The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP046051	Ruminococcaceae bacterium LBM 19010 chromosome, complete genome	1989979	134390	235992	1989979	capsid,transposase,protease,tail,holin,tRNA,portal,terminase,plate,integrase,head	Erysipelothrix_phage(38.1%)	112	170238:170260	182716:182738
WP_086034924.1|134390_135893_+|tRNA	lysine--tRNA ligase	tRNA	A0A2K9KZX5	Tupanvirus	42.3	4.3e-98
WP_086034925.1|135896_136535_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086034926.1|136592_137231_-	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_086034927.1|137392_138652_+	3-isopropylmalate dehydratase large subunit	NA	NA	NA	NA	NA
WP_086034928.1|138668_139163_+	3-isopropylmalate dehydratase small subunit	NA	NA	NA	NA	NA
WP_086034929.1|139293_140004_+	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	43.0	1.1e-51
WP_174193614.1|140133_141720_+	HAMP domain-containing histidine kinase	NA	W8CYF6	Bacillus_phage	32.7	2.3e-41
WP_174192616.1|141706_143152_+|protease	serine protease	protease	A0A1B1IT49	uncultured_Mediterranean_phage	28.5	1.2e-17
WP_086034931.1|143350_143665_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174192618.1|143651_144899_+|terminase	PBSX family phage terminase large subunit	terminase	E5DV50	Deep-sea_thermophilic_phage	47.1	1.1e-110
WP_086036783.1|144898_146053_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086034933.1|146056_146929_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086034934.1|146954_147287_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086034935.1|147300_148305_+|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_157658873.1|148371_148707_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086034937.1|148703_148991_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086034938.1|149081_149594_+	LysM peptidoglycan-binding domain-containing protein	NA	NA	NA	NA	NA
WP_086034939.1|149590_150463_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086034940.1|150484_150820_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174192620.1|150820_151159_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086034942.1|151170_152238_+|plate	baseplate J/gp47 family protein	plate	Q7TDG8	Halovirus	28.9	1.0e-08
WP_086034943.1|152234_152801_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086034944.1|152871_153315_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086034945.1|153396_154656_+	GTPase HflX	NA	NA	NA	NA	NA
WP_086034946.1|154652_155132_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086034947.1|155109_155607_-	flavin reductase	NA	NA	NA	NA	NA
WP_086034948.1|155840_157082_+	argininosuccinate synthase	NA	NA	NA	NA	NA
WP_086034949.1|157163_158201_+	N-acetyl-gamma-glutamyl-phosphate reductase	NA	NA	NA	NA	NA
WP_174193616.1|158246_159533_+	bifunctional glutamate N-acetyltransferase/amino-acid acetyltransferase ArgJ	NA	NA	NA	NA	NA
WP_086034951.1|159587_160445_+	acetylglutamate kinase	NA	NA	NA	NA	NA
WP_086034952.1|160510_161686_+	aspartate aminotransferase family protein	NA	A0A1V0SKB7	Klosneuvirus	26.1	6.3e-20
WP_086034953.1|161825_162728_+	ornithine carbamoyltransferase	NA	A7RB08	Paramecium_bursaria_Chlorella_virus	28.7	3.8e-25
WP_157658874.1|162868_164149_-	germination protein YpeB	NA	NA	NA	NA	NA
WP_174192622.1|164437_165823_+	UDP-N-acetylmuramoyl-L-alanine--D-glutamate ligase	NA	NA	NA	NA	NA
WP_086034955.1|165885_168039_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086034956.1|168023_168788_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174193618.1|168846_170112_+	methionine gamma-lyase family protein	NA	NA	NA	NA	NA
