The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP052128	Ralstonia solanacearum strain FJAT1303.F1 chromosome, complete genome	3649900	198889	218657	3649900		Acidithiobacillus_phage(94.12%)	24	NA	NA
WP_119417463.1|198889_199363_-	hypothetical protein	NA	K4I1C7	Acidithiobacillus_phage	52.6	1.5e-36
WP_119417464.1|199359_199734_-	site-specific recombinase resolvase	NA	K4HZX2	Acidithiobacillus_phage	64.6	2.1e-41
WP_119889762.1|199730_201119_-	recombinase family protein	NA	K4ICM1	Acidithiobacillus_phage	82.1	7.8e-219
WP_119889763.1|201115_201565_-	DUF2924 domain-containing protein	NA	K4I3X1	Acidithiobacillus_phage	71.6	6.7e-55
WP_080511075.1|201564_201783_-	hypothetical protein	NA	K4HZ94	Acidithiobacillus_phage	60.3	1.3e-11
WP_043876685.1|201934_202609_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011003129.1|202608_202896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_100226524.1|202950_204111_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119889764.1|204240_206478_-	hypothetical protein	NA	K4I1D0	Acidithiobacillus_phage	66.2	1.2e-290
WP_089190379.1|206527_206989_-	helix-turn-helix domain-containing protein	NA	K4ICM4	Acidithiobacillus_phage	61.4	8.4e-45
WP_089190378.1|207217_207481_+	DNA-binding protein	NA	K4I3X3	Acidithiobacillus_phage	69.3	5.3e-20
WP_028852742.1|207491_207974_+	hypothetical protein	NA	K4HZ96	Acidithiobacillus_phage	58.7	5.2e-45
WP_071507378.1|207970_208831_+	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	71.3	3.4e-108
WP_029240163.1|208827_209469_+	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	72.8	3.0e-80
WP_071507376.1|209476_209953_+	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	64.4	7.4e-52
WP_071507375.1|209952_210690_+	hypothetical protein	NA	K4HZA0	Acidithiobacillus_phage	76.6	5.4e-110
WP_011003118.1|210686_210947_+	DNA-binding protein	NA	K4I1D6	Acidithiobacillus_phage	62.0	5.5e-17
WP_119889765.1|210943_213232_+	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	63.5	1.2e-285
WP_016725339.1|213362_213827_+	hypothetical protein	NA	K4ICN3	Acidithiobacillus_phage	67.6	1.0e-53
WP_011003115.1|213828_214038_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725340.1|214030_214414_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725341.1|214468_214735_+	type II toxin-antitoxin system ParD family antitoxin	NA	NA	NA	NA	NA
WP_011003112.1|214734_215034_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_071624071.1|215984_218657_+	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	32.0	6.1e-87
>prophage 2
NZ_CP052128	Ralstonia solanacearum strain FJAT1303.F1 chromosome, complete genome	3649900	222935	268795	3649900	transposase,protease	uncultured_Caudovirales_phage(27.27%)	35	NA	NA
WP_086005097.1|222935_224085_+|transposase	IS3 family transposase	transposase	U5P429	Shigella_phage	60.7	5.9e-95
WP_071624171.1|224178_225525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016724179.1|225978_226317_+	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
WP_038962522.1|226374_226665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016726935.1|226793_227315_-	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	61.9	1.2e-23
WP_071624170.1|227521_228487_+|protease	YopT-type cysteine protease domain-containing protein	protease	NA	NA	NA	NA
WP_016725019.1|228715_228910_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	68.6	1.4e-17
WP_011003098.1|228925_229162_+	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	82.3	1.6e-20
WP_043897660.1|230748_232212_-	MFS transporter	NA	NA	NA	NA	NA
WP_016726931.1|232261_233068_-	oxidoreductase	NA	NA	NA	NA	NA
WP_038938210.1|233160_234621_-	TolC family protein	NA	NA	NA	NA	NA
WP_020371869.1|234708_235323_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011003094.1|235410_236526_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_020371868.1|236522_239645_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_157048852.1|240300_240603_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071615479.1|240841_241528_+	TolC family protein	NA	NA	NA	NA	NA
WP_019717165.1|241931_242669_-	SDR family NAD(P)-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_071624190.1|242917_243742_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011003086.1|243799_244336_+	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	50.3	1.8e-46
WP_158594538.1|244494_245127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011003084.1|245451_245676_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624189.1|245742_246033_+	hypothetical protein	NA	K4I011	Acidithiobacillus_phage	47.6	5.3e-13
WP_011003082.1|246029_246512_+	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	71.6	4.8e-59
WP_089190464.1|246582_247699_+|transposase	IS3 family transposase	transposase	S5WIU1	Leptospira_phage	40.4	8.9e-48
WP_038962648.1|247769_248219_+	HNH endonuclease	NA	A0A290FZR9	Caldibacillus_phage	48.9	2.8e-21
WP_119889901.1|248215_248677_+	lysozyme	NA	K4I410	Acidithiobacillus_phage	79.6	1.9e-65
WP_019719020.1|248744_249041_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011003078.1|249092_249425_-	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
WP_071624202.1|258630_259020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624201.1|259147_259393_+	hypothetical protein	NA	NA	NA	NA	NA
WP_158594539.1|259396_262939_+	DUF637 domain-containing protein	NA	NA	NA	NA	NA
WP_081365364.1|262935_263391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_119889766.1|263433_263622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624187.1|264268_265225_-|transposase	IS5 family transposase	transposase	A0A1V0E8E1	Vibrio_phage	43.4	3.3e-59
WP_071624208.1|267286_268795_+|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
