosphate synthase	NA	NA	NA	NA	NA
WP_016722575.1|3815928_3816408_+	VOC family protein	NA	A0A2K9L4N3	Tupanvirus	47.8	5.7e-28
WP_038962152.1|3816579_3818016_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016722578.1|3818909_3819734_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155773177.1|3819995_3827684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016722585.1|3827885_3828248_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011000067.1|3828282_3829188_-	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_016722587.1|3829258_3829957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016722588.1|3830038_3831442_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_069079282.1|3831461_3832913_-	alkaline phosphatase	NA	NA	NA	NA	NA
WP_038938143.1|3833279_3833711_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_011000061.1|3833707_3834259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000060.1|3834507_3835932_+	adenosylhomocysteinase	NA	S4VPF6	Pandoravirus	30.0	3.2e-42
WP_011000059.1|3835998_3836340_+|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_011000058.1|3836353_3837184_+	methylenetetrahydrofolate reductase [NAD(P)H]	NA	NA	NA	NA	NA
WP_016722592.1|3837192_3837651_+	TfoX/Sxy family protein	NA	NA	NA	NA	NA
WP_011000056.1|3837742_3838348_-	5-formyltetrahydrofolate cyclo-ligase	NA	NA	NA	NA	NA
WP_028852442.1|3838386_3840339_+	lytic transglycosylase domain-containing protein	NA	A0A0S2SXL7	Bacillus_phage	32.9	6.2e-12
WP_016722594.1|3840500_3841505_+	complex I NDUFA9 subunit family protein	NA	NA	NA	NA	NA
WP_011000053.1|3841696_3842386_+	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_020830861.1|3842382_3843672_+	multifunctional CCA addition/repair protein	NA	A0A0F6YPT7	Sinorhizobium_phage	47.0	1.6e-80
WP_011000051.1|3843675_3844581_-	transporter substrate-binding domain-containing protein	NA	NA	NA	NA	NA
WP_021155371.1|3844656_3845502_-	3-keto-5-aminohexanoate cleavage protein	NA	NA	NA	NA	NA
WP_020830859.1|3845498_3846851_-	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	23.0	2.6e-17
WP_016722598.1|3846881_3847784_-	MurR/RpiR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011000047.1|3847987_3848293_-	hypothetical protein	NA	NA	NA	NA	NA
WP_023469999.1|3848530_3850918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011000045.1|3851294_3852014_-	response regulator	NA	NA	NA	NA	NA
WP_019717341.1|3852050_3854486_-	PAS domain-containing sensor histidine kinase	NA	NA	NA	NA	NA
WP_071895617.1|3854482_3855283_-	DUF4390 domain-containing protein	NA	NA	NA	NA	NA
WP_011000042.1|3855296_3856622_-	16S rRNA (cytosine(967)-C(5))-methyltransferase RsmB	NA	NA	NA	NA	NA
WP_011000041.1|3856712_3857573_-|protease	zinc metalloprotease HtpX	protease	NA	NA	NA	NA
>prophage 1
NZ_CP052071	Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence	2074832	29663	41755	2074832		Ralstonia_phage(42.86%)	11	NA	NA
WP_071895885.1|29663_32321_+	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	85.3	0.0e+00
WP_038962083.1|32323_33139_+	hypothetical protein	NA	A0A077KEQ4	Ralstonia_phage	68.7	7.8e-94
WP_071895835.1|33135_35367_+	DUF3274 domain-containing protein	NA	A0A077K801	Ralstonia_phage	84.6	0.0e+00
WP_016722308.1|35363_35684_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020829481.1|35692_35959_+	PAAR domain-containing protein	NA	R9U4D0	Rhizobium_phage	56.5	3.1e-07
WP_020829482.1|36582_36849_+	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	51.9	1.7e-13
WP_016722315.1|36866_37586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020829484.1|37609_37828_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016722316.1|37875_38103_+	ogr/Delta-like zinc finger family protein	NA	E5E3P1	Burkholderia_phage	51.7	6.7e-11
WP_016722318.1|38619_38943_+	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
WP_020829487.1|38953_41755_+	toprim domain-containing protein	NA	A0A1S5NPU9	Burkholderia_phage	50.6	7.0e-251
>prophage 2
NZ_CP052071	Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence	2074832	699678	731202	2074832	transposase	Ralstonia_phage(27.27%)	31	NA	NA
WP_016721735.1|699678_700644_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|700640_700790_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081326716.1|702713_703085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011003870.1|703432_704005_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895711.1|704395_705058_+	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	60.5	4.3e-66
WP_155773180.1|705190_705439_+	hypothetical protein	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	86.1	8.5e-36
WP_016725469.1|705435_705711_+	site-specific DNA-methyltransferase	NA	K4HZA5	Acidithiobacillus_phage	78.5	1.2e-27
WP_071895715.1|705717_706269_-	type III effector HopH1	NA	NA	NA	NA	NA
WP_016721735.1|706344_707310_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|707306_707456_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723834.1|708298_708508_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723835.1|708809_710255_-|transposase	IS1182 family transposase	transposase	NA	NA	NA	NA
WP_118888231.1|710671_712297_-	caspase family protein	NA	NA	NA	NA	NA
WP_071895717.1|712306_712621_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016721870.1|713468_714455_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_016721735.1|714612_715578_+|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_155738951.1|715574_715724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895718.1|716680_716869_-	peptidoglycan-binding protein	NA	NA	NA	NA	NA