170238:170260	attL	TTCAAGTCCTGTCATCCGCACCA	NA	NA	NA	NA
WP_174192623.1|170534_170894_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_174192625.1|170898_172539_-|terminase	terminase large subunit	terminase	A0A290GJW3	Caldibacillus_phage	50.4	1.4e-158
WP_174192627.1|172538_172853_-	hypothetical protein	NA	A0A290GJQ7	Caldibacillus_phage	38.8	1.1e-08
WP_174192636.1|172957_173275_-	HNH endonuclease	NA	R9TNN2	Paenibacillus_phage	50.0	1.0e-25
WP_174192638.1|173271_173556_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_174192640.1|173616_174837_-|capsid	phage major capsid protein	capsid	NA	NA	NA	NA
WP_174192642.1|174839_175388_-|head,protease	HK97 family phage prohead protease	head,protease	A0A1B1PA08	Enterococcus_phage	40.9	1.9e-19
WP_174192644.1|175384_176563_-|portal	phage portal protein	portal	A0A1L2BY94	Clostridium_phage	34.8	1.0e-54
WP_174192646.1|176607_176769_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174192648.1|176765_177137_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174192650.1|177156_177315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174192652.1|177467_177845_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174192654.1|177857_178076_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174192655.1|178360_179980_-	DNA primase	NA	A0A059T6A4	Listeria_phage	24.2	6.5e-15
WP_174192657.1|180068_180278_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_174192659.1|180426_181065_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_174192661.1|181042_182275_+|integrase	site-specific integrase	integrase	A0A142K658	Streptomyces_phage	27.5	4.6e-13
WP_174192663.1|182796_184098_-	DUF4368 domain-containing protein	NA	E4ZFN8	Streptococcus_phage	23.0	4.1e-12
182716:182738	attR	TTCAAGTCCTGTCATCCGCACCA	NA	NA	NA	NA
WP_174192665.1|184531_184750_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086034965.1|185332_186079_-	class I SAM-dependent methyltransferase	NA	NA	NA	NA	NA
WP_086034966.1|186222_187854_-	hydroxylamine reductase	NA	NA	NA	NA	NA
WP_086034967.1|187945_188650_-	4Fe-4S binding protein	NA	NA	NA	NA	NA
WP_174192667.1|188756_189440_+	Crp/Fnr family transcriptional regulator	NA	NA	NA	NA	NA
WP_086034969.1|189630_190044_-	large-conductance mechanosensitive channel protein MscL	NA	NA	NA	NA	NA
WP_174192669.1|190208_190400_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086036785.1|190500_190929_+	small multi-drug export protein	NA	NA	NA	NA	NA
WP_086034971.1|190944_191481_+	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_174192671.1|191750_193715_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_157658876.1|193792_194263_+	PTS sugar transporter subunit IIA	NA	NA	NA	NA	NA
WP_174192673.1|194259_195702_+	PTS fructose transporter subunit IIBC	NA	NA	NA	NA	NA
WP_086034975.1|195755_196013_+	HPr family phosphocarrier protein	NA	NA	NA	NA	NA
WP_086034976.1|196247_197006_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_086034977.1|197060_198110_+	S-methyl-5-thioribose-1-phosphate isomerase	NA	NA	NA	NA	NA
WP_174192674.1|198184_198376_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157658877.1|198460_198727_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086034980.1|198775_199633_-	FUSC family protein	NA	NA	NA	NA	NA
WP_174192676.1|199629_200310_-	HAD family hydrolase	NA	NA	NA	NA	NA
WP_086034982.1|200314_200980_-	UDP-N-acetylglucosamine pyrophosphorylase	NA	NA	NA	NA	NA
WP_174192678.1|201496_202876_+	23S rRNA (uracil(1939)-C(5))-methyltransferase RlmD	NA	F5CA72	Streptococcus_phi-m46.1-like_phage	37.4	6.8e-82