>prophage 3
NZ_CP052128	Ralstonia solanacearum strain FJAT1303.F1 chromosome, complete genome	3649900	313634	410179	3649900	head,integrase,portal,holin,capsid,plate,tail,transposase,terminase	Ralstonia_virus(52.94%)	103	370755:370800	410218:410263
WP_016721735.1|313634_314600_-|transposase	IS5 family transposase	transposase	A0A077K814	Ralstonia_phage	98.1	1.6e-178
WP_016724416.1|314666_315467_-	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_071623927.1|315688_316942_-	MFS transporter	NA	NA	NA	NA	NA
WP_016727293.1|317132_317681_-	N-acetyltransferase	NA	NA	NA	NA	NA
WP_058908550.1|317760_318390_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_020832947.1|318493_319489_-	2-hydroxyacid dehydrogenase	NA	M1I636	Acanthocystis_turfacea_Chlorella_virus	44.3	1.8e-60
WP_011003020.1|319553_320579_-	alcohol dehydrogenase AdhP	NA	A0A0G2YAX3	Acanthamoeba_polyphaga_mimivirus	28.3	4.3e-33
WP_058908549.1|320646_322560_-	sigma-54-dependent Fis family transcriptional regulator	NA	NA	NA	NA	NA
WP_058908548.1|322810_324331_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_058908547.1|324414_325809_+	ethanolamine ammonia-lyase subunit EutB	NA	NA	NA	NA	NA
WP_071623926.1|325805_326630_+	ethanolamine ammonia-lyase subunit EutC	NA	NA	NA	NA	NA
WP_016724407.1|326656_328126_+	exodeoxyribonuclease I	NA	NA	NA	NA	NA
WP_081365346.1|328227_328815_+	type VI secretion system amidase effector protein Tae4	NA	NA	NA	NA	NA
WP_071623925.1|328702_329125_+	type VI secretion system amidase immunity protein Tai4	NA	NA	NA	NA	NA
WP_071623924.1|329377_332941_-	indolepyruvate ferredoxin oxidoreductase family protein	NA	NA	NA	NA	NA
WP_071623923.1|333593_334277_-	pyridoxamine 5'-phosphate oxidase family protein	NA	NA	NA	NA	NA
WP_016727299.1|334373_335840_+	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_158594540.1|335867_336020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071623922.1|336047_337337_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071623921.1|339326_340538_-	type II secretion system inner membrane protein GspF	NA	NA	NA	NA	NA
WP_028853770.1|340539_342096_-	type II secretion system ATPase GspE	NA	NA	NA	NA	NA
WP_020832934.1|342130_344548_-	type II secretion system secretin GspD	NA	NA	NA	NA	NA
WP_071623920.1|344581_345433_-	type II secretion system protein N	NA	NA	NA	NA	NA
WP_028861093.1|345436_346015_-	type II secretion system protein M	NA	NA	NA	NA	NA
WP_020832932.1|346026_347457_-	general secretion pathway protein GspL	NA	NA	NA	NA	NA
WP_071623919.1|347598_348657_-	type II secretion system minor pseudopilin GspK	NA	NA	NA	NA	NA
WP_071623918.1|348658_349381_-	prepilin-type N-terminal cleavage/methylation domain-containing protein	NA	NA	NA	NA	NA
WP_019718950.1|349361_349769_-	type II secretion system minor pseudopilin GspI	NA	NA	NA	NA	NA
WP_011002998.1|349765_350263_-	GspH/FimT family pseudopilin	NA	NA	NA	NA	NA
WP_165590622.1|350299_350767_-	type II secretion system major pseudopilin GspG	NA	NA	NA	NA	NA
WP_020832927.1|350942_351629_+	general secretion pathway protein GspC	NA	NA	NA	NA	NA
WP_011002995.1|351761_352346_+	EF-hand domain-containing protein	NA	NA	NA	NA	NA
WP_020371910.1|352437_353541_-	4-hydroxyphenylpyruvate dioxygenase	NA	NA	NA	NA	NA
WP_011002993.1|353701_354190_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_071623917.1|354521_356516_+	S8 family serine peptidase	NA	NA	NA	NA	NA
WP_011002991.1|356578_356974_-	SgcJ/EcaC family oxidoreductase	NA	NA	NA	NA	NA
WP_011002990.1|357103_357592_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_011002989.1|357810_358506_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_020425264.1|358905_359454_+	NAD(P)H-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_028861088.1|359487_361386_+	glutathione-regulated potassium-efflux system protein KefC	NA	NA	NA	NA	NA
WP_155772864.1|361407_362193_-	cellulose 1,4-beta-cellobiosidase	NA	NA	NA	NA	NA
WP_011002985.1|362375_363170_-	DUF1835 domain-containing protein	NA	NA	NA	NA	NA
WP_071507735.1|363367_364675_+	M20/M25/M40 family metallo-hydrolase	NA	NA	NA	NA	NA
WP_011002983.1|364847_365126_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011002982.1|365615_366746_+	porin	NA	NA	NA	NA	NA
WP_019718938.1|366876_367902_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_011002980.1|367905_368610_-	two-component system response regulator KdpE	NA	NA	NA	NA	NA
WP_011002979.1|368692_369004_-	high-potential iron-sulfur protein	NA	NA	NA	NA	NA
WP_011002978.1|369774_370113_+	DUF1484 domain-containing protein	NA	NA	NA	NA	NA
370755:370800	attL	TTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAG	NA	NA	NA	NA
WP_167800885.1|370976_371291_+	hypothetical protein	NA	NA	NA	NA	NA
WP_069079176.1|371345_372767_+	dNTP triphosphohydrolase	NA	NA	NA	NA	NA
WP_081326696.1|373284_373695_+	PAAR domain-containing protein	NA	A4PE23	Ralstonia_virus	98.5	1.7e-65
WP_167814717.1|373696_374200_+	DUF4123 domain-containing protein	NA	A4PE24	Ralstonia_virus	98.2	2.9e-91
WP_157774204.1|374209_375142_+	hypothetical protein	NA	A4PE25	Ralstonia_virus	96.5	2.0e-162
WP_028861084.1|375051_375867_+	immunity 52 family protein	NA	A4PE26	Ralstonia_virus	97.8	3.3e-153
WP_167800886.1|375851_376958_-|portal	phage portal protein	portal	A4PE27	Ralstonia_virus	97.6	6.2e-211
WP_167800887.1|376954_378736_-|terminase	terminase ATPase subunit family protein	terminase	A0A077K8Q7	Ralstonia_phage	98.0	0.0e+00
WP_043897836.1|378877_379723_+|capsid	GPO family capsid scaffolding protein	capsid	A4PE29	Ralstonia_virus	95.7	1.3e-147
WP_011001874.1|379776_380793_+|capsid	phage major capsid protein, P2 family	capsid	A0A077KEQ8	Ralstonia_phage	100.0	4.7e-189
WP_020832909.1|380789_381512_+|terminase	terminase endonuclease subunit	terminase	A0A077K804	Ralstonia_phage	100.0	3.6e-127
