The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054353	Escherichia coli strain SCU-172 chromosome, complete genome	5170495	589708	664898	5170495	protease,integrase,tRNA,transposase,holin	Vibrio_phage(17.65%)	59	610007:610022	656628:656643
WP_001162171.1|589708_591061_+|protease	metalloprotease PmbA	protease	NA	NA	NA	NA
WP_001232240.1|591243_591630_+	cytochrome b562	NA	NA	NA	NA	NA
WP_001106222.1|591674_592139_-	anaerobic ribonucleoside-triphosphate reductase-activating protein	NA	H6WXC9	Vibrio_phage	59.7	1.1e-52
WP_000187778.1|592296_594435_-	anaerobic ribonucleoside-triphosphate reductase	NA	A0A2I7QNQ7	Vibrio_phage	64.5	1.5e-266
WP_001344094.1|594828_596484_-	alpha,alpha-phosphotrehalase	NA	NA	NA	NA	NA
WP_074148765.1|596533_597955_-	PTS trehalose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_001181330.1|598073_599021_-	HTH-type transcriptional regulator TreR	NA	C6ZCU4	Enterobacteria_phage	21.8	4.6e-13
WP_001387276.1|599205_599259_+	mgtA regulatory leader peptide MgtL	NA	NA	NA	NA	NA
WP_174183195.1|599399_602096_+	magnesium-translocating P-type ATPase	NA	M1HLC0	Paramecium_bursaria_Chlorella_virus	27.4	9.0e-46
WP_000047539.1|602301_602688_-	2-iminobutanoate/2-iminopropanoate deaminase	NA	NA	NA	NA	NA
WP_000148581.1|602760_603222_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_000013046.1|603234_604170_-	aspartate carbamoyltransferase	NA	M1HWF9	Paramecium_bursaria_Chlorella_virus	40.2	2.9e-52
WP_001296693.1|604173_604308_-	pyr operon leader peptide	NA	NA	NA	NA	NA
WP_000230265.1|604588_604984_-	RidA family protein	NA	NA	NA	NA	NA
WP_000500710.1|605114_605828_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_000256663.1|605898_606492_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000583467.1|606636_607089_+	toxin-antitoxin biofilm protein TabA	NA	NA	NA	NA	NA
WP_096951991.1|607211_609020_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000012907.1|609075_610080_-	ornithine carbamoyltransferase	NA	NA	NA	NA	NA
610007:610022	attL	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_000002953.1|610241_610658_+	ribonuclease E inhibitor RraB	NA	NA	NA	NA	NA
WP_001059398.1|610703_611207_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000079674.1|611399_612596_+	DUF898 domain-containing protein	NA	NA	NA	NA	NA
WP_000416379.1|612651_615507_-|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	36.7	1.0e-140
WP_174183196.1|615506_615950_-	DNA polymerase III subunit chi	NA	NA	NA	NA	NA
WP_000397144.1|616303_617815_-	leucyl aminopeptidase	NA	Q6GYZ8	Mycoplasma_phage	38.0	6.0e-47
WP_000584107.1|618081_619182_+	LPS export ABC transporter permease LptF	NA	NA	NA	NA	NA
WP_001295681.1|619181_620264_+	LPS export ABC transporter permease LptG	NA	NA	NA	NA	NA
WP_001294551.1|620398_621928_-	DUF853 domain-containing protein	NA	A0A248XCZ8	Klebsiella_phage	44.6	8.1e-84
WP_001300014.1|622055_623075_-	NADPH-dependent aldehyde reductase Ahr	NA	A0A0G2Y405	Acanthamoeba_polyphaga_mimivirus	30.4	1.9e-44
WP_000843538.1|623889_625098_+	DNA cytosine methyltransferase	NA	A7XXH6	Thermus_virus	28.2	3.7e-31
WP_000147098.1|625094_625745_+	Eco29kI family restriction endonuclease	NA	NA	NA	NA	NA
WP_000214247.1|625866_626442_-	recombinase family protein	NA	G8I4U3	Mycobacterium_phage	39.2	1.3e-26
WP_001419161.1|627225_627420_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174183197.1|628790_629711_+	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000189294.1|629995_630955_-	DUF4868 domain-containing protein	NA	NA	NA	NA	NA
WP_000824184.1|630954_631542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003845544.1|631826_632078_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001311342.1|632309_633587_-|integrase	tyrosine-type recombinase/integrase	integrase	NA	NA	NA	NA
WP_174183198.1|638360_639494_-|transposase	IS110-like element ISEc45 family transposase	transposase	NA	NA	NA	NA
WP_064718063.1|639749_640139_+	ATP-binding protein	NA	A0A2L1IVB6	Escherichia_phage	99.2	3.2e-61
WP_000145479.1|640189_640408_-	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000625669.1|640655_641933_-	DUF2254 domain-containing protein	NA	NA	NA	NA	NA
WP_001293435.1|641995_643993_-|holin	choline BCCT transporter BetT	holin	A0A2I7QNT1	Vibrio_phage	25.9	7.4e-21
WP_000088357.1|644146_645286_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	45.1	3.5e-68
WP_001300018.1|645466_646411_-	lauroyl-Kdo(2)-lipid IV(A) myristoyltransferase	NA	NA	NA	NA	NA
WP_001300030.1|646475_647426_-	virulence factor VirK	NA	NA	NA	NA	NA
WP_001388979.1|647430_648519_-	putative hexosyltransferase CapU	NA	NA	NA	NA	NA
WP_160371899.1|648521_649364_-	polysaccharide deacetylase family protein	NA	NA	NA	NA	NA
WP_000177057.1|650828_651086_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000175457.1|651643_652411_-	Fe(3+) dicitrate ABC transporter ATP-binding protein FecE	NA	G3M9Y6	Bacillus_virus	24.8	6.4e-13
WP_000684856.1|652411_653368_-	Fe(3+) dicitrate ABC transporter permease subunit FecD	NA	A0A2H4IY97	uncultured_Caudovirales_phage	26.1	1.1e-17
WP_000125187.1|653364_654363_-	iron-dicitrate ABC transporter permease FecC	NA	NA	NA	NA	NA
WP_000879152.1|654359_655262_-	Fe(3+) dicitrate ABC transporter substrate-binding protein FecB	NA	NA	NA	NA	NA
WP_016235883.1|655306_657631_-	Fe(3+) dicitrate transport protein FecA	NA	NA	NA	NA	NA
656628:656643	attR	TGCAGCAGGCTGTTGA	NA	NA	NA	NA
WP_016235884.1|657717_658671_-	fec operon regulator FecR	NA	NA	NA	NA	NA
WP_001283626.1|658667_659189_-	RNA polymerase sigma factor FecI	NA	NA	NA	NA	NA
WP_000555341.1|660925_661183_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000823243.1|661915_663274_+	esterase-like activity of phytase family protein	NA	NA	NA	NA	NA
WP_115723220.1|663512_664898_-|transposase	IS66 family transposase	transposase	A0A0P0ZBS5	Stx2-converting_phage	89.5	1.2e-259
>prophage 3
NZ_CP054353	Escherichia coli strain SCU-172 chromosome, complete genome	5170495	1092957	1108212	5170495	integrase	Enterobacteria_phage(15.38%)	19	1087382:1087395	1102657:1102670
1087382:1087395	attL	CGCTATGGCAAACA	NA	NA	NA	NA
WP_000749881.1|1092957_1094013_-	phosphoporin PhoE	NA	Q1MVN1	Enterobacteria_phage	60.9	7.7e-118
WP_001285288.1|1094300_1095404_+	glutamate 5-kinase	NA	A0A1X9I5D0	Streptococcus_phage	40.4	1.1e-61
WP_000893288.1|1095415_1096669_+	glutamate-5-semialdehyde dehydrogenase	NA	A0A1X9I5D4	Streptococcus_phage	46.7	7.0e-94
WP_021563225.1|1097024_1098239_+|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	56.2	3.7e-132
WP_000035054.1|1098890_1099094_+	AlpA family transcriptional regulator	NA	A0A1V0E8E5	Vibrio_phage	50.9	4.7e-08
WP_000412539.1|1099093_1099525_+	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	49.7	3.0e-28
WP_001570974.1|1099537_1100371_+	antA/AntB antirepressor family protein	NA	G9L6G1	Escherichia_phage	47.5	5.3e-21
WP_000476150.1|1100363_1100546_+	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_021563224.1|1100539_1101607_+	ash family protein	NA	A0A1C9IHV9	Salmonella_phage	45.8	1.2e-14
WP_001065738.1|1101599_1101794_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001570976.1|1101790_1102054_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000181940.1|1102050_1102272_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001058743.1|1102264_1102867_+	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	36.3	2.0e-25
1102657:1102670	attR	CGCTATGGCAAACA	NA	NA	NA	NA
WP_000628967.1|1102877_1103219_+	hypothetical protein	NA	A0A1B5FPL8	Escherichia_phage	61.5	2.5e-33
WP_001208878.1|1103211_1103583_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001570977.1|1103569_1106326_+	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	57.1	1.2e-298
WP_001018524.1|1106901_1107063_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000420674.1|1107079_1107541_+	DUF2824 family protein	NA	Q2A0B3	Sodalis_phage	72.2	2.9e-61
WP_001570978.1|1107534_1108212_+	hypothetical protein	NA	Q2A0B2	Sodalis_phage	71.6	7.0e-56
>prophage 4
NZ_CP054353	Escherichia coli strain SCU-172 chromosome, complete genome	5170495	1342513	1437225	5170495	portal,protease,integrase,capsid,head,lysis,tail,terminase,tRNA,transposase	Enterobacteria_phage(39.53%)	87	1359318:1359377	1381041:1381810
WP_001295836.1|1342513_1343137_-|protease	multifunctional acyl-CoA thioesterase I/protease I/lysophospholipase L1	protease	NA	NA	NA	NA
WP_001110573.1|1343107_1343794_+	ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	35.6	2.9e-33
WP_001571053.1|1343790_1346205_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_001157960.1|1346445_1347540_-|tRNA	tRNA 2-selenouridine(34) synthase MnmH	tRNA	NA	NA	NA	NA
WP_000460145.1|1347608_1348535_-	HTH-type transcriptional activator AllS	NA	NA	NA	NA	NA
WP_000776388.1|1348764_1349247_+	ureidoglycolate lyase	NA	NA	NA	NA	NA
WP_000141275.1|1349324_1350140_+	HTH-type transcriptional repressor AllR	NA	NA	NA	NA	NA
WP_001571054.1|1350229_1352011_+	glyoxylate carboligase	NA	E4WLQ6	Ostreococcus_tauri_virus	27.4	3.5e-38
WP_001571055.1|1352023_1352800_+	hydroxypyruvate isomerase	NA	NA	NA	NA	NA
WP_000765837.1|1352899_1353778_+	2-hydroxy-3-oxopropionate reductase	NA	NA	NA	NA	NA
WP_000401150.1|1353947_1355402_+	putative allantoin permease	NA	NA	NA	NA	NA
WP_000006913.1|1355462_1356824_+	allantoinase AllB	NA	NA	NA	NA	NA
WP_001302767.1|1356879_1358181_+	uracil/xanthine transporter	NA	NA	NA	NA	NA
WP_174183209.1|1358202_1359345_+	glycerate 3-kinase	NA	W6LM47	Streptococcus_phage	43.4	1.6e-47
1359318:1359377	attL	CGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGG	NA	NA	NA	NA
WP_000495390.1|1361627_1362887_+	DUF1116 domain-containing protein	NA	NA	NA	NA	NA
WP_001330609.1|1362897_1363713_+	DUF2877 domain-containing protein	NA	NA	NA	NA	NA
WP_000855404.1|1363709_1364603_+	carbamate kinase	NA	NA	NA	NA	NA
WP_000815528.1|1364835_1365903_-	5-(carboxyamino)imidazole ribonucleotide synthase	NA	NA	NA	NA	NA
WP_001295318.1|1365899_1366409_-	5-(carboxyamino)imidazole ribonucleotide mutase	NA	NA	NA	NA	NA
WP_000212266.1|1366526_1367249_-	UDP-2,3-diacylglucosamine diphosphatase	NA	NA	NA	NA	NA
WP_000256006.1|1367251_1367746_-	peptidylprolyl isomerase B	NA	NA	NA	NA	NA
WP_000912345.1|1367919_1369305_+|tRNA	cysteine--tRNA ligase	tRNA	M1PG92	Moumouvirus	34.8	3.9e-45
WP_001143563.1|1369340_1369862_-	metal-dependent hydrolase	NA	NA	NA	NA	NA
WP_000190288.1|1369969_1370182_-	ribosome-associated protein YbcJ	NA	NA	NA	NA	NA
WP_000729161.1|1370183_1371050_-	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	37.5	1.7e-30
WP_000776555.1|1371521_1372064_+	type 1 fimbrial protein subunit FimA	NA	NA	NA	NA	NA
WP_000988384.1|1372282_1372975_+	type 1 fimbria chaperone FimC	NA	NA	NA	NA	NA
WP_001308462.1|1373005_1375615_+	fimbrial biogenesis usher protein	NA	NA	NA	NA	NA
WP_000691076.1|1375627_1376635_+	type 1 fimbrin D-mannose specific adhesin FimH	NA	NA	NA	NA	NA
WP_001255235.1|1376645_1377161_+	fimbria assembly protein	NA	NA	NA	NA	NA
WP_021563239.1|1377163_1377796_-	fimbria biosynthesis transcriptional regulator FimZ	NA	NA	NA	NA	NA
WP_001571056.1|1378129_1379293_-|integrase	site-specific integrase	integrase	A0A088CD23	Shigella_phage	86.3	1.2e-199
WP_000206813.1|1379519_1379825_-	hypothetical protein	NA	U5P0J0	Shigella_phage	95.0	1.4e-48
WP_001242707.1|1379824_1380187_-	phage protein	NA	K7PH61	Enterobacteria_phage	98.3	4.4e-65
WP_000008165.1|1380177_1380714_-	5'-deoxynucleotidase	NA	U5P0T3	Shigella_phage	98.3	4.8e-100
WP_000737271.1|1382007_1383090_-	porin OmpC	NA	Q1MVN1	Enterobacteria_phage	80.1	1.6e-166