WP_174192680.1|203369_206660_-	DEAD/DEAH box helicase	NA	A0A167RIL2	Powai_lake_megavirus	27.7	1.6e-33
WP_174192682.1|207032_208601_-	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	56.5	4.2e-160
WP_174192683.1|209021_210581_-	recombinase family protein	NA	A0A2K5B2B2	Erysipelothrix_phage	51.8	6.6e-142
WP_086036626.1|210632_210839_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174192685.1|211046_211460_-|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	69.9	5.1e-49
WP_174192687.1|211538_211898_-|head,tail	head-tail adaptor protein	head,tail	NA	NA	NA	NA
WP_174192689.1|211909_212185_-|head,tail	phage gp6-like head-tail connector protein	head,tail	Q6DMT9	Streptococcus_phage	45.7	9.3e-07
WP_086036622.1|212225_213422_-|capsid	phage major capsid protein	capsid	A0A2I4R671	Erysipelothrix_phage	49.6	1.0e-102
WP_174192691.1|213434_214301_-|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	65.6	8.4e-62
WP_174192693.1|214260_215565_-|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	65.0	2.2e-162
WP_174192694.1|215635_215965_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_174192696.1|215961_216267_-	type II toxin-antitoxin system RelB/DinJ family antitoxin	NA	NA	NA	NA	NA
WP_174193619.1|216350_217952_-|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	82.5	4.4e-266
WP_174192698.1|218458_218635_-	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_174192700.1|218627_218861_-	DUF4314 domain-containing protein	NA	A0A2K5B281	Erysipelothrix_phage	56.0	7.5e-18
WP_174192702.1|218844_219555_-	virulence protein	NA	A0A2K5B280	Erysipelothrix_phage	48.5	5.3e-54
WP_174192704.1|219676_220933_-	site-specific DNA-methyltransferase	NA	A0A1B0RXJ0	Streptococcus_phage	45.2	3.5e-109
WP_174192706.1|220933_221485_-|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	61.7	9.7e-56
WP_174192708.1|221782_222304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174192710.1|222306_223368_+|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	31.5	4.2e-23
WP_174192712.1|223579_223939_-	HNH endonuclease	NA	A0A2K5B276	Erysipelothrix_phage	61.2	6.4e-40
WP_174192714.1|224071_224482_-	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_174192716.1|224478_224706_-	hypothetical protein	NA	A0A2K5B274	Erysipelothrix_phage	55.1	4.2e-13
WP_174192717.1|224761_226126_-	DEAD/DEAH box helicase	NA	A0A1X9I6B0	Streptococcus_phage	60.7	6.6e-154
WP_174192719.1|226106_226388_-	VRR-NUC domain-containing protein	NA	M1PFY8	Streptococcus_phage	62.2	5.3e-26
WP_174193621.1|226384_226918_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174193623.1|227174_228716_-	virulence protein E	NA	A0A2K5B271	Erysipelothrix_phage	50.9	7.5e-154
WP_174192721.1|229506_229938_-	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	56.7	6.2e-42
WP_174192723.1|230018_231959_-	DNA polymerase	NA	A0A2K5B2B0	Erysipelothrix_phage	72.0	3.1e-282
WP_174192725.1|232022_232205_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174192727.1|232225_232801_-	DUF2815 family protein	NA	Q6DMW3	Streptococcus_phage	75.5	2.6e-75
WP_174192729.1|232793_233927_-	DUF2800 domain-containing protein	NA	A0A1X9I6D8	Streptococcus_phage	57.9	3.1e-125
WP_174192731.1|233919_234234_-	DNA ligase	NA	A0A2K5B2A7	Erysipelothrix_phage	45.3	1.4e-14
WP_174192733.1|234157_234382_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174192734.1|234469_234982_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174192736.1|235428_235992_+	hypothetical protein	NA	A0A2K5B265	Erysipelothrix_phage	60.9	5.9e-40