WP_043897946.1|381608_382088_+|head	head completion/stabilization protein	head	A4PE32	Ralstonia_virus	98.1	4.3e-84
WP_011001871.1|382087_382294_+|tail	tail protein X	tail	A0A077K8R0	Ralstonia_phage	100.0	1.8e-31
WP_015985092.1|382309_382714_+|holin	phage holin family protein	holin	A0A077K9X1	Ralstonia_phage	100.0	2.8e-28
WP_020832906.1|382710_383022_+|holin	phage holin family protein	holin	A0A077KER0	Ralstonia_phage	100.0	5.9e-50
WP_167800889.1|383018_383825_+	DUF3380 domain-containing protein	NA	A4PE36	Ralstonia_virus	98.9	7.9e-147
WP_167800890.1|383821_384322_+	hypothetical protein	NA	A4PE37	Ralstonia_virus	94.0	4.1e-77
WP_015985096.1|384318_384753_+|tail	phage tail protein	tail	A0A077K8R3	Ralstonia_phage	100.0	2.9e-79
WP_167800891.1|384749_385199_+	phage virion morphogenesis protein	NA	A0A077K9X5	Ralstonia_phage	92.6	1.8e-68
WP_173941083.1|385262_385877_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173941084.1|386065_387157_-	MBL fold metallo-hydrolase	NA	Q332C0	Clostridium_botulinum_C_phage	22.9	1.1e-05
WP_069079172.1|387577_388195_+|plate	phage baseplate assembly protein V	plate	A4PE41	Ralstonia_virus	94.1	2.5e-108
WP_058907212.1|388191_388539_+	GPW/gp25 family protein	NA	A4PE42	Ralstonia_virus	93.9	3.0e-55
WP_069079171.1|388541_389450_+|plate	baseplate assembly protein	plate	A0A077K9X9	Ralstonia_phage	97.4	5.0e-158
WP_069079170.1|389442_390060_+|tail	phage tail protein I	tail	A0A077KER5	Ralstonia_phage	96.2	1.1e-100
WP_069079169.1|390066_391734_+|tail	phage tail protein	tail	A0A077K818	Ralstonia_phage	90.0	3.5e-282
WP_069079168.1|391746_392499_+|tail	phage tail protein	tail	A0A077K9S5	Ralstonia_phage	94.4	1.8e-124
WP_069079167.1|392495_392960_+	hypothetical protein	NA	A0A077K8R9	Ralstonia_phage	99.4	6.9e-87
WP_069079166.1|393058_394234_+|tail	phage tail sheath protein	tail	A0A077K9Y4	Ralstonia_phage	99.0	4.7e-225
WP_011001854.1|394265_394775_+|tail	phage major tail tube protein	tail	A0A077KER7	Ralstonia_phage	100.0	8.3e-94
WP_038962052.1|394850_395177_+|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	98.1	1.8e-49
WP_011001852.1|395173_395275_+|tail	GpE family phage tail protein	tail	A0A077K821	Ralstonia_phage	97.0	2.1e-09
WP_173941085.1|395271_397935_+|tail	phage tail protein	tail	A4PE52	Ralstonia_virus	96.6	0.0e+00
WP_016727346.1|397937_398360_+|tail	phage tail protein	tail	A4PE53	Ralstonia_virus	97.1	1.5e-72
WP_173941086.1|398356_399484_+	phage late control D family protein	NA	A4PE54	Ralstonia_virus	95.5	1.3e-200
WP_071615623.1|399796_400006_+	Com family DNA-binding transcriptional regulator	NA	A0A1S5NPS9	Burkholderia_phage	70.4	2.4e-15
WP_167814664.1|399956_400739_+	site-specific DNA-methyltransferase	NA	A0A1S5NPU0	Burkholderia_phage	68.2	1.3e-93
WP_167814665.1|400654_401401_-	hypothetical protein	NA	A4PE55	Ralstonia_virus	94.4	5.6e-123
WP_080705229.1|401562_402039_-	helix-turn-helix transcriptional regulator	NA	E5E3P4	Burkholderia_phage	45.7	1.8e-26
WP_021155113.1|402282_402474_+	hypothetical protein	NA	E5E3U0	Burkholderia_phage	50.9	3.4e-08
WP_016722220.1|402502_402697_+	hypothetical protein	NA	A4PE59	Ralstonia_virus	95.3	1.3e-23
WP_028853260.1|402693_402942_+	ogr/Delta-like zinc finger family protein	NA	A4PE60	Ralstonia_virus	98.8	3.0e-41
WP_043885741.1|403056_403290_+	hypothetical protein	NA	A4PE62	Ralstonia_virus	52.6	4.7e-12
WP_021155116.1|403286_403451_+	hypothetical protein	NA	A4PE63	Ralstonia_virus	96.3	5.1e-21
WP_167814666.1|403447_403654_+	hypothetical protein	NA	A4PE64	Ralstonia_virus	86.8	2.6e-22
WP_043885743.1|403677_403890_+	hypothetical protein	NA	A4PE65	Ralstonia_virus	98.6	8.1e-35
WP_023470166.1|403882_404095_+	hypothetical protein	NA	A4PE66	Ralstonia_virus	94.3	2.3e-29
WP_167814667.1|404114_404423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725460.1|404424_404646_+	hypothetical protein	NA	A4PE67	Ralstonia_virus	100.0	1.3e-35
WP_016725461.1|404642_404915_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725462.1|404911_405202_+	hypothetical protein	NA	A4PE68	Ralstonia_virus	95.8	1.4e-50
WP_167814668.1|405201_408006_+	toprim domain-containing protein	NA	A4PE69	Ralstonia_virus	99.1	0.0e+00
WP_155773158.1|407992_408166_+	hypothetical protein	NA	NA	NA	NA	NA
WP_015985128.1|409096_410179_+|integrase	site-specific integrase	integrase	A4PE72	Ralstonia_virus	100.0	2.7e-211
410218:410263	attR	TTGGCGCGCCCGGCTGGGATCGAACCAGCAACCCCTGCCTTCGGAG	NA	NA	NA	NA
>prophage 4
NZ_CP052128	Ralstonia solanacearum strain FJAT1303.F1 chromosome, complete genome	3649900	847327	895417	3649900	coat,protease	Lactobacillus_phage(16.67%)	44	NA	NA
WP_011002605.1|847327_847831_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_058907884.1|847880_848384_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_049842205.1|848502_849222_+	molecular chaperone	NA	NA	NA	NA	NA
WP_058907885.1|849271_851536_+	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_172833515.1|851553_852042_+|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_011002600.1|852111_852654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016723690.1|853259_854204_+	hydrogen peroxide-inducible genes activator	NA	A0A2P0ZL89	Lactobacillus_phage	23.9	4.0e-09
WP_058907886.1|854422_854671_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011002597.1|854729_854972_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003271865.1|855130_855631_+	DNA starvation/stationary phase protection protein	NA	A0A2H4N7L5	Lake_Baikal_phage	36.2	2.1e-20
WP_011002596.1|855704_856580_+	4-hydroxybenzoate octaprenyltransferase	NA	NA	NA	NA	NA
WP_058907887.1|856576_856855_-	hypothetical protein	NA	NA	NA	NA	NA
WP_028853591.1|856876_857701_-	pyrroline-5-carboxylate reductase	NA	NA	NA	NA	NA