1381041:1381810	attR	CGGTGATGCTGCCAACTTACTGATTTAGTGTATGATGGTGTTTTTGAGGTGCTCCAGTGGCTTCTGTTTCTATCAGCTGTCCCTCCTGTTCAGCTACTGACGGGGTGGTGCGTAACGGCAAAAGCACCGCCGGACATCAGCGCTATCTCTGCTCTCACTGCCGTAAAACATGGCAACTGCAGTTCACTTACACCGCTTCTCAACCCGGTACGCACCAGAAAATCATTGATATGGCCATGAATGGCGTTGGATGCCGGGCAACAGCCCGCATTATGGGCGTTGGCCTCAACACGATTTTACGTCACTTAAAAAACTCAGGCCGCAGTCGGTAACCTCGCGCATACAGCCGGGCAGTGACGTCATCGTCTGCGCGGAAATGGACGAACAGTGGGGCTATGTCGGGGCTAAATCGCGCCAGCGCTGGCTGTTTTACGCGTATGACAGGCTCCGGAAGACGGTTGTTGCGCACGTATTCGGTGAACGCACTATGGCGACGCTGGGGCGTCTTATGAGCCTGCTGTCACCCTTTGACGTGGTGATATGGATGACGGATGGCTGGCCGCTGTATGAATCCCGCCTGAAGGGAAAGCTGCACGTAATCAGCAAGCGATATACGCAGCGAATTGAGCGGCATAACCTGAATCTGAGGCAGCACCTGGCACGGCTGGGACGGAAGTCGCTGTCGTTCTCAAAATCGGTGGAGCTGCATGACAAAGTCATCGGGCATTATCTGAACATAAAACACTATCAATAAGTTGGAGTCATTACCT	NA	NA	NA	NA
WP_000839597.1|1383678_1383894_+|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	100.0	2.6e-33
WP_001135253.1|1383893_1384391_+	lysozyme RrrD	NA	M1FJA0	Enterobacteria_phage	97.0	6.0e-89
WP_114504718.1|1384387_1384825_+|lysis	lysis protein	lysis	A0A220NRM0	Escherichia_phage	97.2	8.5e-71
WP_000839225.1|1385026_1385524_+	KilA-N domain-containing protein	NA	A0A220NRM9	Escherichia_phage	100.0	1.1e-93
WP_001283921.1|1385520_1385778_+	hypothetical protein	NA	A0A0P0ZBT1	Stx2-converting_phage	100.0	5.0e-39
WP_001331705.1|1386533_1386767_-	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	96.3	9.5e-21
WP_000453576.1|1387155_1387701_+	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_151309675.1|1387675_1389601_+|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000198149.1|1389597_1389804_+	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_001571331.1|1389800_1391402_+|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	2.9e-310
WP_174183210.1|1391382_1392702_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.0e-232
WP_001345004.1|1392711_1393044_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_000063265.1|1393099_1394125_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	98.8	8.7e-191
WP_000158916.1|1394166_1394562_+	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	93.2	2.4e-56
WP_001535302.1|1394573_1394927_+|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	1.3e-61
WP_000975070.1|1394938_1395517_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	100.0	2.7e-80
WP_000683145.1|1395513_1395909_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_174183211.1|1395916_1396657_+|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	97.2	2.0e-128
WP_000479153.1|1396672_1397095_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	100.0	6.7e-73
WP_000459457.1|1397076_1397511_+|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	100.0	6.9e-65
WP_000840228.1|1397503_1400065_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	99.6	0.0e+00
WP_000847379.1|1400061_1400391_+|tail	phage tail protein	tail	A0A0K2FIE9	Enterobacteria_phage	100.0	9.6e-59
WP_001152639.1|1400390_1401089_+|tail	phage minor tail protein L	tail	A0A0K2FJ01	Enterobacteria_phage	100.0	2.3e-134
WP_000194780.1|1401094_1401838_+|tail	phage tail protein	tail	K7PLW1	Enterobacteria_phage	96.8	2.5e-147
WP_000090891.1|1401774_1402407_+|tail	tail assembly protein	tail	A0A2R9YJH6	Escherichia_phage	99.5	2.2e-96
WP_016235924.1|1402467_1405881_+	host specificity protein J	NA	K7PKJ2	Enterobacteria_phage	97.0	0.0e+00
WP_001571062.1|1405950_1406550_+	Ail/Lom family outer membrane beta-barrel protein	NA	A0A291AWV3	Escherichia_phage	99.0	2.0e-110
WP_021569819.1|1406614_1409011_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A0E3M194	Enterobacteria_phage	55.3	3.9e-133
WP_001522483.1|1409007_1409289_+	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	50.0	1.4e-18
WP_000235966.1|1409298_1410003_+|tail	tail fiber domain-containing protein	tail	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_001571065.1|1410013_1410307_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000239881.1|1410500_1411169_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_001571067.1|1411710_1413192_-	alpha/beta hydrolase	NA	NA	NA	NA	NA
WP_001201825.1|1413378_1414332_-|protease	omptin family outer membrane protease OmpT	protease	NA	NA	NA	NA
WP_001177457.1|1414844_1415606_-	DNA-binding transcriptional regulator EnvY	NA	NA	NA	NA	NA
WP_001224581.1|1415788_1416679_-	DUF4434 family protein	NA	NA	NA	NA	NA
WP_021563102.1|1416679_1419652_-	bacteriophage adsorption protein NfrA	NA	NA	NA	NA	NA
WP_021563101.1|1419638_1421651_-	phage adsorption protein NrfB	NA	NA	NA	NA	NA
WP_000253833.1|1421800_1423243_-	Cu(+)/Ag(+) sensor histidine kinase CusS	NA	A0A1V0SGX0	Hokovirus	26.2	2.3e-11
WP_000770953.1|1423232_1423916_-	copper response regulator transcription factor CusR	NA	W8CYM9	Bacillus_phage	35.1	1.0e-30
WP_001571074.1|1424072_1425455_+	Cu(+)/Ag(+) efflux RND transporter outer membrane channel CusC	NA	NA	NA	NA	NA
WP_001224008.1|1425478_1425811_+	Cu(+)/Ag(+) efflux RND transporter periplasmic metallochaperone CusF	NA	NA	NA	NA	NA
WP_000717169.1|1425826_1427050_+	Cu(+)/Ag(+) efflux RND transporter periplasmic adaptor subunit CusB	NA	NA	NA	NA	NA
WP_000573977.1|1427061_1430205_+	Cu(+)/Ag(+) efflux RND transporter permease subunit CusA	NA	S5VTK5	Leptospira_phage	22.3	7.5e-60
WP_000786307.1|1430306_1431683_+	phenylalanine transporter	NA	NA	NA	NA	NA
WP_016234581.1|1431750_1432998_-	mechanosensitive ion channel YbdG	NA	NA	NA	NA	NA
WP_000351480.1|1433105_1433759_-	oxygen-insensitive NAD(P)H nitroreductase	NA	NA	NA	NA	NA
WP_000360954.1|1433852_1434221_-	MmcQ/YjbR family DNA-binding protein	NA	NA	NA	NA	NA
WP_000682524.1|1434285_1434534_-	DUF1158 domain-containing protein	NA	NA	NA	NA	NA
WP_001571079.1|1434599_1435718_-	glutamate--cysteine ligase	NA	NA	NA	NA	NA
WP_000343765.1|1436004_1437225_-|transposase	ISL3-like element ISEc53 family transposase	transposase	NA	NA	NA	NA
>prophage 5
NZ_CP054353	Escherichia coli strain SCU-172 chromosome, complete genome	5170495	1737312	1843857	5170495	portal,head,tRNA,lysis,tail,terminase,capsid,transposase,holin	Enterobacteria_phage(42.65%)	107	NA	NA
WP_000868863.1|1737312_1738338_+|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_000691708.1|1738839_1738923_-	protein YohP	NA	NA	NA	NA	NA
WP_001571170.1|1739146_1740583_+	multidrug resistance outer membrane protein MdtQ	NA	NA	NA	NA	NA
WP_000079531.1|1740635_1741397_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_001297891.1|1741516_1742095_-	DedA family protein	NA	NA	NA	NA	NA
WP_001295454.1|1742264_1742852_+	YIP1 family protein	NA	NA	NA	NA	NA
WP_001319943.1|1743025_1743958_+	D-alanyl-D-alanine endopeptidase	NA	NA	NA	NA	NA
WP_000097369.1|1743996_1745712_-	D-lactate dehydrogenase	NA	NA	NA	NA	NA
WP_032145195.1|1745907_1748205_+	beta-glucosidase BglX	NA	NA	NA	NA	NA
WP_001131249.1|1748456_1749374_+	glycine betaine ABC transporter substrate-binding protein OsmF	NA	NA	NA	NA	NA
WP_000221813.1|1749380_1750538_+	glycine betaine ABC transporter permease YehY	NA	NA	NA	NA	NA
WP_000569368.1|1750530_1751457_+	glycine betaine ABC transporter ATP binding protein YehX	NA	G3M9Y6	Bacillus_virus	30.8	2.2e-23
WP_000783125.1|1751461_1752193_+	glycine betaine ABC transporter permease YehW	NA	NA	NA	NA	NA
WP_001216963.1|1752173_1752281_-	protein YohO	NA	NA	NA	NA	NA
WP_042101647.1|1752340_1753027_-	HTH-type transcriptional regulator MlrA	NA	Q9EYF2	Enterobacteria_phage	99.5	3.8e-102
WP_001555127.1|1753062_1754349_-	DUF3596 domain-containing protein	NA	A0A0N7KZF5	Stx2-converting_phage	98.6	4.6e-250
WP_001555126.1|1754382_1754637_-	excisionase family protein	NA	Q859D3	Escherichia_coli_phage	98.8	3.3e-43
WP_001030154.1|1754655_1754790_-	hypothetical protein	NA	A0A1B5FPC2	Escherichia_phage	93.2	4.2e-21
WP_000457723.1|1754793_1755036_-	DUF4222 domain-containing protein	NA	Q6H9Z8	Enterobacteria_phage	87.5	4.3e-32
WP_001555125.1|1755120_1755639_-	hypothetical protein	NA	A0A088CE95	Shigella_phage	74.6	1.3e-65
WP_001555124.1|1756152_1756752_-	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.5	1.2e-104
WP_000476207.1|1756748_1756988_-	hypothetical protein	NA	S5MQM0	Escherichia_phage	96.2	9.1e-35
WP_000111289.1|1756980_1757184_-	hypothetical protein	NA	K7PLX1	Enterobacteria_phage	98.5	1.0e-31
WP_001555123.1|1757180_1757543_-	phage protein	NA	K7PH61	Enterobacteria_phage	96.7	1.5e-65
WP_071665807.1|1757533_1758070_-	5'-deoxynucleotidase	NA	K7PKJ9	Enterobacteria_phage	98.3	1.8e-99
WP_001571187.1|1758160_1759078_-	recombination-associated protein RdgC	NA	A0A1W6JP69	Morganella_phage	37.9	6.6e-49
WP_012599998.1|1759766_1760459_-	helix-turn-helix domain-containing protein	NA	S5FUZ3	Shigella_phage	95.7	2.4e-120
WP_001191669.1|1760556_1760817_+	helix-turn-helix transcriptional regulator	NA	K7PJQ8	Enterobacteria_phage	100.0	5.4e-41
WP_016230882.1|1760809_1761367_+	hypothetical protein	NA	Q8SBF4	Shigella_phage	94.6	1.8e-94
WP_016235941.1|1761363_1762509_+	Rha family phage regulatory protein	NA	K7PLX4	Enterobacteria_phage	83.6	4.8e-174
WP_001571188.1|1762505_1763387_+	Rha family phage regulatory protein	NA	A0A1C9IHV9	Salmonella_phage	76.5	4.2e-117
WP_001571189.1|1763383_1763608_+	hypothetical protein	NA	A5LH70	Enterobacteria_phage	98.6	2.8e-38
WP_001571190.1|1763604_1764423_+	helix-turn-helix domain-containing protein	NA	A0A291AWW0	Escherichia_phage	98.9	5.2e-122
WP_077466986.1|1764419_1764914_+	PerC family transcriptional regulator	NA	A0A291AWV6	Escherichia_phage	98.1	7.3e-87
WP_000066917.1|1764913_1765567_+	phage N-6-adenine-methyltransferase	NA	A5LH72	Enterobacteria_phage	99.5	1.9e-127
WP_000210143.1|1765563_1765890_+	LexA family transcriptional regulator	NA	A0A291AWY9	Escherichia_phage	98.1	2.7e-53
WP_000767110.1|1765886_1766282_+	RusA family crossover junction endodeoxyribonuclease	NA	A0A0P0ZD39	Stx2-converting_phage	98.4	5.7e-66
WP_001072669.1|1766444_1767260_+	KilA-N domain-containing protein	NA	U5P4K5	Shigella_phage	99.3	8.5e-149
WP_001358491.1|1767267_1768257_+	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	99.4	4.7e-194
WP_001204814.1|1768274_1768646_+	antitermination protein Q	NA	Q8W638	Enterobacteria_phage	59.2	8.3e-35
WP_000360285.1|1768721_1769339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000917737.1|1769617_1769815_+	hypothetical protein	NA	S5MQK8	Escherichia_phage	96.9	2.6e-27
WP_000301785.1|1769949_1770663_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_174183218.1|1771433_1773395_+	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	64.5	8.7e-240
WP_001405838.1|1773546_1773729_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	91.5	9.4e-24
WP_001514225.1|1773766_1774036_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	76.4	1.8e-10
WP_000284510.1|1774111_1774327_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001037011.1|1774331_1774682_+	YdfR family protein	NA	B6DZ91	Enterobacteria_phage	91.1	6.0e-51
WP_000992063.1|1774745_1775279_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	95.5	2.1e-100
WP_001082564.1|1775577_1776015_+|lysis	lysis protein	lysis	A0A088CBQ1	Shigella_phage	95.2	2.3e-68
WP_001028465.1|1776216_1776738_+	KilA-N domain-containing protein	NA	K7P7K9	Enterobacteria_phage	100.0	1.5e-93
WP_000347013.1|1777446_1777587_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001329960.1|1777719_1777905_-	DUF3950 domain-containing protein	NA	A0A0K2FIR8	Escherichia_phage	90.4	3.2e-19
WP_000235436.1|1778308_1778818_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|1780690_1780897_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_021537906.1|1780893_1782486_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.5	1.3e-185