>prophage 2
NZ_CP046051	Ruminococcaceae bacterium LBM 19010 chromosome, complete genome	1989979	850574	860188	1989979	tRNA	Staphylococcus_phage(50.0%)	7	NA	NA
WP_174193042.1|850574_852923_-	cation-translocating P-type ATPase	NA	M1HBF8	Paramecium_bursaria_Chlorella_virus	25.8	9.0e-34
WP_174193044.1|853174_854494_+	O-antigen ligase family protein	NA	NA	NA	NA	NA
WP_086035930.1|854588_855056_-	6,7-dimethyl-8-ribityllumazine synthase	NA	A0A2H4PQS3	Staphylococcus_phage	53.0	2.6e-41
WP_086035929.1|855110_856310_-	bifunctional 3,4-dihydroxy-2-butanone-4-phosphate synthase/GTP cyclohydrolase II	NA	A0A2H4PQS2	Staphylococcus_phage	48.1	1.1e-99
WP_086035928.1|856313_856964_-	riboflavin synthase	NA	A0A2H4PQS5	Staphylococcus_phage	44.8	2.2e-38
WP_086035927.1|856963_858052_-	bifunctional diaminohydroxyphosphoribosylaminopyrimidine deaminase/5-amino-6-(5-phosphoribosylamino)uracil reductase RibD	NA	A0A1V0SE20	Indivirus	34.5	6.2e-46
WP_086035926.1|858493_860188_-|tRNA	glutamine--tRNA ligase/YqeY domain fusion protein	tRNA	A0A222YZ70	Escherichia_phage	55.8	5.1e-180
>prophage 3
NZ_CP046051	Ruminococcaceae bacterium LBM 19010 chromosome, complete genome	1989979	1386292	1481672	1989979	capsid,transposase,protease,tail,holin,tRNA,portal,terminase,integrase,head	Erysipelothrix_phage(33.33%)	97	1414212:1414234	1484047:1484069
WP_174193328.1|1386292_1387447_-|tRNA	alanyl-tRNA editing protein	tRNA	NA	NA	NA	NA
WP_086035405.1|1387693_1388095_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086036824.1|1388131_1389871_-	HAMP domain-containing protein	NA	W8CYF6	Bacillus_phage	34.8	1.3e-34
WP_086035404.1|1389879_1390614_-	response regulator transcription factor	NA	W8CYM9	Bacillus_phage	40.4	4.6e-37
WP_086035403.1|1390634_1391312_-	phosphate signaling complex protein PhoU	NA	NA	NA	NA	NA
WP_174193330.1|1391376_1392282_-	phosphate ABC transporter ATP-binding protein	NA	G9BWD6	Planktothrix_phage	31.0	5.4e-19
WP_174193332.1|1392305_1393208_-	phosphate ABC transporter permease PstA	NA	NA	NA	NA	NA
WP_086035401.1|1393204_1394104_-	phosphate ABC transporter permease subunit PstC	NA	NA	NA	NA	NA
WP_174193334.1|1394175_1395105_-	phosphate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_174193336.1|1395371_1397315_+	fructose-1,6-bisphosphatase	NA	NA	NA	NA	NA
WP_086035398.1|1397402_1397834_-	aspartate carbamoyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_086036822.1|1397827_1398754_-	aspartate carbamoyltransferase	NA	A0A1J0F9B8	Only_Syngen_Nebraska_virus	41.9	4.2e-59
WP_086035397.1|1398859_1400644_-	aminopeptidase P family protein	NA	A0A0P0I8D7	Acinetobacter_phage	37.6	1.5e-110
WP_086035396.1|1400895_1402278_-	citrate/2-methylcitrate synthase	NA	NA	NA	NA	NA
WP_174193338.1|1402521_1403412_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086035394.1|1403733_1405482_-	alpha-glycosidase	NA	NA	NA	NA	NA
WP_174193340.1|1405539_1406832_-	maltose ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_086035392.1|1406859_1407684_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_086035391.1|1407687_1409019_-	sugar ABC transporter permease	NA	NA	NA	NA	NA
WP_086035390.1|1409125_1410037_+	LacI family DNA-binding transcriptional regulator	NA	NA	NA	NA	NA
WP_086035389.1|1410108_1410798_-	starch-binding protein	NA	NA	NA	NA	NA
WP_086035388.1|1410862_1411723_-	class B sortase	NA	NA	NA	NA	NA
WP_157658904.1|1411943_1412450_-	DUF2213 domain-containing protein	NA	NA	NA	NA	NA
WP_086035387.1|1412656_1412857_-	hypothetical protein	NA	Q708N1	Streptococcus_phage	43.1	4.8e-05