WP_011002593.1|857735_858458_-	YggS family pyridoxal phosphate-dependent enzyme	NA	NA	NA	NA	NA
WP_011002592.1|858582_859626_+	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_011002591.1|859678_860818_+	PilT/PilU family type 4a pilus ATPase	NA	NA	NA	NA	NA
WP_016723685.1|861012_861453_+	type IV pilin protein	NA	NA	NA	NA	NA
WP_016723684.1|861456_861945_+	GspH/FimT family pseudopilin	NA	NA	NA	NA	NA
WP_028860948.1|861941_862532_+	type IV pilus modification protein PilV	NA	NA	NA	NA	NA
WP_016723683.1|862528_863557_+	PilW family protein	NA	NA	NA	NA	NA
WP_011002586.1|863560_864097_+	pilus assembly PilX N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_071623704.1|864128_867341_+	pilus assembly protein	NA	NA	NA	NA	NA
WP_011002584.1|867436_867934_+	glutathione peroxidase	NA	Q6VZR0	Canarypox_virus	40.2	5.5e-26
WP_016723680.1|867950_868649_-	YafY family transcriptional regulator	NA	NA	NA	NA	NA
WP_016726000.1|868691_869171_-	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_016723678.1|869221_869617_-	VOC family protein	NA	NA	NA	NA	NA
WP_028853586.1|869774_870497_-	LrgB family protein	NA	NA	NA	NA	NA
WP_058907889.1|870493_870871_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_058907890.1|870922_872170_-	glycolate oxidase subunit GlcF	NA	NA	NA	NA	NA
WP_058907891.1|872179_873298_-	glycolate oxidase subunit GlcE	NA	NA	NA	NA	NA
WP_058907892.1|873308_874802_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_058907893.1|874972_875863_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011002574.1|875873_877292_-	FAD-binding protein	NA	NA	NA	NA	NA
WP_020832612.1|877412_877970_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_011002572.1|878043_878940_-	mechanosensitive ion channel family protein	NA	NA	NA	NA	NA
WP_058907894.1|879224_879560_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_011002570.1|879683_880763_-	3-deoxy-7-phosphoheptulonate synthase AroG	NA	A0A2I6UFP9	Klebsiella_phage	45.0	1.1e-76
WP_058907895.1|881155_882616_-|protease	metalloprotease TldD	protease	NA	NA	NA	NA
WP_011002568.1|882643_883513_-	carbon-nitrogen hydrolase family protein	NA	M1H5W0	Paramecium_bursaria_Chlorella_virus	25.3	8.3e-09
WP_071623705.1|883518_887799_-	TIGR02099 family protein	NA	NA	NA	NA	NA
WP_071623706.1|887978_890846_+	bifunctional [glutamate--ammonia ligase]-adenylyl-L-tyrosine phosphorylase/[glutamate--ammonia-ligase] adenylyltransferase	NA	NA	NA	NA	NA
WP_011002565.1|890842_891463_+	rhombosortase	NA	NA	NA	NA	NA
WP_020832604.1|891518_893570_-|protease	MprA protease, GlyGly-CTERM protein-sorting domain-containing form	protease	A0A1B0T6A2	Bacillus_phage	34.7	6.1e-10
WP_043897787.1|893785_895417_-|protease	MprA protease, GlyGly-CTERM protein-sorting domain-containing form	protease	NA	NA	NA	NA
>prophage 5
NZ_CP052128	Ralstonia solanacearum strain FJAT1303.F1 chromosome, complete genome	3649900	910576	920715	3649900		Hokovirus(14.29%)	9	NA	NA
WP_021155204.1|910576_912538_+	molecular chaperone DnaK	NA	A0A1V0SH73	Hokovirus	50.8	1.4e-149
WP_011002544.1|912672_913815_+	molecular chaperone DnaJ	NA	A0A0P0YMJ9	Yellowstone_lake_phycodnavirus	32.7	2.9e-22
WP_028860933.1|913850_915731_+	bifunctional anthranilate synthase component I family protein/class IV aminotransferase	NA	A0A0B5J984	Pandoravirus	37.4	4.6e-57
WP_058907902.1|915686_916373_-	energy-coupling factor ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	27.2	8.8e-14
WP_011002541.1|916380_917088_-	ABC transporter permease	NA	NA	NA	NA	NA
WP_011002540.1|917099_917924_-	3-methyl-2-oxobutanoate hydroxymethyltransferase	NA	A0A0N7HVJ8	Ostreococcus_lucimarinus_virus	31.3	1.9e-34
WP_011002539.1|917980_918625_-	deoxynucleoside kinase	NA	M1IA15	Paramecium_bursaria_Chlorella_virus	27.8	1.7e-06
WP_003271964.1|918658_919168_-	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_020832586.1|919167_920715_-	polynucleotide adenylyltransferase PcnB	NA	H7BUW3	unidentified_phage	33.6	3.6e-23
>prophage 6
NZ_CP052128	Ralstonia solanacearum strain FJAT1303.F1 chromosome, complete genome	3649900	1960527	1972876	3649900	coat,transposase	Ralstonia_phage(76.92%)	15	NA	NA
WP_010889950.1|1960527_1960959_-	DUF29 domain-containing protein	NA	A0JC30	Ralstonia_phage	100.0	7.1e-78
WP_010889951.1|1961000_1961627_-	hypothetical protein	NA	A0JC29	Ralstonia_phage	100.0	6.2e-107
WP_071653928.1|1962549_1963374_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_015984160.1|1963682_1963958_-	DUF2523 domain-containing protein	NA	A0JC27	Ralstonia_phage	100.0	4.3e-36
WP_071623619.1|1963954_1965190_-	hypothetical protein	NA	S6BAK4	Ralstonia_phage	99.8	2.4e-211
WP_010889942.1|1965269_1965605_-	hypothetical protein	NA	A0JC24	Ralstonia_phage	100.0	1.6e-56
WP_015984157.1|1965604_1965874_-|coat	major coat protein	coat	A0JC23	Ralstonia_phage	100.0	4.9e-37
WP_010889944.1|1965873_1966185_-	hypothetical protein	NA	A0JC22	Ralstonia_phage	100.0	8.2e-52
WP_015984156.1|1966189_1967317_-	replication initiation factor domain-containing protein	NA	A0JC21	Ralstonia_phage	100.0	1.3e-219
WP_015984155.1|1967316_1967523_-	hypothetical protein	NA	A0JC20	Ralstonia_phage	100.0	2.8e-32
WP_089190813.1|1967639_1968032_+	helix-turn-helix transcriptional regulator	NA	S6B268	Ralstonia_phage	100.0	4.8e-65
WP_038938487.1|1968730_1970245_+	deoxyribodipyrimidine photo-lyase	NA	A0A2H4UV63	Bodo_saltans_virus	27.8	4.6e-47
WP_043885799.1|1970492_1970747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908721.1|1970853_1972476_-	chaperonin GroEL	NA	A0A240F779	uncultured_virus	60.8	5.2e-174
WP_016727460.1|1972558_1972876_-	co-chaperone GroES	NA	A0A221S322	uncultured_virus	47.9	1.8e-17
>prophage 7
NZ_CP052128	Ralstonia solanacearum strain FJAT1303.F1 chromosome, complete genome	3649900	2598026	2606262	3649900		Planktothrix_phage(16.67%)	8	NA	NA