WP_016238736.1|1782475_1783981_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.8	9.3e-101
WP_016247652.1|1784017_1784365_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	3.7e-21
WP_001530577.1|1784422_1785451_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	61.9	6.6e-114
WP_174183219.1|1785502_1785886_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204533.1|1785878_1786232_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000974994.1|1786247_1786823_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	3.7e-50
WP_000683079.1|1786819_1787215_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235034.1|1787222_1787969_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.0	5.6e-123
WP_001299690.1|1787987_1788419_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000533402.1|1788445_1788859_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_021519673.1|1788839_1791401_+|tail	phage tail tape measure protein	tail	A0A0K2FI43	Enterobacteria_phage	90.1	0.0e+00
WP_000847298.1|1791397_1791727_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001327694.1|1791726_1792425_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	7.6e-130
WP_001351101.1|1792430_1793174_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	6.1e-146
WP_032300536.1|1793119_1793752_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_174183220.1|1794095_1797788_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.5	0.0e+00
WP_001530022.1|1797855_1798455_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	93.0	6.5e-106
WP_021568444.1|1798606_1800667_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	65.7	4.2e-152
WP_001204578.1|1800663_1800942_+	hypothetical protein	NA	A0A0E3GMJ7	Enterobacteria_phage	47.3	2.3e-21
WP_000355615.1|1800951_1801248_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001261928.1|1801365_1801614_-	DinI-like family protein	NA	H6WZN4	Escherichia_phage	84.0	1.8e-30
WP_001295431.1|1802128_1803814_+	two-component regulatory system sensor histidine kinase BtsS	NA	Q9EYF3	Enterobacteria_phage	99.6	2.5e-304
WP_000598641.1|1803810_1804530_+	two-component system response regulator BtsR	NA	NA	NA	NA	NA
WP_001329820.1|1804576_1805047_+	DUF1456 family protein	NA	Q9EYF4	Enterobacteria_phage	99.4	3.0e-82
WP_001296231.1|1805087_1805549_-	YehR family lipoprotein	NA	Q9EYF5	Enterobacteria_phage	99.3	3.2e-76
WP_087900240.1|1805673_1807674_-	SWIM zinc finger family protein	NA	Q9EYF6	Enterobacteria_phage	96.0	0.0e+00
WP_021563178.1|1808729_1811009_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001563691.1|1811019_1812108_-	MoxR family ATPase	NA	NA	NA	NA	NA
WP_000483766.1|1815671_1817018_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_016234500.1|1817067_1819215_-	WGR domain-containing protein	NA	NA	NA	NA	NA
WP_001571626.1|1819355_1821389_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0SDF2	Indivirus	27.6	1.8e-54
WP_001005448.1|1821520_1822630_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_001571625.1|1822891_1823170_+	DUF2574 family protein	NA	NA	NA	NA	NA
WP_174183221.1|1824000_1824285_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001195576.1|1824631_1825420_+	hydroxyethylthiazole kinase	NA	NA	NA	NA	NA
WP_000822262.1|1825416_1826217_+	bifunctional hydroxymethylpyrimidine kinase/phosphomethylpyrimidine kinase	NA	NA	NA	NA	NA
WP_001361580.1|1826281_1827100_+	glycoside hydrolase family 25 protein	NA	D0R7H8	Paenibacillus_phage	38.0	2.5e-23
WP_112043273.1|1827151_1827898_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000011939.1|1827871_1828837_-	sugar kinase	NA	NA	NA	NA	NA
WP_000846208.1|1828833_1829838_-	ADP-ribosylglycohydrolase family protein	NA	A0A1S6UB21	Serratia_phage	29.4	7.5e-14
WP_000858523.1|1829834_1831112_-	MFS transporter	NA	NA	NA	NA	NA
WP_000129551.1|1832145_1833198_+	class I fructose-bisphosphate aldolase	NA	NA	NA	NA	NA
WP_000289798.1|1833425_1834280_+	tagatose-bisphosphate aldolase subunit GatY	NA	NA	NA	NA	NA
WP_000853841.1|1834308_1835571_+	tagatose-bisphosphate aldolase subunit GatZ	NA	NA	NA	NA	NA
WP_000823282.1|1836840_1837125_+	PTS galactitol transporter subunit IIB	NA	NA	NA	NA	NA
WP_000490678.1|1837128_1838484_+	PTS galactitol transporter subunit IIC	NA	NA	NA	NA	NA
WP_000844196.1|1838531_1839572_+	galactitol-1-phosphate 5-dehydrogenase	NA	NA	NA	NA	NA
WP_000178552.1|1839671_1840451_+	DeoR/GlpR transcriptional regulator	NA	NA	NA	NA	NA
WP_000807358.1|1840532_1841432_-	lipid kinase YegS	NA	A0A1V0SBJ0	Catovirus	29.5	5.7e-13
WP_001303579.1|1841846_1842164_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000476012.1|1842495_1843857_-|tRNA	tRNA 5-hydroxyuridine modification protein YegQ	tRNA	Q6DW11	Phage_TP	99.5	2.5e-217
>prophage 6
NZ_CP054353	Escherichia coli strain SCU-172 chromosome, complete genome	5170495	1894131	1902847	5170495		Enterobacteria_phage(42.86%)	8	NA	NA
WP_001115981.1|1894131_1895526_+	colanic acid biosynthesis protein WcaM	NA	A0A291LBB9	Klebsiella_phage	33.5	1.3e-19
WP_000183060.1|1895700_1896594_+	UTP--glucose-1-phosphate uridylyltransferase GalF	NA	A0A127AW70	Bacillus_phage	42.0	1.0e-46
WP_000699418.1|1896966_1898052_+	dTDP-glucose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	54.2	1.4e-101
WP_001023627.1|1898051_1898951_+	dTDP-4-dehydrorhamnose reductase	NA	A0A291LA50	Escherichia_phage	35.6	1.5e-29
WP_000857549.1|1899008_1899887_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	64.1	1.5e-106
WP_001100791.1|1899891_1900440_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	I7HJC4	Enterobacteria_phage	56.1	4.2e-51
WP_001362820.1|1900471_1901710_+	oligosaccharide flippase family protein	NA	NA	NA	NA	NA
WP_000735124.1|1901719_1902847_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAI1	Catovirus	30.4	5.3e-32
>prophage 7
NZ_CP054353	Escherichia coli strain SCU-172 chromosome, complete genome	5170495	1983255	2085998	5170495	portal,integrase,plate,head,lysis,tail,terminase,capsid,transposase,holin	Escherichia_phage(26.88%)	134	2014408:2014424	2062804:2062820
WP_024175719.1|1983255_1984518_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B0VMI6	Pseudomonas_phage	38.8	4.1e-73
WP_001311896.1|1984855_1985653_-	DgsA anti-repressor MtfA	NA	NA	NA	NA	NA
WP_000533617.1|1985888_1986914_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A192Y7M7	Salmonella_phage	57.9	2.0e-102
WP_000096344.1|1986913_1987117_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_021563172.1|1987175_1989617_-	exonuclease	NA	V5UQJ3	Shigella_phage	47.3	5.4e-114
WP_021563171.1|1989710_1989902_-|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_000854559.1|1989898_1990087_-	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001296188.1|1990486_1990651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001673454.1|1990654_1990873_-	hypothetical protein	NA	NA	NA	NA	NA
WP_044068532.1|1990944_1991244_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000381213.1|1991473_1991881_-	helix-turn-helix domain-containing protein	NA	I6PD69	Cronobacter_phage	51.9	1.2e-31
WP_000921592.1|1991961_1992189_+	transcriptional regulator	NA	NA	NA	NA	NA
WP_000705383.1|1992172_1992724_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000020541.1|1992695_1993736_+	DNA-binding protein	NA	A0A0U2RT81	Escherichia_phage	87.2	1.0e-90
WP_001309414.1|1993647_1994190_+	hypothetical protein	NA	A0A0U2JGJ0	Escherichia_phage	90.2	3.6e-79
WP_000450702.1|1994223_1994994_+	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	68.4	6.7e-87
WP_001141099.1|1995009_1995402_+	DUF977 family protein	NA	A0A088CBK9	Shigella_phage	63.3	1.5e-39
WP_001266130.1|1995398_1995695_+	DUF4406 domain-containing protein	NA	A0A0U2SAZ1	Escherichia_phage	95.8	1.2e-47
WP_001209475.1|1995691_1996153_+	ead/Ea22-like family protein	NA	Q8VNQ2	Enterobacteria_phage	94.0	2.6e-38
WP_000403785.1|1996130_1996487_+	hypothetical protein	NA	A0A2R2Z307	Escherichia_phage	99.2	1.8e-58
WP_001224662.1|1996580_1996763_+	hypothetical protein	NA	A0A2R2Z308	Escherichia_phage	100.0	1.4e-27
WP_000753058.1|1996755_1996932_+	hypothetical protein	NA	A0A2R2X2A8	Escherichia_phage	93.1	4.3e-26
WP_001289994.1|1996928_1997444_+	hypothetical protein	NA	A0A076GCN9	Escherichia_phage	77.6	1.2e-36
WP_000813254.1|1998002_1998158_+	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000980988.1|1998374_1998626_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001405664.1|1998692_1998971_+	hypothetical protein	NA	A0A077KB22	Edwardsiella_phage	37.1	5.1e-05
WP_001554968.1|1998972_2000019_+	DUF968 domain-containing protein	NA	U5P0K4	Shigella_phage	55.3	1.2e-110
WP_000904112.1|2000031_2000406_+	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	62.7	8.4e-35
WP_000762915.1|2000402_2001224_+	antitermination protein	NA	K7P7B9	Enterobacteria_phage	59.0	1.6e-78
WP_000562553.1|2002119_2002251_+	DUF3927 family protein	NA	H6WZJ7	Escherichia_phage	100.0	3.7e-06
WP_001336019.1|2002531_2002867_-	anti-adapter protein IraM	NA	Q8HAJ1	Enterobacteria_phage	75.7	1.4e-44
WP_174183218.1|2003127_2005089_+	DUF1737 domain-containing protein	NA	A0A0P0ZBH7	Stx2-converting_phage	64.5	8.7e-240
WP_001405838.1|2005240_2005423_+	DUF1378 family protein	NA	A0A2R2Z345	Escherichia_phage	91.5	9.4e-24
WP_001538590.1|2005460_2005706_+	DUF826 domain-containing protein	NA	S5MW40	Escherichia_phage	92.6	8.8e-17
WP_000284510.1|2005782_2005998_+|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_001037012.1|2006002_2006893_+	YdfR family protein	NA	Q08JA0	Stx2-converting_phage	70.6	6.1e-108
WP_001092864.1|2006929_2007463_+	lysozyme	NA	Q6H9V6	Enterobacteria_phage	96.0	3.3e-101
WP_001151823.1|2007619_2007802_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023143934.1|2007798_2007948_+	hypothetical protein	NA	A0A0P0ZG36	Escherichia_phage	71.4	1.3e-07
WP_032142285.1|2007950_2008418_+|lysis	lysis protein	lysis	Q6H9V3	Enterobacteria_phage	84.4	6.7e-66
WP_000830178.1|2008728_2009055_+	TonB family protein	NA	H6WZK5	Escherichia_phage	72.2	3.7e-39
WP_001322427.1|2009177_2009531_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235436.1|2010013_2010523_+|terminase	terminase small subunit	terminase	A0A1I9KFT4	Aeromonas_phage	32.7	1.6e-12
WP_000259002.1|2012395_2012602_+|head,tail	head-tail joining protein	head,tail	K7PM10	Enterobacteria_phage	56.9	7.9e-11
WP_021537906.1|2012598_2014191_+|portal	phage portal protein	portal	K7P6U7	Enterobacteria_phage	61.5	1.3e-185
WP_016238736.1|2014180_2015686_+	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	53.8	9.3e-101
2014408:2014424	attL	CGGTATTGCGGTACTGC	NA	NA	NA	NA
WP_016247652.1|2015722_2016070_+|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	55.9	3.7e-21
WP_000522592.1|2016127_2017156_+|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	62.2	1.7e-114
WP_174183219.1|2017207_2017591_+	DNA-packaging protein FI	NA	NA	NA	NA	NA
WP_001204533.1|2017583_2017937_+|tail	tail attachment protein	tail	A0A0K2FJB7	Enterobacteria_phage	70.1	1.9e-41
WP_000974994.1|2017952_2018528_+|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	57.8	3.7e-50
WP_000683079.1|2018524_2018920_+|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	82.4	1.5e-58
WP_000235037.1|2018927_2019674_+|tail	phage tail protein	tail	Q687F6	Enterobacteria_phage	93.4	8.7e-124
WP_001299690.1|2019692_2020124_+|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	67.4	2.4e-41
WP_000533402.1|2020150_2020564_+|tail	phage tail assembly protein T	tail	S5MDP5	Escherichia_phage	82.2	1.6e-42
WP_000082391.1|2020544_2023118_+|tail	phage tail tape measure protein	tail	A0A2R9YJM8	Escherichia_phage	84.1	0.0e+00