WP_157658903.1|1412858_1413632_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157658902.1|1413921_1414215_+	hypothetical protein	NA	NA	NA	NA	NA
1414212:1414234	attL	TTGACTTGCATCTGACTTGCATC	NA	NA	NA	NA
WP_157658901.1|1414322_1414823_-|integrase	tyrosine-type recombinase/integrase	integrase	Q6SEG4	Lactobacillus_prophage	30.4	3.2e-05
WP_086035384.1|1414821_1415637_+|terminase	PBSX family phage terminase large subunit	terminase	A0A059T7K2	Staphylococcus_phage	50.8	5.4e-71
WP_086035383.1|1415641_1416166_+|portal	phage portal protein	portal	NA	NA	NA	NA
WP_086035382.1|1416169_1417111_+|portal	phage portal protein	portal	A0A0A8WIB1	Clostridium_phage	43.6	2.2e-63
WP_086035381.1|1417110_1418622_+	hypothetical protein	NA	A0A0A7RU06	Clostridium_phage	42.1	3.3e-61
WP_157658900.1|1418597_1418756_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086035380.1|1418926_1419505_+	phage scaffolding protein	NA	NA	NA	NA	NA
WP_086035379.1|1420659_1421004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174193341.1|1421005_1421371_+	hypothetical protein	NA	A0A0A8WIC0	Clostridium_phage	43.6	1.8e-10
WP_174193343.1|1421550_1423905_-	DUF262 domain-containing protein	NA	NA	NA	NA	NA
WP_174193345.1|1423904_1426997_-	type I restriction endonuclease subunit R	NA	NA	NA	NA	NA
WP_174193347.1|1426999_1428379_-	restriction endonuclease subunit S	NA	NA	NA	NA	NA
WP_174193349.1|1428378_1430385_-	SAM-dependent DNA methyltransferase	NA	A0A220A2U5	Liberibacter_phage	29.5	5.7e-21
WP_174193350.1|1430418_1430661_-	helix-turn-helix transcriptional regulator	NA	A0A2K5B263	Erysipelothrix_phage	62.7	2.5e-16
WP_174193351.1|1430641_1432324_-	DUF2326 domain-containing protein	NA	NA	NA	NA	NA
WP_174193352.1|1432313_1432538_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174193353.1|1432524_1433730_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174193354.1|1434245_1434950_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174193355.1|1435037_1435457_+	hypothetical protein	NA	A0A2K5B270	Erysipelothrix_phage	55.6	2.4e-38
WP_174193356.1|1435438_1435768_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174193358.1|1435764_1437438_+	hypothetical protein	NA	A0A0A7RTG3	Clostridium_phage	47.4	1.6e-146
WP_174192710.1|1437535_1438597_-|transposase	IS3 family transposase	transposase	Q716C2	Shigella_phage	31.5	4.2e-23
WP_174192708.1|1438599_1439121_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174193359.1|1439451_1440003_+|terminase	terminase	terminase	A0A2K5B277	Erysipelothrix_phage	62.3	6.1e-58
WP_174193361.1|1440003_1441263_+	site-specific DNA-methyltransferase	NA	A0A1B0RXJ0	Streptococcus_phage	45.4	1.4e-110
WP_132379943.1|1441427_1442192_+	virulence protein	NA	A0A2K5B280	Erysipelothrix_phage	44.4	9.1e-52
WP_132379941.1|1442188_1442413_+	DUF4314 domain-containing protein	NA	A0A2K5B281	Erysipelothrix_phage	61.2	1.1e-18
WP_132379939.1|1442414_1442600_+	DUF5049 domain-containing protein	NA	NA	NA	NA	NA
WP_132379937.1|1442723_1443191_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132379935.1|1443282_1443654_+	hypothetical protein	NA	NA	NA	NA	NA
WP_132379933.1|1443668_1443896_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174193692.1|1443973_1445620_+|terminase	terminase large subunit	terminase	A0A2K5B285	Erysipelothrix_phage	83.2	4.1e-267
WP_174193363.1|1445699_1447040_+|portal	phage portal protein	portal	A0A2K5B287	Erysipelothrix_phage	76.5	7.6e-187
WP_174193365.1|1447036_1447780_+|protease	Clp protease ClpP	protease	Q6DMU1	Streptococcus_phage	60.0	5.1e-68