WP_011000872.1|2598026_2599079_-	methionine ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	39.4	2.6e-33
WP_011000871.1|2599235_2600159_-	histone deacetylase family protein	NA	A0A2K9KZC4	Tupanvirus	35.9	9.3e-43
WP_058907684.1|2600276_2601389_+	lytic murein transglycosylase B	NA	NA	NA	NA	NA
WP_011000869.1|2601469_2602372_-	cysteine synthase CysM	NA	A0A1X9I5K7	Streptococcus_phage	40.8	8.2e-52
WP_011000868.1|2602475_2602793_-	ComEA family DNA-binding protein	NA	NA	NA	NA	NA
WP_011000867.1|2602922_2603918_-	ADP-glyceromanno-heptose 6-epimerase	NA	R9S880	Prochlorococcus_phage	32.3	4.1e-28
WP_049842162.1|2603914_2604862_-	D-glycero-beta-D-manno-heptose-7-phosphate kinase	NA	A0A2H4N7X4	Lake_Baikal_phage	27.6	9.0e-17
WP_016723343.1|2604888_2606262_-	UDP-glucose/GDP-mannose dehydrogenase family protein	NA	A0A127AXI2	Bacillus_phage	38.9	1.9e-76
>prophage 8
NZ_CP052128	Ralstonia solanacearum strain FJAT1303.F1 chromosome, complete genome	3649900	2649143	2705973	3649900	head,portal,capsid,tail,transposase,terminase	Acidithiobacillus_phage(37.93%)	57	NA	NA
WP_058907694.1|2649143_2649605_-	lysozyme	NA	K4I410	Acidithiobacillus_phage	80.3	4.8e-64
WP_028860336.1|2649601_2650078_-	hypothetical protein	NA	K4ICR8	Acidithiobacillus_phage	84.2	1.4e-71
WP_016724633.1|2650074_2650365_-	membrane protein	NA	K4I011	Acidithiobacillus_phage	48.8	2.4e-13
WP_058907695.1|2650432_2650657_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071508023.1|2650666_2652502_-	hypothetical protein	NA	A0A0M4UKC5	Ralstonia_phage	45.1	1.1e-103
WP_071508022.1|2652506_2652905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016727799.1|2652901_2653384_-	hypothetical protein	NA	A0A0M4TU90	Ralstonia_phage	44.0	1.1e-13
WP_071653957.1|2653387_2654554_-	hypothetical protein	NA	A0A0M5TJJ3	Ralstonia_phage	33.3	7.9e-47
WP_071895561.1|2654565_2658156_-	hypothetical protein	NA	A0A0M4U447	Ralstonia_phage	53.5	0.0e+00
WP_016727790.1|2658185_2658758_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016727789.1|2658744_2659140_-	hypothetical protein	NA	A0A0M4UTA7	Ralstonia_phage	53.0	1.6e-31
WP_119889844.1|2659145_2663249_-|tail	phage tail tape measure protein	tail	A0A0P0ZCJ4	Stx2-converting_phage	28.8	1.4e-26
WP_165858489.1|2663432_2664590_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071654080.1|2664695_2665784_-	DNA cytosine methyltransferase	NA	Q6J1P4	Burkholderia_virus	54.5	1.8e-98
WP_016727755.1|2666408_2666696_+	H-NS histone family protein	NA	NA	NA	NA	NA
WP_173940953.1|2667284_2669603_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071507988.1|2669985_2670630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071507989.1|2670604_2670826_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071507990.1|2670822_2671212_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653954.1|2671220_2671994_-	hypothetical protein	NA	A0A2D2W2E0	Stenotrophomonas_phage	43.6	3.1e-47
WP_071508048.1|2672116_2672563_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020833003.1|2672568_2672871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653953.1|2672873_2673878_-|capsid	major capsid protein	capsid	A0A1B2LRS0	Wolbachia_phage	67.5	1.9e-110
WP_071653952.1|2673884_2674262_-|head	head decoration protein	head	A0A1B2LRT0	Wolbachia_phage	48.0	6.7e-24
WP_071653951.1|2674271_2675531_-	S49 family peptidase	NA	K4HZZ6	Acidithiobacillus_phage	43.4	4.6e-61
WP_016725355.1|2675540_2677067_-|portal	phage portal protein	portal	A0A1B2LRR5	Wolbachia_phage	57.7	3.4e-151
WP_016725356.1|2677066_2677288_-	hypothetical protein	NA	A0A2H4JCJ9	uncultured_Caudovirales_phage	57.5	1.3e-11
WP_016727772.1|2677288_2677681_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071653949.1|2677691_2678201_-	hypothetical protein	NA	A0A0F6WCR7	Sinorhizobium_phage	44.4	4.8e-25
WP_172833506.1|2678244_2680227_-|terminase	phage terminase large subunit family protein	terminase	A0A2H4JIC6	uncultured_Caudovirales_phage	86.0	0.0e+00
WP_038962858.1|2680226_2680763_-	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	79.8	4.2e-72
WP_038938655.1|2680782_2681121_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624100.1|2681227_2681734_+	DUF3489 domain-containing protein	NA	A0A2H4JE21	uncultured_Caudovirales_phage	72.3	4.0e-24
WP_016727890.1|2681863_2682370_+	DUF3489 domain-containing protein	NA	K4HZZ2	Acidithiobacillus_phage	32.9	2.9e-14
WP_038938808.1|2682497_2682848_+	hypothetical protein	NA	NA	NA	NA	NA
WP_162904291.1|2682945_2683110_+	hypothetical protein	NA	K4HZY7	Acidithiobacillus_phage	56.1	1.1e-07
WP_016725011.1|2683191_2683488_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016725010.1|2683484_2683865_+	DUF86 domain-containing protein	NA	NA	NA	NA	NA
WP_071653948.1|2683847_2685122_-	site-specific DNA-methyltransferase	NA	A0A2H4JGF1	uncultured_Caudovirales_phage	81.1	6.3e-199
WP_071508043.1|2685118_2686522_-	site-specific DNA-methyltransferase	NA	K4I3Y2	Acidithiobacillus_phage	60.5	8.3e-160
WP_119889845.1|2686748_2687987_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	31.7	4.7e-34
WP_071895574.1|2688830_2689238_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016725004.1|2689227_2689437_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895575.1|2689646_2691953_-	hypothetical protein	NA	K4HZY1	Acidithiobacillus_phage	59.7	1.2e-269
WP_071895576.1|2691936_2692326_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895577.1|2692331_2692799_-	hypothetical protein	NA	K4I3X7	Acidithiobacillus_phage	53.9	1.6e-38
WP_071895578.1|2692808_2693441_-	hypothetical protein	NA	K4ICM8	Acidithiobacillus_phage	61.4	2.7e-62
WP_021156151.1|2693458_2694331_-	ATP-binding protein	NA	K4HZX9	Acidithiobacillus_phage	65.7	2.4e-101