WP_000847298.1|2023114_2023444_+|tail	phage tail protein	tail	Q687F2	Enterobacteria_phage	100.0	4.3e-59
WP_001327694.1|2023443_2024142_+|tail	phage minor tail protein L	tail	S5M7Q4	Escherichia_phage	97.0	7.6e-130
WP_001351101.1|2024147_2024891_+|tail	phage tail protein	tail	Q6H9T4	Enterobacteria_phage	96.4	6.1e-146
WP_032300536.1|2024836_2025469_+|tail	tail assembly protein	tail	Q9EYE5	Enterobacteria_phage	91.8	4.2e-103
WP_174183220.1|2025812_2029505_+	DUF1983 domain-containing protein	NA	A0A0P0ZCI5	Stx2-converting_phage	85.5	0.0e+00
WP_154358444.1|2029572_2030172_+	Ail/Lom family outer membrane beta-barrel protein	NA	H6WZM8	Escherichia_phage	95.5	1.2e-107
WP_174183223.1|2030236_2032303_+|tail	prophage tail fiber N-terminal domain-containing protein	tail	A0A1X7QGG5	Escherichia_phage	62.5	2.4e-147
WP_001204581.1|2032299_2032578_+	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	50.5	6.0e-22
WP_001520721.1|2032587_2032875_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001007774.1|2033955_2034606_-	metal-binding protein ZinT	NA	NA	NA	NA	NA
WP_001240061.1|2034863_2035499_-	protein-methionine-sulfoxide reductase heme-binding subunit MsrQ	NA	NA	NA	NA	NA
WP_001571583.1|2035499_2036504_-	protein-methionine-sulfoxide reductase catalytic subunit MsrP	NA	NA	NA	NA	NA
WP_000920127.1|2036612_2037026_-	hydroxyisourate hydrolase	NA	NA	NA	NA	NA
WP_024190346.1|2037158_2037830_+	response regulator transcription factor HprR	NA	W8CYM9	Bacillus_phage	35.2	5.4e-32
WP_000826735.1|2037829_2039188_+	two-component system sensor histidine kinase HprS	NA	NA	NA	NA	NA
WP_000218217.1|2039295_2040147_-	protein deglycase HchA	NA	NA	NA	NA	NA
WP_000824389.1|2040742_2041801_-	porin	NA	Q1MVN1	Enterobacteria_phage	49.1	2.5e-92
WP_001330593.1|2042367_2042733_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296176.1|2042772_2043468_+	phosphohydrolase	NA	S4W232	Pandoravirus	28.7	1.6e-07
WP_001157265.1|2043534_2044953_+	DNA-cytosine methyltransferase	NA	E5E3X6	Burkholderia_phage	55.1	1.0e-101
WP_000228686.1|2044933_2045404_+	VSPR family DNA mismatch endonuclease	NA	E5E3X5	Burkholderia_phage	48.3	5.2e-34
WP_001212226.1|2045392_2046313_-	drug/metabolite exporter YedA	NA	NA	NA	NA	NA
WP_000922683.1|2046485_2047403_+	DUF808 domain-containing protein	NA	NA	NA	NA	NA
WP_000009302.1|2047481_2047664_+	DUF2158 domain-containing protein	NA	NA	NA	NA	NA
WP_001571575.1|2048781_2048943_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001571573.1|2048946_2049579_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001571572.1|2049693_2050092_-	hypothetical protein	NA	Q6QIE8	Burkholderia_phage	55.0	1.1e-29
WP_001571571.1|2050063_2050513_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	45.9	1.6e-24
WP_000123379.1|2050505_2050721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000631819.1|2050710_2050941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000132039.1|2050937_2051621_-	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	36.1	1.1e-32
WP_000763554.1|2051617_2051833_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001295929.1|2051847_2052144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001571570.1|2052153_2052426_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001381528.1|2052714_2053245_-	host-nuclease inhibitor Gam family protein	NA	L7P7T1	Pseudomonas_phage	66.7	1.2e-58
WP_000843446.1|2053272_2053542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000960680.1|2053544_2054711_-	AAA family ATPase	NA	A4JWN1	Burkholderia_virus	59.7	9.7e-122
WP_001571569.1|2054721_2056491_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	68.2	3.4e-227
WP_000533821.1|2056494_2057409_-	DUF3102 domain-containing protein	NA	A4JWN3	Burkholderia_virus	52.5	6.8e-70
WP_000049025.1|2057419_2057728_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	55.9	5.5e-24
WP_000200153.1|2057780_2057969_-	DNA-binding protein	NA	Q5ZQZ9	Pseudomonas_phage	71.0	6.1e-18
WP_001571568.1|2058019_2058481_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_000031883.1|2058477_2059464_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032154561.1|2059548_2060136_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000149906.1|2060173_2060650_-	ABC transporter ATPase	NA	NA	NA	NA	NA
WP_000793146.1|2060780_2061131_+	membrane protein	NA	A4JWP3	Burkholderia_virus	53.0	1.5e-22
WP_001104440.1|2061133_2061874_+	transglycosylase SLT domain-containing protein	NA	Q5ZQZ1	Pseudomonas_phage	51.4	2.5e-62
WP_016234468.1|2061857_2062508_+	hypothetical protein	NA	J9SVN7	Pseudomonas_phage	32.0	6.2e-09
WP_000175097.1|2062504_2062831_+	membrane protein	NA	Q6QIC4	Burkholderia_phage	49.5	9.6e-19
2062804:2062820	attR	GCAGTACCGCAATACCG	NA	NA	NA	NA
WP_000227702.1|2062830_2063142_+	hypothetical protein	NA	A0A0S4L0A3	Pseudomonas_phage	60.6	3.0e-30
WP_016234467.1|2063144_2063687_+	DUF3486 family protein	NA	A4JWJ3	Burkholderia_virus	50.8	7.1e-43
WP_016234466.1|2063683_2065207_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	62.4	6.8e-184
WP_016234465.1|2065206_2066700_+	DUF935 domain-containing protein	NA	A4JWJ5	Burkholderia_virus	59.9	3.9e-168
WP_000117560.1|2066680_2067502_+|capsid	minor capsid protein	capsid	A4JWJ6	Burkholderia_virus	61.2	1.2e-97
WP_000135513.1|2067504_2067963_+	phage virion morphogenesis protein	NA	Q6QIB8	Burkholderia_phage	44.8	1.5e-30
WP_001273074.1|2068177_2069293_+	hypothetical protein	NA	A4JWJ9	Burkholderia_virus	51.6	9.4e-98
WP_001286908.1|2069307_2070261_+	hypothetical protein	NA	A4JWK0	Burkholderia_virus	43.8	3.4e-64
WP_000537457.1|2070270_2070609_+	DUF2190 family protein	NA	NA	NA	NA	NA
WP_000271668.1|2070610_2071057_+	DUF1320 domain-containing protein	NA	A4JWK2	Burkholderia_virus	52.3	2.2e-34
WP_001101804.1|2071056_2071521_+	hypothetical protein	NA	Q6QIB2	Burkholderia_phage	51.7	9.1e-39
WP_000666499.1|2071520_2071772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016236044.1|2071761_2073189_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A4JWK5	Burkholderia_virus	75.9	6.6e-213
WP_162832341.1|2073185_2073710_+|tail	phage major tail tube protein	tail	A4JWK6	Burkholderia_virus	66.7	1.1e-67
WP_000110114.1|2073712_2073994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000084213.1|2074091_2074427_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_001202894.1|2074350_2074509_+|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_016234462.1|2074584_2077536_+|tail	phage tail tape measure protein	tail	A4JWL0	Burkholderia_virus	29.6	5.4e-84
WP_016236043.1|2077535_2078420_+|tail	phage tail protein	tail	A4JWL1	Burkholderia_virus	47.9	6.8e-51
WP_000478221.1|2078419_2078632_+|tail	tail protein X	tail	Q6QIA3	Burkholderia_phage	60.0	2.4e-18
WP_001756576.1|2078619_2079774_+	phage late control D family protein	NA	Q6QIA2	Burkholderia_phage	47.6	1.9e-85
WP_016236042.1|2079770_2080367_+|plate	phage baseplate assembly protein V	plate	A4JWL4	Burkholderia_virus	44.7	2.7e-35
WP_000859111.1|2080421_2080769_+	GPW/gp25 family protein	NA	Q6QIA0	Burkholderia_phage	62.4	5.9e-35
WP_021563052.1|2080759_2081863_+|plate	baseplate J/gp47 family protein	plate	Q6QI99	Burkholderia_phage	55.2	8.3e-107
WP_000138756.1|2081855_2082434_+|tail	phage tail protein I	tail	A4JWL7	Burkholderia_virus	66.8	1.7e-66
WP_134888835.1|2082436_2084221_+|tail	tail fiber protein	tail	A0A0K2FIZ6	Escherichia_phage	44.5	5.8e-41
WP_016234458.1|2084227_2084842_-|tail	tail assembly chaperone	tail	Q9MCR5	Enterobacteria_phage	60.5	1.1e-60
WP_024173474.1|2084841_2085354_-|tail	tail fiber protein	tail	K7P7Q7	Enterobacteria_phage	47.9	9.7e-34
WP_016234457.1|2085425_2085998_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	84.6	1.8e-84
>prophage 8
NZ_CP054353	Escherichia coli strain SCU-172 chromosome, complete genome	5170495	2296113	2340649	5170495	portal,integrase,capsid,plate,head,tail,terminase,tRNA	Enterobacteria_phage(73.81%)	57	2303305:2303329	2338223:2338247
WP_001144202.1|2296113_2298042_+|tRNA	threonine--tRNA ligase	tRNA	A0A2K9L297	Tupanvirus	37.3	9.4e-130
WP_001700733.1|2298045_2298588_+	translation initiation factor IF-3	NA	A0A2L0UZ54	Agrobacterium_phage	32.9	6.3e-15
WP_001124225.1|2298684_2298882_+	50S ribosomal protein L35	NA	NA	NA	NA	NA
WP_000124850.1|2298935_2299292_+	50S ribosomal protein L20	NA	NA	NA	NA	NA
WP_001386830.1|2299414_2299459_+	pheST operon leader peptide PheM	NA	NA	NA	NA	NA
WP_000018588.1|2299597_2300581_+|tRNA	phenylalanine--tRNA ligase subunit alpha	tRNA	A0A2K9L3A8	Tupanvirus	38.5	1.1e-33
WP_000672340.1|2300595_2302983_+|tRNA	phenylalanine--tRNA ligase subunit beta	tRNA	NA	NA	NA	NA
WP_001229265.1|2302987_2303287_+	integration host factor subunit alpha	NA	A0A0H3UZA0	Geobacillus_virus	40.0	7.2e-13
2303305:2303329	attL	GGCCGCTCTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_000078916.1|2303588_2303729_-	Hok/Gef family protein	NA	A0A0A7NPZ4	Enterobacteria_phage	97.8	1.5e-18
WP_016240850.1|2303957_2304215_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_021524220.1|2304267_2305383_-	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	74.1	1.6e-150
WP_021524219.1|2305545_2306727_+|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	85.3	5.8e-191
WP_021524218.1|2306727_2307243_+|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	64.7	1.8e-56
WP_021524217.1|2307289_2307673_+	hypothetical protein	NA	B9A7B2	Serratia_phage	51.1	2.9e-14
WP_032142793.1|2307678_2307837_+|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	63.8	8.7e-10
WP_016240844.1|2311301_2311760_+|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	79.6	8.6e-66
WP_077684501.1|2312140_2312353_-|tail	tail fiber assembly protein	tail	NA	NA	NA	NA
WP_016240843.1|2312943_2313237_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016240842.1|2313249_2313528_-	hypothetical protein	NA	A0A0E3JSQ1	Enterobacteria_phage	59.8	6.2e-27
WP_021524215.1|2313524_2315306_-|tail	phage tail protein	tail	A0A1X7QGG5	Escherichia_phage	61.5	3.3e-145
WP_016240840.1|2315302_2316079_-|tail	phage tail protein I	tail	A0A0A7NPV1	Enterobacteria_phage	60.2	1.4e-55
WP_021524214.1|2316071_2316968_-|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	70.5	2.3e-110
WP_001546048.1|2316954_2317320_-	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	67.0	1.9e-39
WP_016240838.1|2317316_2317898_-|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	76.2	1.0e-79
WP_021524213.1|2317894_2318533_-	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	46.6	1.8e-45
WP_016240836.1|2318513_2318996_-|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	58.9	5.5e-47
WP_021524212.1|2319090_2319537_-	DUF2570 domain-containing protein	NA	A0A0A7NPY2	Enterobacteria_phage	33.3	1.6e-08
WP_021524211.1|2319533_2320076_-	lysozyme	NA	A0A1S5Q8G1	Aeromonas_phage	41.5	1.5e-29
WP_021524210.1|2320062_2320356_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016240832.1|2320346_2320547_-|tail	tail protein X	tail	A0A0A7NV57	Enterobacteria_phage	78.5	4.3e-22
WP_016240831.1|2320546_2321041_-|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	65.2	2.4e-53
WP_021524209.1|2321160_2321958_-|terminase	phage small terminase subunit	terminase	A0A0A7NPX9	Enterobacteria_phage	75.9	4.3e-97
WP_016240829.1|2322007_2323069_-|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	65.3	3.7e-128
WP_021524207.1|2323078_2323948_-|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	58.8	1.6e-81
WP_021524206.1|2324099_2325842_+	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	71.9	1.3e-247
WP_021524205.1|2325841_2326891_+|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	77.7	5.6e-161