WP_016723839.1|716984_717674_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_014631877.1|717712_718075_-	DUF1304 domain-containing protein	NA	NA	NA	NA	NA
WP_011004587.1|718204_718921_+	dienelactone hydrolase family protein	NA	NA	NA	NA	NA
WP_021156145.1|718959_720582_-	NAD(P)/FAD-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_016723841.1|720595_722173_-	polyamine aminopropyltransferase	NA	A0A1C9C533	Heterosigma_akashiwo_virus	27.0	5.5e-11
WP_020830396.1|722303_723014_-	ABC transporter ATP-binding protein	NA	W6JKT0	Anomala_cuprea_entomopoxvirus	24.4	5.0e-12
WP_019719996.1|723010_723760_-	ABC transporter ATP-binding protein	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	1.6e-16
WP_019719997.1|723756_724725_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_014631870.1|724721_725591_-	branched-chain amino acid ABC transporter permease	NA	NA	NA	NA	NA
WP_016726288.1|725639_726899_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_074960931.1|727851_729150_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139180419.1|729313_729700_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086005097.1|730052_731202_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	60.7	5.9e-95
>prophage 3
NZ_CP052071	Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence	2074832	1095213	1106108	2074832	transposase	Ralstonia_phage(25.0%)	10	NA	NA
WP_023470149.1|1095213_1096689_+|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_016723619.1|1096895_1097861_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_019719026.1|1098009_1098225_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_043885730.1|1098121_1098901_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	33.5	4.9e-29
WP_074960884.1|1099248_1100139_+	VacJ family lipoprotein	NA	NA	NA	NA	NA
WP_155773181.1|1100384_1101476_+	type III effector protein	NA	NA	NA	NA	NA
WP_016721870.1|1101552_1102539_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_155773182.1|1103986_1104604_-|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	49.2	2.9e-48
WP_071895761.1|1104854_1105868_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_071508531.1|1105898_1106108_-|transposase	IS3 family transposase	transposase	NA	NA	NA	NA
>prophage 4
NZ_CP052071	Ralstonia solanacearum strain FJAT454.F1 plasmid Plas1, complete sequence	2074832	1272263	1322966	2074832	tRNA,transposase,plate	uncultured_Caudovirales_phage(28.57%)	35	NA	NA
WP_016723213.1|1272263_1274216_-|tRNA	class I tRNA ligase family protein	tRNA	A0A1V0SK04	Klosneuvirus	24.7	5.2e-43
WP_016723214.1|1274202_1275744_-	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_016723215.1|1275968_1277978_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_020371709.1|1278119_1278674_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016723217.1|1278885_1279602_-	autoinducer binding domain-containing protein	NA	NA	NA	NA	NA
WP_139233336.1|1280947_1281232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723220.1|1281368_1281650_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052331358.1|1281767_1282724_-	hypothetical protein	NA	NA	NA	NA	NA
WP_161632306.1|1282922_1283891_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071508464.1|1285062_1286727_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173877498.1|1286742_1289763_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	23.0	8.3e-16
WP_011004065.1|1289900_1290647_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021155949.1|1290933_1291782_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011004063.1|1291821_1292091_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	1.8e-10
WP_071508536.1|1292101_1293589_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071895778.1|1293626_1297568_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_016723230.1|1297564_1298551_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_011004059.1|1298553_1299387_+	OmpA family protein	NA	NA	NA	NA	NA
WP_038962315.1|1299485_1300454_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038962316.1|1300526_1301606_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_016723233.1|1301739_1303083_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_016723234.1|1303079_1303838_-	hypothetical protein	NA	NA	NA	NA	NA
WP_038962317.1|1303842_1304226_-	hypothetical protein	NA	NA	NA	NA	NA
WP_155773183.1|1304463_1304790_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723619.1|1305543_1306509_-|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_071895632.1|1306731_1307556_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_144061949.1|1307618_1308068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_038962318.1|1308077_1309196_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086005103.1|1309214_1310017_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016723619.1|1310142_1311108_+|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_043885652.1|1313382_1314516_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_020830185.1|1314533_1317290_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.6	2.1e-37
WP_020830186.1|1317310_1320028_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.0	4.5e-85
WP_020371627.1|1320060_1321152_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_016724833.1|1321115_1322966_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