WP_021156150.1|2694327_2694825_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071895579.1|2694821_2695106_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016724993.1|2695527_2696133_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_119889847.1|2697308_2698310_+	NADP-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_058908754.1|2698738_2699713_-	hypothetical protein	NA	NA	NA	NA	NA
WP_043885812.1|2699709_2700933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051048318.1|2701330_2702437_-	type III secretion system YopJ family effector PopP1	NA	NA	NA	NA	NA
WP_058908849.1|2703320_2704220_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086004752.1|2705171_2705973_+|transposase	IS5-like element IS1421 family transposase	transposase	NA	NA	NA	NA
>prophage 9
NZ_CP052128	Ralstonia solanacearum strain FJAT1303.F1 chromosome, complete genome	3649900	3342724	3411969	3649900	transposase,integrase	Pseudomonas_phage(28.57%)	58	3370096:3370155	3414498:3415363
WP_016723619.1|3342724_3343690_+|transposase	IS5-like element IS1405 family transposase	transposase	A0A077K814	Ralstonia_phage	100.0	5.8e-181
WP_119889909.1|3344120_3348449_+	calcium-binding protein	NA	NA	NA	NA	NA
WP_119889860.1|3348678_3350151_+	nucleoside hydrolase	NA	NA	NA	NA	NA
WP_011000211.1|3350176_3351031_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_016722398.1|3351214_3352147_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_016722397.1|3352359_3353046_+	hydrolase	NA	NA	NA	NA	NA
WP_016722396.1|3353139_3353430_+	XapX domain-containing protein	NA	NA	NA	NA	NA
WP_016722395.1|3353444_3353882_+	DoxX family protein	NA	NA	NA	NA	NA
WP_016722394.1|3353886_3355725_+	amidohydrolase	NA	NA	NA	NA	NA
WP_016722393.1|3355714_3356425_+	DUF1275 domain-containing protein	NA	NA	NA	NA	NA
WP_023470360.1|3357067_3360367_-	methylmalonyl-CoA mutase family protein	NA	NA	NA	NA	NA
WP_011000203.1|3360722_3361793_+	hypothetical protein	NA	NA	NA	NA	NA
WP_011000202.1|3361974_3362331_+	DUF427 domain-containing protein	NA	NA	NA	NA	NA
WP_021155912.1|3362880_3363627_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_043885959.1|3363753_3364734_+	DMT family transporter	NA	NA	NA	NA	NA
WP_016722476.1|3364890_3365697_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011000198.1|3366115_3366751_+	LysE family translocator	NA	NA	NA	NA	NA
WP_011000197.1|3366758_3367955_+	low temperature requirement protein A	NA	NA	NA	NA	NA
WP_071624164.1|3368172_3369381_-	PLP-dependent aminotransferase family protein	NA	NA	NA	NA	NA
WP_080705157.1|3369696_3369975_-	hypothetical protein	NA	NA	NA	NA	NA
3370096:3370155	attL	AGAGCCGCTAACACAACTGGACATGGAGCGAGGCAAACCGTATCGTGCGGGGCATGTCGA	NA	NA	NA	NA
WP_087451503.1|3370148_3370953_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011000193.1|3371550_3372594_-	RNA 3'-terminal phosphate cyclase	NA	NA	NA	NA	NA
WP_071507869.1|3372636_3373482_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	44.8	4.7e-49
WP_173941089.1|3374650_3375076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173941090.1|3375062_3376958_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_173941091.1|3376954_3378577_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173941092.1|3378579_3379755_-|integrase	site-specific integrase	integrase	NA	NA	NA	NA
WP_173941093.1|3379751_3380102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173941094.1|3380660_3381134_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_173941095.1|3381354_3382239_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173941096.1|3382850_3383330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_173941097.1|3383898_3385200_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173941098.1|3385382_3386387_+	hypothetical protein	NA	NA	NA	NA	NA
WP_043885831.1|3387107_3388640_-	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.7	7.9e-31
WP_173941099.1|3389715_3390411_+	SOS response-associated peptidase family protein	NA	Q8W6R8	Burkholderia_virus	38.5	2.8e-36
WP_173941100.1|3390891_3391461_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173941101.1|3391509_3392616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173941102.1|3393122_3394814_+	RNA-directed DNA polymerase	NA	NA	NA	NA	NA
WP_173941103.1|3394803_3395526_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173941104.1|3395732_3395981_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173941105.1|3395995_3396313_+	SMI1/KNR4 family protein	NA	NA	NA	NA	NA
WP_173941106.1|3396387_3396795_+	hypothetical protein	NA	NA	NA	NA	NA
WP_173941107.1|3396835_3398272_-	RtcB family protein	NA	A2RQD0	Archaeal_BJ1_virus	45.2	6.4e-107
WP_173941109.1|3398299_3398719_-	archease	NA	NA	NA	NA	NA
WP_011000190.1|3399218_3399602_-	zinc-ribbon domain-containing protein	NA	NA	NA	NA	NA
WP_020830945.1|3399870_3401478_+	sigma 54-dependent transcriptional regulator	NA	NA	NA	NA	NA
WP_019717404.1|3401523_3402435_-	patatin-like phospholipase family protein	NA	NA	NA	NA	NA
WP_021155918.1|3402587_3403058_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_058908344.1|3403085_3403445_-	acylphosphatase	NA	NA	NA	NA	NA
WP_011000185.1|3403557_3404001_-	hypothetical protein	NA	NA	NA	NA	NA
WP_162494300.1|3404201_3404432_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908343.1|3404464_3405454_-	aldo/keto reductase	NA	NA	NA	NA	NA
WP_072633633.1|3405513_3406743_-	Bcr/CflA family multidrug efflux MFS transporter	NA	NA	NA	NA	NA
WP_011000182.1|3407137_3407965_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_058908325.1|3408023_3408890_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071624213.1|3409551_3411123_-|transposase	IS66 family transposase	transposase	S5VTD3	Leptospira_phage	36.2	1.3e-73
WP_103025506.1|3411154_3411505_-	IS66 family insertion sequence element accessory protein TnpB	NA	S5VXZ8	Leptospira_phage	44.3	7.1e-20