WP_000654460.1|2327449_2328256_+	DUF3800 domain-containing protein	NA	NA	NA	NA	NA
WP_021524203.1|2328487_2328799_-	plasmid partitioning/stability family protein	NA	A0A0A7NPT5	Enterobacteria_phage	94.2	7.2e-48
WP_000686524.1|2328803_2329763_-	plasmid segregation protein ParM	NA	A0A0A7NPX4	Enterobacteria_phage	99.7	9.9e-181
WP_021524201.1|2329839_2332686_-	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	88.6	0.0e+00
WP_000564228.1|2332682_2333072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_122985482.1|2333068_2333686_-	ash family protein	NA	S5MQL6	Escherichia_phage	37.8	2.1e-06
WP_021524200.1|2333697_2333997_-	hypothetical protein	NA	A0A0A7NRX6	Enterobacteria_phage	88.9	6.2e-41
WP_000153700.1|2333993_2334260_-	winged helix-turn-helix transcriptional regulator	NA	A0A0A7NV47	Enterobacteria_phage	75.9	2.0e-30
WP_000985157.1|2334256_2334460_-	hypothetical protein	NA	A0A0A7NPS8	Enterobacteria_phage	83.6	2.5e-25
WP_000543031.1|2334483_2334894_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000021659.1|2334987_2335101_-	hypothetical protein	NA	A0A0A7NPW7	Enterobacteria_phage	91.9	4.0e-09
WP_000357028.1|2335097_2335340_-	DUF4754 family protein	NA	A0A0A7NQ71	Enterobacteria_phage	97.5	3.4e-37
WP_000158971.1|2335351_2335639_-	hypothetical protein	NA	A0A0A7NRX5	Enterobacteria_phage	76.8	7.8e-33
WP_000917809.1|2335649_2335988_-	DUF4761 family protein	NA	A0A0A7NV42	Enterobacteria_phage	87.1	2.3e-52
WP_001151410.1|2336002_2336281_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000904674.1|2336377_2336686_+	helix-turn-helix transcriptional regulator	NA	A0A0M5M1I9	Salmonella_phage	52.1	8.7e-22
WP_001247208.1|2336774_2337710_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4RTQ0	Salmonella_phage	50.8	5.6e-80
WP_000416306.1|2337720_2338116_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000956528.1|2338305_2339286_+	vitamin B12 ABC transporter permease BtuC	NA	NA	NA	NA	NA
2338223:2338247	attR	GGCCGCTCTGCGGCCTTTTTTCTTT	NA	NA	NA	NA
WP_001154167.1|2339348_2339900_+	bifunctional thioredoxin/glutathione peroxidase	NA	NA	NA	NA	NA
WP_000029466.1|2339899_2340649_+	vitamin B12 ABC transporter ATP-binding protein BtuD	NA	A0A2R8FG22	Brazilian_cedratvirus	28.2	9.3e-09
>prophage 9
NZ_CP054353	Escherichia coli strain SCU-172 chromosome, complete genome	5170495	2452070	2554392	5170495	portal,head,lysis,tail,terminase,capsid,transposase	Escherichia_phage(29.09%)	109	NA	NA
WP_000483766.1|2452070_2453417_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000825465.1|2454289_2454793_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000876782.1|2454805_2455336_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_024190332.1|2455349_2456177_-	fimbrial biogenesis outer membrane usher protein	NA	NA	NA	NA	NA
WP_148718718.1|2456240_2457468_+|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	1.9e-176
WP_000483766.1|2461185_2462532_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000154335.1|2467123_2468077_-	transcriptional regulator LsrR	NA	NA	NA	NA	NA
WP_001194902.1|2468325_2469861_+	autoinducer 2 ABC transporter ATP-binding protein LsrA	NA	A0A2H4PQG7	Staphylococcus_phage	30.9	3.4e-21
WP_000911164.1|2469854_2470883_+	autoinducer 2 ABC transporter permease LsrC	NA	NA	NA	NA	NA
WP_001222705.1|2470882_2471875_+	autoinducer 2 ABC transporter permease LsrD	NA	NA	NA	NA	NA
WP_016235646.1|2471886_2472909_+	autoinducer 2 ABC transporter substrate-binding protein LsrB	NA	NA	NA	NA	NA
WP_000774159.1|2472935_2473811_+	3-hydroxy-5-phosphonooxypentane-2,4-dione thiolase	NA	NA	NA	NA	NA
WP_000558525.1|2473834_2474125_+	(4S)-4-hydroxy-5-phosphonooxypentane-2,3-dione isomerase	NA	NA	NA	NA	NA
WP_001286535.1|2474181_2474940_+	trans-aconitate 2-methyltransferase	NA	NA	NA	NA	NA
WP_001313828.1|2474943_2475858_-	bestrophin family inner membrane protein	NA	NA	NA	NA	NA
WP_000854645.1|2476054_2477506_-	tagaturonate reductase	NA	NA	NA	NA	NA
WP_016234359.1|2477733_2479152_-	GGDEF domain-containing protein	NA	A0A127AWB9	Bacillus_phage	36.1	1.4e-18
WP_001191037.1|2479290_2479650_-	DUF4186 domain-containing protein	NA	NA	NA	NA	NA
WP_000257409.1|2479649_2480576_-	glutaminase B	NA	NA	NA	NA	NA
WP_001571433.1|2480639_2482028_-	succinate-semialdehyde dehydrogenase	NA	NA	NA	NA	NA
WP_001571434.1|2482128_2483010_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000258575.1|2483087_2484203_+	putative protein YneK	NA	NA	NA	NA	NA
WP_000210806.1|2484352_2485543_+	L-arabinose MFS transporter	NA	NA	NA	NA	NA
WP_000885033.1|2485567_2486233_-	NAAT family transporter MarC	NA	NA	NA	NA	NA
WP_000843419.1|2486444_2486879_+	multiple antibiotic resistance transcriptional regulator MarR	NA	NA	NA	NA	NA
WP_000091199.1|2486899_2487283_+	MDR efflux pump AcrAB transcriptional activator MarA	NA	D0R0F8	Streptococcus_phage	32.3	4.7e-09
WP_000803531.1|2487314_2487533_+	multiple antibiotic resistance protein MarB	NA	NA	NA	NA	NA
WP_000012602.1|2487589_2489029_-	6-phospho-beta-glucosidase	NA	A0A0B5JD41	Pandoravirus	25.9	1.8e-29
WP_001022787.1|2489053_2490727_-	carbohydrate porin	NA	NA	NA	NA	NA
WP_001459752.1|2490782_2491094_-	PTS lactose/cellobiose transporter subunit IIA	NA	NA	NA	NA	NA
WP_021563067.1|2491121_2492444_-	PTS sugar transporter subunit IIC	NA	NA	NA	NA	NA
WP_000019440.1|2492673_2493654_-|transposase	IS5-like element ISKpn26 family transposase	transposase	A0A077SK28	Escherichia_phage	99.1	6.8e-185
WP_000722570.1|2493756_2494068_-	PTS sugar transporter subunit IIB	NA	NA	NA	NA	NA
WP_000577190.1|2494266_2494965_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000087205.1|2495009_2495909_-	O-acetylserine/cysteine exporter	NA	NA	NA	NA	NA
WP_001054192.1|2496103_2497291_+	efflux MFS transporter YdeE	NA	NA	NA	NA	NA
WP_000901367.1|2497417_2497513_+	protein MgtS	NA	NA	NA	NA	NA
WP_001571437.1|2497731_2498622_-	diguanylate cyclase DgcZ	NA	A0A127AWB9	Bacillus_phage	37.0	1.8e-19
WP_000671726.1|2498876_2499269_-	YdeI family stress tolerance OB fold protein	NA	NA	NA	NA	NA
WP_001571438.1|2499634_2501680_-	peptidyl-dipeptidase Dcp	NA	NA	NA	NA	NA
WP_001296081.1|2501816_2502563_+	bifunctional NADP-dependent 3-hydroxy acid dehydrogenase/3-hydroxypropionate dehydrogenase YdfG	NA	NA	NA	NA	NA
WP_000215553.1|2502651_2503338_+	DNA-binding transcriptional regulator YdfH	NA	NA	NA	NA	NA
WP_000214712.1|2503515_2503719_+	putative selenium delivery protein YdfZ	NA	J9Q802	Salmonella_phage	55.2	1.6e-11
WP_000527820.1|2503754_2505215_-	mannitol dehydrogenase family protein	NA	G8DCZ3	Micromonas_pusilla_virus	29.9	6.0e-44
WP_120795384.1|2507190_2507304_+	Rac prophage; protein YnaM	NA	A0A1C9IHU6	Salmonella_phage	80.6	8.4e-07
WP_000836768.1|2507372_2507606_+	cold shock protein YdfK	NA	A0A192Y6D5	Salmonella_phage	88.3	1.1e-32
WP_000086527.1|2507922_2508513_+	recombinase family protein	NA	A0A0A7NPV4	Enterobacteria_phage	38.8	1.6e-24
WP_000355609.1|2508740_2509034_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000235980.1|2509044_2509749_-	hypothetical protein	NA	A0A1X7QGH6	Escherichia_phage	61.7	1.2e-58
WP_000654160.1|2509758_2510040_-	hypothetical protein	NA	A0A1X7QHA1	Escherichia_phage	47.8	5.9e-17
WP_001233058.1|2513286_2513886_-	Ail/Lom family outer membrane beta-barrel protein	NA	A0A0P0ZCF6	Stx2-converting_phage	96.0	2.0e-107
WP_001254932.1|2515771_2516923_+|transposase	IS30-like element IS30 family transposase	transposase	W5R8L2	Staphylococcus_phage	35.6	2.0e-42
WP_001571447.1|2517288_2517723_-|tail	phage tail assembly protein T	tail	A0A0K2FJB3	Enterobacteria_phage	98.3	5.0e-63
WP_001552795.1|2517704_2518127_-|tail	phage minor tail protein G	tail	A0A0K2FIQ8	Enterobacteria_phage	82.9	4.2e-59
WP_016235889.1|2518142_2518883_-|tail	phage tail protein	tail	A0A0K2FJ05	Enterobacteria_phage	98.8	3.3e-131
WP_000683145.1|2518890_2519286_-|tail	tail protein	tail	A0A2R9YJI2	Escherichia_phage	100.0	1.3e-70
WP_001520551.1|2519282_2519861_-|tail	phage tail protein	tail	A0A2R9YJK4	Escherichia_phage	99.5	7.8e-80
WP_000753006.1|2519915_2520269_-|head,tail	head-tail joining protein	head,tail	A0A2R9YJJ5	Escherichia_phage	98.3	4.4e-62
WP_000158879.1|2520280_2520676_-	DNA-packaging protein FI	NA	A0A2R9YJP4	Escherichia_phage	94.7	1.7e-57
WP_001571334.1|2520717_2521743_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	97.7	2.4e-188
WP_001345004.1|2521798_2522131_-|head	head decoration protein	head	A0A2R9YJN3	Escherichia_phage	99.1	5.0e-55
WP_174183210.1|2522140_2523460_-	S49 family peptidase	NA	A0A2I6TC87	Escherichia_phage	98.2	2.0e-232
WP_001571331.1|2523440_2525042_-|portal	phage portal protein	portal	A0A0K2FJC0	Enterobacteria_phage	99.1	2.9e-310
WP_000198149.1|2525038_2525245_-	gpW family protein	NA	A0A2R9YJL2	Escherichia_phage	100.0	5.8e-30
WP_151309675.1|2525241_2527167_-|terminase	phage terminase large subunit family protein	terminase	A0A0K2FJ14	Enterobacteria_phage	99.5	0.0e+00
WP_000453576.1|2527141_2527687_-	DNA-packaging protein	NA	A0A0K2FIG2	Enterobacteria_phage	99.4	4.7e-95
WP_001368374.1|2528075_2528309_+	YlcI/YnfO family protein	NA	A0A0K2FIR8	Escherichia_phage	84.1	2.5e-21
WP_001571459.1|2528366_2528777_+	DUF1398 domain-containing protein	NA	C6ZCX4	Enterobacteria_phage	79.3	1.2e-55
WP_001019606.1|2528928_2529102_-	addiction module toxin, GnsA/GnsB family	NA	NA	NA	NA	NA
WP_001309517.1|2529273_2529429_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123005512.1|2529508_2529574_-	hypothetical protein	NA	NA	NA	NA	NA
WP_071524604.1|2529576_2529765_-	cold-shock protein	NA	NA	NA	NA	NA
WP_000066495.1|2529775_2529988_-	cold shock protein CspI	NA	A0A1W6JNX5	Morganella_phage	74.3	1.2e-22
WP_021563006.1|2530843_2531377_-	lysozyme	NA	K7PLY1	Enterobacteria_phage	92.7	8.4e-97
WP_000189916.1|2531373_2531685_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	64.6	2.0e-26
WP_000839590.1|2531689_2531905_-|lysis	phage lysis protein EssD	lysis	A5LH82	Enterobacteria_phage	94.4	1.1e-31
WP_000066484.1|2532658_2532874_-	cold shock-like protein CspB	NA	A0A1W6JNX5	Morganella_phage	76.5	3.4e-25
WP_000087756.1|2533174_2533387_+	cold shock-like protein CspF	NA	NA	NA	NA	NA
WP_120795389.1|2533441_2533531_+	Qin prophage; protein YnfS	NA	NA	NA	NA	NA
WP_001571462.1|2533808_2534561_-	antitermination protein	NA	A0A192Y5X6	Salmonella_phage	92.4	2.7e-133
WP_001265198.1|2534574_2535624_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	57.3	1.3e-112
WP_032147666.1|2535625_2535904_-	hypothetical protein	NA	A0A2I6TCC8	Escherichia_phage	45.2	8.8e-05
WP_000980988.1|2535970_2536222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000813254.1|2536438_2536594_-	type I toxin-antitoxin system toxin HokD	NA	A0A0U2QV81	Escherichia_phage	96.1	1.5e-17
WP_000323025.1|2536665_2536953_-	type II toxin-antitoxin system mRNA interferase RelE	NA	A0A2H4JBF4	uncultured_Caudovirales_phage	66.0	1.4e-29
WP_000534858.1|2536952_2537192_-	type II toxin-antitoxin system antitoxin RelB	NA	A0A2H4JBG1	uncultured_Caudovirales_phage	54.4	1.6e-18
WP_001326990.1|2537216_2537522_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001301033.1|2537724_2538057_+	protein FlxA	NA	NA	NA	NA	NA
WP_001571463.1|2538493_2539807_-|transposase	ISNCY family transposase	transposase	NA	NA	NA	NA
WP_000955178.1|2539984_2540167_+	hypothetical protein	NA	Q7Y2Q9	Escherichia_phage	74.5	6.3e-12
WP_001310834.1|2541473_2541830_-	class I SAM-dependent methyltransferase	NA	H9C170	Pectobacterium_phage	69.6	1.6e-38
WP_001151262.1|2541826_2542249_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	92.0	4.4e-64
WP_000054512.1|2542289_2543255_-	hypothetical protein	NA	U5P0A0	Shigella_phage	60.2	2.2e-55