WP_086035045.1|1447798_1449004_+|capsid	phage major capsid protein	capsid	Q6DMU0	Streptococcus_phage	61.8	7.6e-146
WP_174193367.1|1449072_1449360_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1B0RXK2	Streptococcus_phage	46.3	2.2e-11
WP_086035047.1|1449359_1449695_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_086035048.1|1449691_1450072_+	HK97 gp10 family phage protein	NA	Q9AZY1	Lactococcus_phage	34.4	3.1e-13
WP_086035049.1|1450077_1450404_+	hypothetical protein	NA	D2XR22	Bacillus_phage	46.8	3.2e-22
WP_086035050.1|1450409_1451042_+|tail	phage tail protein	tail	A0A0U4JWV5	Exiguobacterium_phage	51.6	5.6e-47
WP_086035051.1|1451045_1451423_+	hypothetical protein	NA	NA	NA	NA	NA
WP_168099034.1|1451419_1451584_+	hypothetical protein	NA	NA	NA	NA	NA
WP_157658908.1|1451586_1451760_-	hypothetical protein	NA	NA	NA	NA	NA
WP_086035471.1|1451869_1454725_+|tail	phage tail tape measure protein	tail	A6M961	Geobacillus_virus	29.4	7.4e-14
WP_174192566.1|1456633_1458010_+|tail	phage tail protein	tail	A0A2K5B298	Erysipelothrix_phage	65.9	3.5e-171
WP_174193369.1|1458022_1458217_+	hypothetical protein	NA	A0A2K5B299	Erysipelothrix_phage	56.9	1.1e-14
WP_174193371.1|1458219_1458801_+	hypothetical protein	NA	A0A2K5B2A0	Erysipelothrix_phage	49.2	2.8e-45
WP_174193373.1|1458892_1459594_+	MerR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174193375.1|1459590_1460367_-	tryptophan synthase subunit alpha	NA	NA	NA	NA	NA
WP_174193377.1|1460363_1461548_-	tryptophan synthase subunit beta	NA	NA	NA	NA	NA
WP_174193379.1|1461540_1462134_-	phosphoribosylanthranilate isomerase	NA	NA	NA	NA	NA
WP_174193381.1|1462120_1462924_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	39.0	1.1e-39
WP_174193383.1|1462920_1463937_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	40.4	6.4e-61
WP_174193385.1|1463993_1464575_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	46.6	5.8e-43
WP_174193387.1|1464558_1466049_-	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_174193389.1|1466463_1467117_-	CpXC protein	NA	NA	NA	NA	NA
WP_174193391.1|1467349_1467871_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174193393.1|1467867_1468374_+|tRNA	tRNA-specific 2-thiouridylase	tRNA	NA	NA	NA	NA
WP_086035474.1|1468330_1468525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174193694.1|1468588_1471063_+	glycosyl hydrolase	NA	A0A2K5B2A1	Erysipelothrix_phage	67.8	0.0e+00
WP_013485727.1|1471149_1471563_+|holin	phage holin family protein	holin	A0A2K5B2A2	Erysipelothrix_phage	71.3	1.3e-49
WP_086035476.1|1471562_1472507_+	LysM peptidoglycan-binding domain-containing protein	NA	A0A2K5B2A3	Erysipelothrix_phage	43.4	1.7e-52
WP_086035477.1|1472629_1473052_+	RNA polymerase subunit sigma-70	NA	NA	NA	NA	NA
WP_174193395.1|1473044_1473209_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086035478.1|1473266_1475060_+	recombinase family protein	NA	A0A2K5B2B4	Erysipelothrix_phage	43.7	9.5e-76
WP_086035479.1|1475038_1476622_+	recombinase family protein	NA	Q6DMS5	Streptococcus_phage	52.1	2.8e-148
WP_174193396.1|1476697_1477120_-	SseB family protein	NA	NA	NA	NA	NA
WP_157658899.1|1477299_1477653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086035376.1|1477666_1478233_+	hypothetical protein	NA	A0A0A8WJ49	Clostridium_phage	31.2	1.6e-13
WP_086035375.1|1478361_1478694_+	hypothetical protein	NA	NA	NA	NA	NA
WP_086035374.1|1478882_1481672_+|tail	phage tail tape measure protein	tail	D9ZNE6	Clostridium_phage	54.9	1.4e-89
1484047:1484069	attR	TTGACTTGCATCTGACTTGCATC	NA	NA	NA	NA