WP_103025505.1|3411504_3411969_-|transposase	transposase	transposase	NA	NA	NA	NA
3414498:3415363	attR	AGAGCCGCTAACACAACTGGACATGGAGCGAGGCAAACCGTATCGTGCGGGGCATGTCGAGAAGAAGAATCAGCAAGGAATTGTGGGCGGTGCTTGAATCGTTGATACCGGAATTCGTGCCGTCGGCCAAAGGCGGACGCCGCCGCTCGGTCGACGACAGAGCGGCATTGAACGGCATCCTGTTCGTGCTGCAGACCGGTATCCCTTGGGAGGACTTGCCCCAGGAGCTTGGTTTTGGCAGCGGCATGACTTGCTGGCGACGGCTGCGCGACTGGCAAGCCGCTGGGGTATGGGACAAGCTGCATGTGGCGATGCTTGGCCGCCTGCGCGAGCATGATCAAATCGACTGGAGCCGGGCCAGCATCGACGGGGCAAGCGTGTCCAGCCCCCGGGGGGCCAGGAAACCGGCCCGAACCCGACTGATCGAGGCAAGCTCGGCAGCAAACGACACCTTGTCGTAGACGCCCAGGGTATTCCACTGGCCGTCACGGTGACCAGCGCGAACCGGCACGATTCGATCGCGTTCGAATCCACCCTGGACACCATCCCGGCGGTTCGCGGGTTGGATGGACGTCCTCGTAAGCGGCCCGACAAGCTCCATGCCGACAAAGGGTACGACTGCCGCCGATGCCGGCGCTATCTGAAGCGCCGTGGTATCACCGCCCGCATCGCCCGTATCGGTGTTGAAGGCAAGCAGCGACTGGGCCGGCATCGATGGGTTGTTGAGCGCACGCATGCTTGGTTTGCCGGCTTCGGCAAGCTACGCATCCGCTTCGAACGACGACTCGATATTCACACCGCGCTCCTTTCACTCGCCGCTGCAATCATCTGTTCTCGATTCGTAGATGACTTGTGTTAGCGGCTCT	NA	NA	NA	NA
>prophage 1
NZ_CP052129	Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence	2051206	1177670	1231438	2051206	plate,transposase,tRNA	uncultured_Caudovirales_phage(33.33%)	35	NA	NA
WP_071624136.1|1177670_1179623_-|tRNA	class I tRNA ligase family protein	tRNA	A0A1V0SK04	Klosneuvirus	24.5	3.4e-42
WP_071624137.1|1179609_1181151_-	PLP-dependent transferase	NA	NA	NA	NA	NA
WP_016723215.1|1181375_1183385_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_019719459.1|1183526_1184081_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_016723217.1|1184292_1185009_-	autoinducer binding domain-containing protein	NA	NA	NA	NA	NA
WP_139233336.1|1186354_1186639_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016723220.1|1186774_1187056_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058907494.1|1187173_1188130_-	hypothetical protein	NA	NA	NA	NA	NA
WP_158594559.1|1188328_1189246_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071624139.1|1189338_1191003_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119889935.1|1191018_1194039_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	22.8	1.9e-15
WP_021155950.1|1194176_1194923_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021155949.1|1195209_1196058_+	M15 family metallopeptidase	NA	NA	NA	NA	NA
WP_011004063.1|1196097_1196367_+	PAAR domain-containing protein	NA	A4JWV5	Burkholderia_virus	49.4	1.8e-10
WP_020830172.1|1196377_1197865_+	hypothetical protein	NA	NA	NA	NA	NA
WP_020830173.1|1197902_1201832_+	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_019719447.1|1201828_1202815_+	type VI secretion system-associated protein TagF	NA	NA	NA	NA	NA
WP_011004059.1|1202817_1203651_+	OmpA family protein	NA	NA	NA	NA	NA
WP_043898207.1|1203749_1204718_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071624176.1|1204790_1205870_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_016725644.1|1206003_1207347_-	glycoside hydrolase family 10 protein	NA	NA	NA	NA	NA
WP_019719442.1|1208099_1208483_-	hypothetical protein	NA	NA	NA	NA	NA
WP_045579185.1|1209266_1210064_-	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	35.6	2.9e-32
WP_071624208.1|1210053_1211562_-|transposase	IS21 family transposase	transposase	NA	NA	NA	NA
WP_058908884.1|1214236_1214875_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_011003443.1|1215208_1216540_-|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
WP_071653888.1|1216621_1217446_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_058908010.1|1217477_1218551_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119889934.1|1218563_1221341_-	hypothetical protein	NA	NA	NA	NA	NA
WP_089191096.1|1221318_1222452_-	DUF4123 domain-containing protein	NA	NA	NA	NA	NA
WP_071623901.1|1222469_1225226_-	type VI secretion system tip protein VgrG	NA	A0A2H4JCD4	uncultured_Caudovirales_phage	25.5	3.5e-37
WP_028861634.1|1225246_1227964_-	type VI secretion system ATPase TssH	NA	A0A2I7SAX5	Vibrio_phage	32.0	4.5e-85
WP_058908679.1|1227996_1229088_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_058908678.1|1229051_1230902_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_011004044.1|1230964_1231438_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
>prophage 2
NZ_CP052129	Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence	2051206	1656464	1703922	2051206	transposase	uncultured_Caudovirales_phage(25.0%)	24	NA	NA
WP_011003443.1|1656464_1657796_-|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
WP_087451503.1|1658180_1658985_+|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_071653928.1|1659011_1659836_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_011003443.1|1659944_1661276_+|transposase	IS701-like element ISRso17 family transposase	transposase	NA	NA	NA	NA
WP_028854568.1|1661777_1663409_+	MCP four helix bundle domain-containing protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.1	6.7e-20
WP_058908595.1|1663656_1666254_+	2-oxoglutarate dehydrogenase E1 component	NA	NA	NA	NA	NA
WP_011004615.1|1666924_1667827_-	acyltransferase	NA	NA	NA	NA	NA
WP_058908594.1|1667939_1668962_-	FAD:protein FMN transferase	NA	NA	NA	NA	NA
WP_011004617.1|1668966_1669374_-	cytochrome c5 family protein	NA	NA	NA	NA	NA
WP_058908593.1|1669602_1671543_+	nitrous-oxide reductase	NA	NA	NA	NA	NA
WP_071624145.1|1671600_1674219_+	regulatory protein NosR	NA	NA	NA	NA	NA
WP_016727950.1|1674215_1675487_+	nitrous oxide reductase family maturation protein NosD	NA	NA	NA	NA	NA
WP_019719967.1|1675470_1676415_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	33.7	1.3e-28
WP_016724593.1|1676411_1677236_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_058908591.1|1677232_1677763_+	nitrous oxide reductase accessory protein NosL	NA	NA	NA	NA	NA