WP_000705358.1|2543235_2543757_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000920568.1|2543740_2543971_-	dicB transcriptional regulator DicC	NA	NA	NA	NA	NA
WP_000448564.1|2544054_2544462_+	DNA-binding transcriptional dual regulator DicA	NA	K7PM82	Enterobacteria_phage	54.7	4.4e-13
WP_000379575.1|2544628_2544784_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	53.2	3.0e-07
WP_001673454.1|2544943_2545162_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001296188.1|2545165_2545330_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000854559.1|2545729_2545918_+	cell division inhibition protein DicB	NA	NA	NA	NA	NA
WP_001083297.1|2545914_2546106_+|lysis	lysis protein YdfD	lysis	NA	NA	NA	NA
WP_174183235.1|2546198_2547326_+	exonuclease	NA	NA	NA	NA	NA
WP_174183236.1|2547266_2548525_-|transposase	IS3-like element IS2 family transposase	transposase	Q9ZXG3	Shigella_phage	99.0	2.5e-176
WP_174183237.1|2548578_2549991_+	3'-5' exoribonuclease	NA	A0A192Y6E0	Salmonella_phage	56.7	4.9e-59
WP_000005552.1|2550063_2550315_+	excisionase family protein	NA	S4TND0	Salmonella_phage	50.0	2.2e-15
WP_001571468.1|2550349_2551630_+	DUF3596 domain-containing protein	NA	B6DZ48	Enterobacteria_phage	61.8	7.3e-155
WP_000836045.1|2551818_2552838_-	Zn-dependent oxidoreductase	NA	E3SJ82	Synechococcus_phage	26.2	7.4e-17
WP_087900063.1|2552849_2553860_-	D-galactonate dehydratase family protein	NA	NA	NA	NA	NA
WP_001304355.1|2554065_2554392_-	YnfA family protein	NA	A0A218MNG8	uncultured_virus	54.5	2.9e-23
>prophage 10
NZ_CP054353	Escherichia coli strain SCU-172 chromosome, complete genome	5170495	2714070	2726816	5170495	tRNA	Escherichia_phage(66.67%)	14	NA	NA
WP_001169151.1|2714070_2714226_+	YdaF family protein	NA	M4QQ57	Salicola_phage	55.3	6.1e-08
WP_032142840.1|2714222_2714711_-	super-infection exclusion protein B	NA	NA	NA	NA	NA
WP_000560223.1|2715151_2715373_+	killing protein KilR	NA	A0A0U2RTC4	Escherichia_phage	98.6	2.0e-36
WP_001485242.1|2715372_2715543_+	hypothetical protein	NA	A0A0U2SHB5	Escherichia_phage	71.4	6.1e-17
WP_000632297.1|2715617_2715893_+	protein RacC	NA	A0A0U2QW85	Escherichia_phage	96.7	1.4e-42
WP_000105133.1|2715994_2718595_+	exodeoxyribonuclease VIII	NA	A0A0U2I1R6	Escherichia_phage	63.2	3.9e-248
WP_000166319.1|2718587_2719397_+	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	71.5	8.8e-106
WP_042038331.1|2719453_2719648_+	type I toxin-antitoxin system endodeoxyribonuclease toxin RalR	NA	A0A0U2QQP4	Escherichia_phage	95.3	1.3e-31
WP_001302840.1|2719640_2719829_+	DUF1187 family protein	NA	A0A0U2QL97	Escherichia_phage	98.4	5.5e-27
WP_000079604.1|2719928_2720144_+	excisionase XisR	NA	A0A0U2RY08	Escherichia_phage	100.0	1.8e-37
WP_001157407.1|2721430_2722366_+|tRNA	tRNA 2-thiocytidine(32) synthetase TtcA	tRNA	A0A0U2S5Z2	Escherichia_phage	98.8	5.9e-146
WP_000123722.1|2722494_2723868_-	ATP-dependent RNA helicase DbpA	NA	Q5GF26	Diachasmimorpha_longicaudata_entomopoxvirus	33.1	3.9e-53
WP_000387388.1|2724345_2725329_-	zinc transporter ZntB	NA	NA	NA	NA	NA
WP_021563001.1|2725583_2726816_+	diguanylate cyclase DgcM	NA	A0A127AWB9	Bacillus_phage	39.5	3.1e-17
>prophage 11
NZ_CP054353	Escherichia coli strain SCU-172 chromosome, complete genome	5170495	2801192	2849465	5170495	protease,integrase,lysis,tail,transposase,holin	Escherichia_phage(24.14%)	57	2823225:2823239	2849842:2849856
WP_000422040.1|2801192_2802242_-|protease	protease SohB	protease	A0A2H4UUF9	Bodo_saltans_virus	31.5	1.3e-21
WP_000559303.1|2802461_2803220_+	YciK family oxidoreductase	NA	A0A0N9R355	Chrysochromulina_ericina_virus	23.4	3.3e-06
WP_001278895.1|2803216_2803807_+	cob(I)yrinic acid a,c-diamide adenosyltransferase	NA	NA	NA	NA	NA
WP_001000712.1|2803859_2804168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_021562996.1|2804178_2805144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001291217.1|2806126_2807002_-	23S rRNA pseudouridine(2605) synthase RluB	NA	NA	NA	NA	NA
WP_001571342.1|2807212_2809108_-	DUF2207 domain-containing protein	NA	NA	NA	NA	NA
WP_001295575.1|2809135_2809756_-	threonylcarbamoyl-AMP synthase	NA	NA	NA	NA	NA
WP_001285697.1|2809752_2810634_-	5'-3' exoribonuclease	NA	NA	NA	NA	NA
WP_001700591.1|2810771_2810816_+	trp operon leader peptide	NA	NA	NA	NA	NA
WP_001194634.1|2810907_2812470_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_000763524.1|2812469_2814065_+	bifunctional anthranilate synthase glutamate amidotransferase component TrpG/anthranilate phosphoribosyltransferase TrpD	NA	A0A0N7IRD9	Acinetobacter_phage	38.5	1.7e-52
WP_000983885.1|2814065_2815427_+	bifunctional indole-3-glycerol-phosphate synthase TrpC/phosphoribosylanthranilate isomerase TrpF	NA	A0A0P0IR83	Acinetobacter_phage	40.2	6.6e-37
WP_000209513.1|2815438_2816632_+	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_000443095.1|2816631_2817438_+	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_001571340.1|2817818_2817998_+	general stress protein	NA	NA	NA	NA	NA
WP_001056491.1|2818083_2818584_+	ferritin-like domain-containing protein	NA	NA	NA	NA	NA
WP_001082539.1|2819888_2820356_-|lysis	lysis protein	lysis	Q9ZXB6	Enterobacteria_phage	90.3	9.1e-71
WP_001571305.1|2820654_2821188_-	lysozyme	NA	Q6H9V6	Enterobacteria_phage	93.8	5.3e-99
WP_000369850.1|2821293_2821566_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000193278.1|2821531_2821876_-	YdfR family protein	NA	K7PGU6	Enterobacteria_phage	95.2	2.8e-37
WP_000284510.1|2821880_2822096_-|holin	class II holin family protein	holin	G9L6J5	Escherichia_phage	100.0	9.0e-34
WP_000874516.1|2822246_2824100_-	SASA family carbohydrate esterase	NA	Q08JA2	Stx2-converting_phage	90.5	0.0e+00
2823225:2823239	attL	ACCGTGTTCTTGTTT	NA	NA	NA	NA
WP_000935536.1|2825373_2826423_-	site-specific DNA-methyltransferase	NA	A0A0N7KZF8	Stx2-converting_phage	95.7	8.8e-199
WP_000917768.1|2826573_2826771_-	hypothetical protein	NA	S5MQK8	Escherichia_phage	100.0	6.1e-29
WP_001064916.1|2826985_2827675_-	antiterminator	NA	I6PDF8	Cronobacter_phage	46.4	2.3e-54
WP_000140035.1|2827671_2828037_-	RusA family crossover junction endodeoxyribonuclease	NA	V5URS4	Shigella_phage	66.7	4.6e-38
WP_001265092.1|2828037_2829093_-	DUF968 domain-containing protein	NA	A0A291AWV9	Escherichia_phage	48.4	4.0e-90
WP_001329966.1|2829094_2829367_-	hypothetical protein	NA	I6PCV7	Cronobacter_phage	49.2	5.5e-12
WP_001112736.1|2829313_2829493_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000018429.1|2829534_2829747_-	type I toxin-antitoxin system Hok family toxin	NA	A0A0U2QV81	Escherichia_phage	90.0	5.2e-26
WP_000150294.1|2829927_2830593_-	epoxyqueuosine reductase QueH	NA	NA	NA	NA	NA
WP_001151165.1|2830767_2831193_-	DUF977 family protein	NA	A0A0U2QQN3	Escherichia_phage	93.3	4.8e-63
WP_000450998.1|2831208_2831979_-	DUF1627 domain-containing protein	NA	A0A0U2SAW4	Escherichia_phage	64.5	1.6e-80
WP_154388452.1|2832000_2832747_-	ATP-binding protein	NA	A0A088CBP4	Shigella_phage	83.8	2.0e-112
WP_000095673.1|2832753_2833716_-	helix-turn-helix domain-containing protein	NA	U5P0A0	Shigella_phage	51.2	1.6e-69
WP_001571298.1|2833738_2834164_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000391950.1|2834147_2834429_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	72.6	6.5e-24
WP_000362153.1|2834529_2834949_+	hypothetical protein	NA	K7PK07	Enterobacteria_phage	65.1	8.8e-25
WP_001725971.1|2835213_2835366_+	DUF1391 family protein	NA	M4QQ57	Salicola_phage	51.1	1.1e-06
WP_001339605.1|2835377_2835779_+	hypothetical protein	NA	I6PDF6	Cronobacter_phage	81.6	1.0e-09
WP_000358769.1|2835738_2836017_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000449175.1|2836588_2836777_+	cell division inhibitor	NA	NA	NA	NA	NA
WP_000199473.1|2836773_2836962_+	DUF1482 family protein	NA	NA	NA	NA	NA
WP_174183243.1|2837057_2839529_+	3'-5' exoribonuclease	NA	K7PLW7	Enterobacteria_phage	60.3	8.5e-59
WP_000113189.1|2839593_2839842_+	excisionase	NA	NA	NA	NA	NA
WP_000113674.1|2839819_2840950_+|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21940	Phage_21	51.4	3.4e-103
WP_000737244.1|2840984_2841623_-	outer membrane protein OmpW	NA	NA	NA	NA	NA
WP_000028541.1|2841977_2842721_+	UPF0259 family protein	NA	NA	NA	NA	NA
WP_000808672.1|2842750_2843290_+	septation protein A	NA	NA	NA	NA	NA
WP_000108160.1|2843394_2843793_+	acyl-CoA thioester hydrolase YciA	NA	NA	NA	NA	NA
WP_001357407.1|2843832_2844549_-	TonB system transport protein TonB	NA	NA	NA	NA	NA
WP_000967595.1|2844772_2845069_+	YciI family protein	NA	NA	NA	NA	NA
WP_000022039.1|2845587_2847381_+	alkaline phosphatase family protein	NA	NA	NA	NA	NA
WP_000497462.1|2847806_2848034_+	DinI family protein	NA	Q6UAW0	Klebsiella_phage	73.0	4.8e-25
WP_000843045.1|2848122_2848491_-|tail	tail fiber domain-containing protein	tail	W6ASK4	Escherichia_phage	50.4	2.2e-27
WP_077635307.1|2848586_2849465_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	61.7	2.7e-84
2849842:2849856	attR	ACCGTGTTCTTGTTT	NA	NA	NA	NA
>prophage 12
NZ_CP054353	Escherichia coli strain SCU-172 chromosome, complete genome	5170495	3157532	3282708	5170495	portal,protease,transposase,integrase,plate,head,tail,capsid,tRNA	Enterobacteria_phage(40.0%)	112	3152532:3152547	3275743:3275758
3152532:3152547	attL	GCTCCGCTTCCGCCTG	NA	NA	NA	NA
WP_001298300.1|3157532_3158318_-|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_000899600.1|3158453_3159233_+	envelope biogenesis factor ElyC	NA	NA	NA	NA	NA
WP_000436900.1|3159209_3160103_-	YcbJ family phosphotransferase	NA	NA	NA	NA	NA
WP_000011609.1|3160256_3161003_-	3-deoxy-manno-octulosonate cytidylyltransferase	NA	NA	NA	NA	NA
WP_000350058.1|3160999_3161182_-	protein YcaR	NA	NA	NA	NA	NA
WP_000056519.1|3161233_3162466_-	winged helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_000570527.1|3162502_3163489_-	tetraacyldisaccharide 4'-kinase	NA	NA	NA	NA	NA
WP_000551270.1|3163485_3165234_-	lipid A ABC transporter ATP-binding protein/permease MsbA	NA	W8CYL7	Bacillus_phage	29.8	2.5e-57
WP_001571215.1|3165270_3167535_-	ComEC family protein	NA	NA	NA	NA	NA
WP_000167336.1|3167741_3168026_-	integration host factor subunit beta	NA	A7KV42	Bacillus_phage	40.2	3.2e-10
WP_000140327.1|3168185_3169859_-	30S ribosomal protein S1	NA	NA	NA	NA	NA
WP_000125016.1|3169969_3170653_-	(d)CMP kinase	NA	NA	NA	NA	NA
WP_001353317.1|3170825_3171590_-	metallopeptidase YcaL	NA	NA	NA	NA	NA
WP_000483766.1|3171778_3173125_+|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
WP_000445216.1|3173197_3174481_-	3-phosphoshikimate 1-carboxyvinyltransferase	NA	NA	NA	NA	NA
WP_000057143.1|3174551_3175640_-	3-phosphoserine/phosphohydroxythreonine transaminase	NA	M1Q1P2	Streptococcus_phage	46.8	3.5e-81
WP_000642852.1|3175838_3176531_-	DUF421 domain-containing protein	NA	NA	NA	NA	NA
WP_001571629.1|3176660_3178421_+	30S ribosomal protein S12 methylthiotransferase accessory protein YcaO	NA	NA	NA	NA	NA
WP_000642546.1|3178826_3179684_+	formate transporter FocA	NA	NA	NA	NA	NA
WP_001292820.1|3179738_3182021_+	formate C-acetyltransferase	NA	A0A2P0VNR5	Tetraselmis_virus	41.5	1.3e-162
WP_000111043.1|3182212_3182953_+	pyruvate formate lyase 1-activating protein	NA	A0A2P0VNQ0	Tetraselmis_virus	26.5	8.0e-21
WP_001571630.1|3183099_3186207_-	cellulose biosynthesis protein BcsC	NA	NA	NA	NA	NA
WP_001049883.1|3189455_3191570_-	UDP-forming cellulose synthase catalytic subunit	NA	NA	NA	NA	NA
WP_001571636.1|3191643_3192984_-	GGDEF domain-containing protein	NA	NA	NA	NA	NA
WP_174183249.1|3192988_3195337_-	CHASE9 sensor domain-containing protein	NA	NA	NA	NA	NA
WP_000109288.1|3198065_3199214_-	MFS transporter	NA	NA	NA	NA	NA
WP_000165876.1|3199528_3200155_+	hydrolase	NA	NA	NA	NA	NA