WP_071624144.1|1678182_1685721_+	type III effector protein skwp2	NA	NA	NA	NA	NA
WP_139274363.1|1696104_1696350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016721870.1|1696686_1697673_+|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_149079313.1|1697792_1698188_+	hypothetical protein	NA	NA	NA	NA	NA
WP_071653902.1|1698426_1700121_+	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_011004625.1|1700451_1700754_-	AzlD family protein	NA	NA	NA	NA	NA
WP_089191141.1|1700750_1701491_-	AzlC family ABC transporter permease	NA	NA	NA	NA	NA
WP_016725410.1|1701621_1702080_+	Lrp/AsnC family transcriptional regulator	NA	NA	NA	NA	NA
WP_089190850.1|1702556_1703922_+|transposase	IS3 family transposase	transposase	A0A1B1P773	Bacillus_phage	53.8	7.2e-76
>prophage 3
NZ_CP052129	Ralstonia solanacearum strain FJAT1303.F1 plasmid Plas1, complete sequence	2051206	1847714	1915927	2051206	coat,protease,transposase	Bacillus_virus(16.67%)	55	NA	NA
WP_058907856.1|1847714_1848692_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_058907837.1|1848688_1851082_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_086005454.1|1851081_1851765_-	molecular chaperone	NA	NA	NA	NA	NA
WP_011004747.1|1851854_1852376_-|coat	spore coat U domain-containing protein	coat	NA	NA	NA	NA
WP_016723579.1|1852878_1853463_-	SCO family protein	NA	NA	NA	NA	NA
WP_071623712.1|1853459_1854251_-	formylglycine-generating enzyme family protein	NA	NA	NA	NA	NA
WP_023470340.1|1854270_1855764_-	nitrite reductase, copper-containing	NA	NA	NA	NA	NA
WP_011004751.1|1856040_1856343_+	DUF2249 domain-containing protein	NA	NA	NA	NA	NA
WP_011004752.1|1856386_1858657_+	nitric-oxide reductase large subunit	NA	NA	NA	NA	NA
WP_071013739.1|1858915_1859638_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_071013744.1|1859696_1860482_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	38.3	3.9e-34
WP_011004755.1|1860471_1861368_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_019719871.1|1861415_1862456_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_011004757.1|1862489_1862888_+	DUF488 domain-containing protein	NA	NA	NA	NA	NA
WP_019719870.1|1863384_1864788_+	diguanylate cyclase	NA	A0A127AWB9	Bacillus_phage	38.6	2.3e-21
WP_011004758.1|1864973_1865192_+	DUF1059 domain-containing protein	NA	NA	NA	NA	NA
WP_058907842.1|1865299_1865998_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_016726400.1|1866079_1866517_-	multidrug/biocide efflux PACE transporter	NA	NA	NA	NA	NA
WP_021155502.1|1866630_1867515_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_011004762.1|1867591_1867984_-	RidA family protein	NA	NA	NA	NA	NA
WP_011004763.1|1867980_1868952_-	threo-3-hydroxy-L-aspartate ammonia-lyase	NA	NA	NA	NA	NA
WP_058907843.1|1868948_1869593_-	transcriptional regulator	NA	NA	NA	NA	NA
WP_058907844.1|1869795_1870332_+	signal peptide protein	NA	NA	NA	NA	NA
WP_058907845.1|1870439_1872143_+	SulP family inorganic anion transporter	NA	NA	NA	NA	NA
WP_020371802.1|1872151_1872850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021155598.1|1872964_1874788_-	virulence factor family protein	NA	NA	NA	NA	NA
WP_064048021.1|1874784_1877436_-	bifunctional lysylphosphatidylglycerol flippase/synthetase MprF	NA	NA	NA	NA	NA
WP_014632055.1|1877768_1877957_-	hypothetical protein	NA	NA	NA	NA	NA
WP_020371516.1|1878302_1879820_+	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_043885669.1|1880019_1881729_+|protease	rhomboid family intramembrane serine protease	protease	NA	NA	NA	NA
WP_020371804.1|1882303_1883629_+	DUF3500 domain-containing protein	NA	Q7Y402	Yersinia_phage	46.8	2.6e-06
WP_016723603.1|1883654_1884905_+	HupE/UreJ family protein	NA	NA	NA	NA	NA
WP_038937972.1|1885067_1885589_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058907853.1|1885938_1886976_+	isopenicillin N synthase family oxygenase	NA	NA	NA	NA	NA
WP_043885670.1|1887089_1889237_-	multicopper oxidase family protein	NA	NA	NA	NA	NA
WP_016725441.1|1889851_1890319_-	DUF2846 domain-containing protein	NA	NA	NA	NA	NA
WP_028854671.1|1890318_1890705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_119889925.1|1890950_1891796_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_089190929.1|1891808_1893578_-	ShlB/FhaC/HecB family hemolysin secretion/activation protein	NA	NA	NA	NA	NA
WP_058908831.1|1893582_1894197_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908826.1|1894294_1896835_-	filamentous hemagglutinin N-terminal domain-containing protein	NA	A0A0R6PJK4	Moraxella_phage	30.8	2.4e-16
WP_058908832.1|1896884_1897253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071615618.1|1898082_1898436_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071615620.1|1898600_1898807_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908828.1|1898855_1899374_-	DUF2247 family protein	NA	NA	NA	NA	NA
WP_016721870.1|1899515_1900502_-|transposase	IS5 family transposase	transposase	E5E3P6	Burkholderia_phage	81.7	7.6e-152
WP_139274349.1|1900636_1901065_-	hypothetical protein	NA	NA	NA	NA	NA
WP_058908830.1|1901122_1901365_-	hypothetical protein	NA	NA	NA	NA	NA
WP_139274350.1|1901354_1901705_-	hypothetical protein	NA	NA	NA	NA	NA
WP_087451503.1|1901736_1902542_-|transposase	IS5 family transposase	transposase	NA	NA	NA	NA
WP_016725060.1|1911679_1911895_+	hypothetical protein	NA	NA	NA	NA	NA
WP_028854674.1|1912121_1912634_+	DUF1993 family protein	NA	NA	NA	NA	NA
WP_011004795.1|1912791_1913121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_011004797.1|1913902_1914265_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016725057.1|1914454_1915927_-|protease	DegQ family serine endoprotease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	29.3	1.6e-25