WP_000534659.1|3200190_3201054_-	dimethyl sulfoxide reductase anchor subunit DmsC	NA	NA	NA	NA	NA
WP_000213098.1|3201055_3201673_-	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	60.6	5.0e-77
WP_000850334.1|3201683_3204128_-	dimethylsulfoxide reductase subunit A	NA	A0A077SK27	Escherichia_phage	49.8	8.6e-221
WP_087889394.1|3204427_3205420_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A0F7LBR0	Escherichia_phage	55.9	7.3e-102
WP_016232598.1|3205489_3205831_-	helix-turn-helix transcriptional regulator	NA	Q1JS45	Enterobacteria_phage	48.8	3.9e-15
WP_001232123.1|3205935_3206460_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001031145.1|3207000_3207264_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016232596.1|3207416_3207761_+	DUF4761 family protein	NA	NA	NA	NA	NA
WP_000568659.1|3207779_3208022_+	DUF4754 family protein	NA	NA	NA	NA	NA
WP_016236093.1|3208357_3208588_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087889395.1|3208587_3209169_+	3'-5' exoribonuclease	NA	K7PM77	Enterobacteria_phage	38.7	5.7e-30
WP_042100958.1|3209402_3210347_+	Dam family site-specific DNA-(adenine-N6)-methyltransferase	NA	A0A0M4QWR0	Salmonella_phage	45.1	5.5e-59
WP_079399664.1|3210375_3210726_+	DUF4406 domain-containing protein	NA	A0A222YYT7	Escherichia_phage	60.7	5.3e-23
WP_174183250.1|3210744_3211851_+	ash family protein	NA	S5MQL6	Escherichia_phage	34.1	4.0e-08
WP_165828384.1|3212062_3212680_+	ash family protein	NA	S5MQL6	Escherichia_phage	34.8	7.7e-09
WP_000843718.1|3212666_3213083_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016236097.1|3213079_3215593_+	replication endonuclease	NA	A0A0A7NQ77	Enterobacteria_phage	51.5	4.1e-210
WP_016236098.1|3215589_3215994_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016236099.1|3216003_3216213_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079399657.1|3216209_3216548_+	MarR family transcriptional regulator	NA	O48423	Enterobacteria_phage	44.4	1.1e-12
WP_079399655.1|3216580_3216898_+	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000801013.1|3216947_3217484_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016236103.1|3218038_3219082_-|portal	phage portal protein	portal	A0A0A7NPT9	Enterobacteria_phage	70.5	1.0e-146
WP_079399653.1|3219087_3220821_-	helix-turn-helix domain-containing protein	NA	A0A0A7NV54	Enterobacteria_phage	71.5	2.6e-248
WP_016236105.1|3220977_3221814_+|capsid	GPO family capsid scaffolding protein	capsid	A0A0A7NRY7	Enterobacteria_phage	56.1	1.9e-82
WP_016236106.1|3221829_3222924_+|capsid	phage major capsid protein, P2 family	capsid	A0A0A7NQ82	Enterobacteria_phage	61.0	1.1e-119
WP_016236107.1|3222973_3223783_+	hypothetical protein	NA	A0A0A7NPX9	Enterobacteria_phage	59.0	2.1e-67
WP_016236108.1|3223891_3224386_+|head	head completion/stabilization protein	head	A0A0A7NPU2	Enterobacteria_phage	70.6	7.9e-57
WP_016236109.1|3224385_3224586_+|tail	tail protein X	tail	A0A2H4J946	uncultured_Caudovirales_phage	53.1	4.2e-09
WP_079399651.1|3224588_3224879_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_016236111.1|3224862_3225402_+	lysozyme	NA	A0A1S5Q8G1	Aeromonas_phage	41.2	3.2e-27
WP_016236112.1|3225398_3225842_+	hypothetical protein	NA	NA	NA	NA	NA
WP_114476103.1|3225951_3227889_+	DUF1737 domain-containing protein	NA	Q6H9W1	Enterobacteria_phage	55.1	3.9e-192
WP_016236114.1|3228189_3228660_+|tail	phage tail protein	tail	A0A0A7NPU6	Enterobacteria_phage	57.3	1.2e-46
WP_016236115.1|3228656_3229292_+	phage virion morphogenesis protein	NA	A0A0A7NV60	Enterobacteria_phage	44.9	2.6e-44
WP_016236116.1|3229288_3229870_+|plate	phage baseplate assembly protein V	plate	A0A0A7NRZ3	Enterobacteria_phage	60.1	7.8e-64
WP_016236117.1|3229866_3230235_+	GPW/gp25 family protein	NA	A0A0A7NQ90	Enterobacteria_phage	56.1	1.6e-33
WP_087889237.1|3230221_3231118_+|plate	baseplate J/gp47 family protein	plate	A0A0A7NPY5	Enterobacteria_phage	64.4	3.1e-104
WP_016236119.1|3231110_3231644_+|tail	phage tail protein I	tail	Q6K1H3	Salmonella_virus	66.9	1.8e-67
WP_016236120.1|3231650_3234632_+|tail	phage tail protein	tail	Q858V4	Yersinia_virus	50.7	2.0e-219
WP_016236121.1|3234631_3235378_+	DUF4376 domain-containing protein	NA	S5MBX6	Escherichia_phage	49.1	4.4e-43
WP_016236122.1|3235410_3235878_-|tail	phage tail protein	tail	A0A0A7NV65	Enterobacteria_phage	76.2	3.1e-63
WP_174183251.1|3235889_3238748_-|tail	phage tail tape measure protein	tail	F1BUT7	Erwinia_phage	44.1	9.1e-105
WP_032149167.1|3238740_3238896_-|tail	GpE family phage tail protein	tail	A0A0A7NQ96	Enterobacteria_phage	71.4	3.7e-13
WP_016236124.1|3238895_3239288_-	hypothetical protein	NA	NA	NA	NA	NA
WP_016236125.1|3239333_3239846_-|tail	phage major tail tube protein	tail	A0A0A7NPV8	Enterobacteria_phage	61.8	1.2e-55
WP_024195327.1|3239845_3241039_-|tail	phage tail sheath family protein	tail	A0A0A7NV69	Enterobacteria_phage	74.1	5.6e-165
WP_016236127.1|3241191_3242337_+	phage late control D family protein	NA	A0A0A7NQ97	Enterobacteria_phage	73.3	5.2e-152
WP_087889235.1|3242378_3242681_+	ogr/Delta-like zinc finger family protein	NA	A0A0F7LDQ9	Escherichia_phage	46.3	2.3e-06
WP_001135720.1|3242812_3242953_+	Hok/Gef family protein	NA	G9L6L7	Escherichia_phage	84.4	3.6e-15
WP_000886683.1|3243193_3244486_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	48.2	1.5e-94
WP_000067771.1|3244576_3245920_-	replication-associated recombination protein RarA	NA	G3MBE0	Bacillus_virus	41.0	7.3e-81
WP_001295343.1|3245930_3246542_-	outer membrane lipoprotein chaperone LolA	NA	NA	NA	NA	NA
WP_016234723.1|3246700_3250849_-	DNA translocase FtsK	NA	A0A218M9A2	Mycobacterium_phage	48.7	1.2e-86
WP_000228473.1|3250983_3251478_-	leucine-responsive transcriptional regulator Lrp	NA	NA	NA	NA	NA
WP_000537432.1|3252022_3252988_+	thioredoxin-disulfide reductase	NA	A0A2I2L5E1	Orpheovirus	44.6	1.1e-62
WP_001043599.1|3253110_3254877_+	cysteine/glutathione ABC transporter permease/ATP-binding protein CydD	NA	W8CYL7	Bacillus_phage	24.3	3.2e-23
WP_001202182.1|3254877_3256599_+	cysteine/glutathione ABC transporter ATP-binding protein/permease CydC	NA	W8CYL7	Bacillus_phage	25.0	1.1e-20
WP_001241667.1|3256640_3257345_+|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
WP_001040187.1|3257628_3257847_+	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_000934041.1|3258529_3260806_-|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.5	1.9e-166
WP_000520781.1|3260836_3261157_-|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.4	1.6e-13
WP_001624992.1|3261854_3262037_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000133410.1|3262293_3262575_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000224593.1|3263237_3263651_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000380882.1|3263663_3263999_-|head	head decoration protein	head	NA	NA	NA	NA
WP_174183252.1|3264011_3265067_-|capsid	major capsid protein	capsid	C6ZCY2	Enterobacteria_phage	43.1	3.9e-69
WP_000796959.1|3265066_3265273_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001672381.1|3265527_3265776_-	PerC family transcriptional regulator	NA	NA	NA	NA	NA
WP_000126690.1|3265786_3266197_-	single-stranded DNA-binding protein	NA	NA	NA	NA	NA
WP_000198853.1|3266193_3266445_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046623331.1|3266815_3268939_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	53.1	4.0e-174
WP_001261492.1|3268935_3269235_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_046623330.1|3269241_3269562_-	hypothetical protein	NA	NA	NA	NA	NA
WP_077784899.1|3269554_3270478_-	host cell division inhibitor Icd-like protein	NA	NA	NA	NA	NA
WP_046623327.1|3270488_3270698_-	AlpA family phage regulatory protein	NA	A0A2H4JB58	uncultured_Caudovirales_phage	66.1	1.1e-15
WP_046623326.1|3271107_3272346_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JB45	uncultured_Caudovirales_phage	53.0	2.6e-125
WP_000410785.1|3272750_3272975_+	cold shock-like protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	61.2	2.3e-16
WP_021562972.1|3273047_3274994_-	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	40.1	1.1e-37
WP_001571647.1|3274990_3276106_-	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
3275743:3275758	attR	GCTCCGCTTCCGCCTG	NA	NA	NA	NA
WP_001355621.1|3276256_3277213_+	VirK/YbjX family protein	NA	NA	NA	NA	NA
WP_001571650.1|3277209_3278868_-	ATP-dependent endonuclease	NA	NA	NA	NA	NA
WP_000488716.1|3279293_3279989_+	aquaporin Z	NA	NA	NA	NA	NA
WP_000868863.1|3280503_3281529_-|transposase	IS110 family transposase	transposase	NA	NA	NA	NA
WP_001264873.1|3281760_3282708_-|tRNA	tRNA dihydrouridine(16) synthase DusC	tRNA	NA	NA	NA	NA
>prophage 13
NZ_CP054353	Escherichia coli strain SCU-172 chromosome, complete genome	5170495	3849507	3856647	5170495		Escherichia_phage(83.33%)	6	NA	NA
WP_001278992.1|3849507_3850146_-	aldolase	NA	A0A077SK32	Escherichia_phage	74.5	1.8e-82
WP_000590408.1|3850142_3851405_-	3-oxo-tetronate kinase	NA	A0A077SLJ7	Escherichia_phage	61.4	2.2e-135
WP_000847988.1|3851401_3852310_-	NAD(P)-dependent oxidoreductase	NA	A0A077SLF7	Escherichia_phage	76.5	1.5e-117
WP_001295181.1|3852505_3853273_+	DeoR/GlpR transcriptional regulator	NA	A0A077SK06	Escherichia_phage	56.7	2.5e-70
WP_001141300.1|3853323_3853980_-	protein-serine/threonine phosphatase	NA	A0A077SLQ6	Escherichia_phage	46.6	3.0e-51
WP_001272915.1|3854085_3856647_-	DNA mismatch repair protein MutS	NA	E3T5Q7	Cafeteria_roenbergensis_virus	20.7	2.7e-31
>prophage 14
NZ_CP054353	Escherichia coli strain SCU-172 chromosome, complete genome	5170495	3939033	4005643	5170495	portal,integrase,transposase,plate,head,lysis,tail,terminase,capsid,tRNA	Salmonella_phage(71.15%)	81	3949430:3949474	3984642:3984686
WP_114504716.1|3939033_3941367_-	toprim domain-containing protein	NA	Q7M2A8	Enterobacteria_phage	98.6	0.0e+00
WP_000856729.1|3941381_3941702_-	DUF5375 domain-containing protein	NA	NA	NA	NA	NA
WP_000459291.1|3941837_3942293_-	hypothetical protein	NA	Q7M298	Enterobacteria_phage	99.1	1.6e-64
WP_001244664.1|3942285_3942573_-	hypothetical protein	NA	Q7M2A0	Enterobacteria_phage	98.9	5.1e-48
WP_001360858.1|3942565_3943165_-	host cell division inhibitor Icd-like protein	NA	Q7M2A7	Enterobacteria_phage	81.8	3.0e-50
WP_001149160.1|3943161_3943428_-	AlpA family transcriptional regulator	NA	Q7M299	Enterobacteria_phage	100.0	4.9e-45
WP_174183263.1|3943980_3944715_+	glycoprotein 3	NA	Q7M2A2	Enterobacteria_phage	97.5	1.5e-128
WP_151309698.1|3944711_3945212_+	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_021569893.1|3945285_3945858_+	hypothetical protein	NA	Q7M2A1	Enterobacteria_phage	96.8	1.4e-94
WP_001183326.1|3946074_3948033_-	NACHT domain-containing protein	NA	X5JAK5	Clostridium_phage	31.1	8.8e-67
WP_021562945.1|3948036_3949245_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A1B5FPC6	Escherichia_phage	50.1	8.6e-105
3949430:3949474	attL	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_029401564.1|3949589_3950240_-	hypothetical protein	NA	NA	NA	NA	NA
WP_029401565.1|3950254_3951271_-|integrase	site-specific integrase	integrase	A0A1S6L016	Salmonella_phage	94.4	1.2e-189
WP_029401566.1|3951272_3951905_-	phage repressor protein CI	NA	A0A1S6KZZ7	Salmonella_phage	91.0	3.1e-106
WP_029401570.1|3952024_3952267_+	hypothetical protein	NA	A0A1S6KZZ6	Salmonella_phage	96.2	2.0e-37
WP_001399248.1|3952299_3952809_+	phage regulatory CII family protein	NA	E5G6L3	Salmonella_phage	99.4	3.4e-87
WP_000956187.1|3952816_3953113_+	DUF2724 domain-containing protein	NA	E5G6L4	Salmonella_phage	92.3	2.2e-22
WP_000996717.1|3953230_3953572_+	DUF5347 domain-containing protein	NA	E5G6L5	Salmonella_phage	98.2	1.7e-55
WP_001244213.1|3953639_3953873_+	DUF2732 family protein	NA	E5G6L6	Salmonella_phage	97.4	1.4e-32
WP_023568304.1|3953872_3954100_+	TraR/DksA family transcriptional regulator	NA	E5G6L7	Salmonella_phage	98.7	6.0e-36
WP_000196280.1|3954096_3954399_+	DUF3850 domain-containing protein	NA	A0A0A8WI22	Clostridium_phage	42.1	9.8e-10
WP_000104157.1|3954395_3955253_+	DNA adenine methylase	NA	E5G6L8	Salmonella_phage	98.2	4.1e-162
WP_174183264.1|3955249_3957664_+	replication endonuclease	NA	E5G6L9	Salmonella_phage	98.1	0.0e+00
WP_001154434.1|3957816_3958005_+	hypothetical protein	NA	E5G6M0	Salmonella_phage	98.4	5.5e-27
WP_001217563.1|3958015_3958249_+	DinI family protein	NA	E5G6M1	Salmonella_phage	98.7	8.0e-36
WP_000094764.1|3958519_3958735_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000212611.1|3958734_3959577_+	hypothetical protein	NA	A0A0M4R2T6	Salmonella_phage	48.1	8.4e-59
WP_000567607.1|3959903_3960320_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001374087.1|3960545_3960923_+	toll/interleukin-1 receptor domain-containing protein	NA	NA	NA	NA	NA
WP_174183265.1|3960955_3961984_-|portal	phage portal protein	portal	A0A1S6KZW5	Salmonella_phage	89.5	1.4e-172
WP_001098431.1|3961983_3963750_-|terminase	terminase ATPase subunit family protein	terminase	A0A1S6KZW3	Salmonella_phage	99.7	0.0e+00
WP_174183266.1|3963892_3964726_+|capsid	GPO family capsid scaffolding protein	capsid	A0A1S6KZW9	Salmonella_phage	90.6	1.1e-122
WP_000742511.1|3964742_3965801_+|capsid	phage major capsid protein, P2 family	capsid	E5G6M6	Salmonella_phage	93.4	2.9e-181
WP_174183267.1|3965804_3966455_+|terminase	terminase endonuclease subunit	terminase	E5G6M7	Salmonella_phage	94.9	9.6e-111
WP_174183268.1|3966550_3967015_+|head	head completion/stabilization protein	head	A0A1S6KZW8	Salmonella_phage	87.7	1.0e-74
WP_000868175.1|3967014_3967218_+|tail	tail protein X	tail	E5G6M9	Salmonella_phage	92.5	1.4e-31
WP_000171568.1|3967221_3967437_+	hypothetical protein	NA	E5G6N0	Salmonella_phage	80.3	1.8e-26
WP_152071069.1|3967417_3967930_+	glycoside hydrolase family protein	NA	E5G6N1	Salmonella_phage	90.5	1.3e-86
WP_000727853.1|3967931_3968309_+	hypothetical protein	NA	A0A1S6KZZ2	Salmonella_phage	40.0	2.3e-16
WP_001080935.1|3968305_3968734_+|lysis	LysB family phage lysis regulatory protein	lysis	E5G6N2	Salmonella_phage	73.8	1.6e-45
WP_001039935.1|3968829_3969261_+|tail	phage tail protein	tail	E5G6N3	Salmonella_phage	92.3	6.4e-71
WP_000829141.1|3969253_3969700_+	phage virion morphogenesis protein	NA	A0A1S6L001	Salmonella_phage	84.9	1.5e-62
WP_109538349.1|3969768_3970347_+|plate	phage baseplate assembly protein V	plate	A0A1S6KZX7	Salmonella_phage	86.5	7.2e-94
WP_000177590.1|3970343_3970703_+	GPW/gp25 family protein	NA	A0A1S6KZZ4	Salmonella_phage	86.6	9.5e-52
WP_174183269.1|3970689_3971598_+|plate	baseplate assembly protein	plate	A0A1S6KZY6	Salmonella_phage	90.1	1.1e-141
WP_001086836.1|3971590_3972196_+|tail	phage tail protein I	tail	A0A1S6L000	Salmonella_phage	92.5	1.5e-110
WP_000905033.1|3975196_3975763_+	recombinase family protein	NA	A0A0F7LA37	Escherichia_phage	86.8	3.8e-87
WP_174183270.1|3975904_3977077_+|tail	phage tail sheath protein	tail	A0A1S6KZY7	Salmonella_phage	89.5	1.9e-202
WP_001504081.1|3977086_3977602_+|tail	phage major tail tube protein	tail	A0A1S6L002	Salmonella_phage	94.7	4.8e-89
WP_001281016.1|3977656_3977959_+|tail	phage tail assembly protein	tail	A0A1S6KZZ9	Salmonella_phage	90.0	8.2e-41
WP_000763313.1|3977973_3978093_+|tail	GpE family phage tail protein	tail	E5G6Q0	Salmonella_phage	84.6	4.1e-12
WP_174183271.1|3978085_3981163_+|tail	phage tail tape measure protein	tail	E5G6Q1	Salmonella_phage	63.0	0.0e+00
WP_000980413.1|3981159_3981645_+|tail	phage tail protein	tail	E5G6Q2	Salmonella_phage	80.6	6.3e-67
WP_174183272.1|3981641_3982742_+	phage late control D family protein	NA	A0A1S6KZZ5	Salmonella_phage	87.4	5.5e-175
WP_071780634.1|3982810_3983029_+	ogr/Delta-like zinc finger family protein	NA	Q53ZE7	Salmonella_virus	75.0	1.1e-26
WP_113870597.1|3983269_3984346_-	ParA family protein	NA	H2BD62	Pseudomonas_phage	32.2	9.8e-36
WP_000162574.1|3985218_3985701_-	SsrA-binding protein SmpB	NA	W5RAM5	Staphylococcus_phage	46.8	4.0e-29
3984642:3984686	attR	TGGTGGAGCTGGCGGGAGTTGAACCCGCGTCCGAAATTCCTACAT	NA	NA	NA	NA
WP_000600189.1|3985832_3986309_+	type II toxin-antitoxin system toxin RatA	NA	NA	NA	NA	NA
WP_001117840.1|3986298_3986589_+	RnfH family protein	NA	NA	NA	NA	NA
WP_001203437.1|3986650_3986992_-	outer membrane protein assembly factor BamE	NA	NA	NA	NA	NA
WP_000880932.1|3987140_3988802_-	DNA repair protein RecN	NA	NA	NA	NA	NA
WP_001059146.1|3988887_3989766_-	NAD(+) kinase	NA	NA	NA	NA	NA
WP_001300112.1|3989889_3990480_+	nucleotide exchange factor GrpE	NA	NA	NA	NA	NA
WP_001287920.1|3990514_3991120_-	hypothetical protein	NA	NA	NA	NA	NA
WP_010723175.1|3991240_3992527_-	HlyC/CorC family transporter	NA	NA	NA	NA	NA
WP_001338897.1|3992547_3993339_-	inner membrane protein YpjD	NA	NA	NA	NA	NA
WP_000460035.1|3993505_3994867_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_000256450.1|3995003_3995252_+	30S ribosomal protein S16	NA	NA	NA	NA	NA
WP_000043335.1|3995270_3995819_+	ribosome maturation factor RimM	NA	NA	NA	NA	NA
WP_087900134.1|3995849_3996617_+|tRNA	tRNA (guanosine(37)-N1)-methyltransferase TrmD	tRNA	NA	NA	NA	NA
WP_000065253.1|3996658_3997006_+	50S ribosomal protein L19	NA	NA	NA	NA	NA
WP_000589834.1|3997082_3997565_-	OmpA family protein	NA	NA	NA	NA	NA
WP_000969053.1|3997580_3998807_-	diguanylate cyclase DgcN	NA	NA	NA	NA	NA
WP_001571813.1|3998796_3999315_-	YfiR family protein	NA	NA	NA	NA	NA
WP_001353010.1|3999464_3999830_-	DUF2799 domain-containing protein	NA	NA	NA	NA	NA
WP_001168045.1|4000040_4001111_+	3-deoxy-7-phosphoheptulonate synthase AroF	NA	A0A0F6R6T6	Escherichia_coli_O157_typing_phage	51.2	4.0e-90
WP_000225208.1|4001121_4002243_+	bifunctional chorismate mutase/prephenate dehydrogenase	NA	NA	NA	NA	NA
WP_001571816.1|4002285_4003446_-	bifunctional chorismate mutase/prephenate dehydratase	NA	NA	NA	NA	NA
WP_001386991.1|4003544_4003592_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000178456.1|4003695_4004037_-	ribosome-associated translation inhibitor RaiA	NA	NA	NA	NA	NA
WP_000483766.1|4004296_4005643_-|transposase	IS4-like element IS4 family transposase	transposase	NA	NA	NA	NA
>prophage 15
NZ_CP054353	Escherichia coli strain SCU-172 chromosome, complete genome	5170495	4184892	4254486	5170495	protease,integrase,lysis,tRNA,transposase	Stx2-converting_phage(42.86%)	56	4199513:4199528	4215951:4215966
WP_000858396.1|4184892_4185390_+|protease	SprT family zinc-dependent metalloprotease	protease	NA	NA	NA	NA
WP_001571880.1|4185484_4186192_+	deoxyribonuclease I	NA	NA	NA	NA	NA
WP_001300912.1|4186271_4187003_+	16S rRNA (uracil(1498)-N(3))-methyltransferase	NA	NA	NA	NA	NA
WP_000593273.1|4187015_4187966_+	glutathione synthase	NA	NA	NA	NA	NA
WP_001053178.1|4188074_4188638_+	YqgE/AlgH family protein	NA	NA	NA	NA	NA
WP_000017106.1|4188637_4189054_+	Holliday junction resolvase RuvX	NA	NA	NA	NA	NA
WP_001055632.1|4189266_4190247_-	type IV pilus twitching motility protein PilT	NA	NA	NA	NA	NA
WP_000997795.1|4190264_4190969_+	pyridoxal phosphate homeostasis protein	NA	NA	NA	NA	NA
WP_001094831.1|4190986_4191553_+	osmotic shock tolerance protein YggT	NA	NA	NA	NA	NA
WP_001277222.1|4191549_4191840_+	YggU family protein	NA	NA	NA	NA	NA
WP_001174738.1|4191847_4192441_+	XTP/dITP diphosphatase	NA	NA	NA	NA	NA
WP_000239986.1|4192433_4193570_+	radical SAM family heme chaperone HemW	NA	NA	NA	NA	NA
WP_000784004.1|4193882_4194869_+	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_000577029.1|4194913_4195417_+	TRAP transporter small permease	NA	NA	NA	NA	NA
WP_001571881.1|4195416_4196718_+	TRAP transporter large permease subunit	NA	NA	NA	NA	NA
WP_001521259.1|4196773_4197781_-	DUF1202 family protein	NA	NA	NA	NA	NA
WP_000394132.1|4197897_4198944_-	L-asparaginase 2	NA	NA	NA	NA	NA
WP_000984791.1|4199119_4199839_-	DUF2884 domain-containing protein	NA	NA	NA	NA	NA
4199513:4199528	attL	CTCCTGAACGATAATT	NA	NA	NA	NA
WP_001107566.1|4200075_4200402_-	YggL family protein	NA	NA	NA	NA	NA
WP_000786911.1|4200401_4201121_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
WP_001309725.1|4201281_4202334_+	A/G-specific adenine glycosylase	NA	NA	NA	NA	NA
WP_000091700.1|4202361_4202637_+	oxidative damage protection protein	NA	NA	NA	NA	NA
WP_001336290.1|4202701_4203781_+	membrane-bound lytic murein transglycosylase MltC	NA	NA	NA	NA	NA
WP_001049791.1|4203982_4205239_+	nucleoside permease NupG	NA	NA	NA	NA	NA
WP_000839808.1|4205284_4207420_-	ornithine decarboxylase	NA	NA	NA	NA	NA
WP_000234490.1|4207818_4208526_+	DUF554 domain-containing protein	NA	NA	NA	NA	NA
WP_001218878.1|4208904_4210170_+|integrase	integrase arm-type DNA-binding domain-containing protein	integrase	Q7M297	Enterobacteria_phage	37.8	1.3e-76
WP_000147018.1|4210425_4211469_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000839179.1|4212891_4213296_+	IS66 family insertion sequence hypothetical protein	NA	A0A0P0ZCV4	Stx2-converting_phage	100.0	3.0e-70
WP_000612626.1|4213292_4213640_+	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZDM8	Stx2-converting_phage	100.0	2.6e-62
WP_021563200.1|4213688_4215227_+|transposase	IS66 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	98.0	1.9e-290
WP_016240919.1|4215142_4215793_-	DUF1705 domain-containing protein	NA	NA	NA	NA	NA
WP_000116006.1|4215981_4216239_-	hypothetical protein	NA	NA	NA	NA	NA
4215951:4215966	attR	AATTATCGTTCAGGAG	NA	NA	NA	NA
WP_001330348.1|4217547_4217850_-	winged helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_001049880.1|4218147_4218489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001087508.1|4220041_4220758_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001447126.1|4221250_4221802_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_000332660.1|4223272_4223872_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000723797.1|4225471_4225993_-	fimbrial protein	NA	NA	NA	NA	NA
WP_000597712.1|4226019_4226556_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_001617400.1|4226565_4227147_-	protein prsJ	NA	NA	NA	NA	NA
WP_000265730.1|4227183_4227918_-	fimbria/pilus periplasmic chaperone	NA	NA	NA	NA	NA
WP_024188759.1|4230556_4231144_-	type 1 fimbrial protein	NA	NA	NA	NA	NA
WP_000597754.1|4231206_4231773_-	P fimbria major subunit PapA	NA	NA	NA	NA	NA
WP_001389262.1|4232710_4232932_+	P fimbrial regulatory protein KS71A	NA	NA	NA	NA	NA
WP_001513409.1|4234799_4234913_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_001110186.1|4236746_4237007_+	DUF1471 domain-containing protein	NA	NA	NA	NA	NA
WP_000109148.1|4237048_4237609_+	TetR/AcrR family transcriptional regulator	NA	NA	NA	NA	NA
WP_001296373.1|4237648_4238077_+	DUF417 family protein	NA	NA	NA	NA	NA
WP_105955809.1|4238785_4240013_+|transposase	IS3 family transposase	transposase	Q9ZXG3	Shigella_phage	94.7	2.5e-168
WP_001223354.1|4240513_4242604_+	bifunctional siderophore receptor/adhesin Iha	NA	A0A0P0I887	Acinetobacter_phage	31.5	2.6e-08
WP_001296383.1|4243465_4243708_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001521284.1|4243998_4244367_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000266542.1|4244370_4244586_+	hypothetical protein	NA	NA	NA	NA	NA
WP_001571891.1|4249970_4250552_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001034082.1|4250598_4254486_-|protease	serine protease autotransporter toxin Sat	protease	Q9LA58	Enterobacterial_phage	38.9	2.6e-227
