The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054569	Achromobacter denitrificans strain FDAARGOS_787 chromosome, complete genome	6816538	1867	56385	6816538	capsid,tail,tRNA,portal,head,protease	Pseudomonas_phage(23.53%)	58	NA	NA
WP_174715470.1|1867_2239_+|portal	phage portal protein	portal	A0A142K630	Streptomyces_phage	36.8	9.6e-07
WP_174715471.1|2238_3093_+|portal	phage portal protein	portal	Q8HAD4	Salmonella_phage	50.2	2.4e-69
WP_174715472.1|3094_3730_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	48.8	7.3e-47
WP_174715473.1|3795_4986_+|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	53.8	1.2e-119
WP_174715474.1|5036_5618_+|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
WP_174717453.1|5655_5988_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_174715475.1|5991_6486_+	HK97 gp10 family phage protein	NA	NA	NA	NA	NA
WP_174715476.1|6478_6832_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_174715477.1|6828_7269_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174715478.1|7372_8026_+|tail	phage tail protein	tail	A0A0H5BBY3	Pseudomonas_phage	52.6	5.5e-58
WP_174715479.1|8097_8418_+	hypothetical protein	NA	A0A0S2SYT8	Pseudomonas_phage	46.2	2.8e-23
WP_174717454.1|8414_8726_+	DUF1799 domain-containing protein	NA	A0A2H4JBP7	uncultured_Caudovirales_phage	40.7	1.7e-12
WP_174715480.1|8762_14369_+|tail	phage tail length tape measure family protein	tail	A0A1V0E8B0	Vibrio_phage	40.7	1.2e-68
WP_174715481.1|14365_15256_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174715482.1|15257_16097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174715483.1|16309_16537_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174717455.1|16620_17064_+	hypothetical protein	NA	Q6TM82	Pseudomonas_phage	38.0	3.7e-13
WP_174715484.1|17066_17564_+	hypothetical protein	NA	A0A2H4JFP9	uncultured_Caudovirales_phage	64.3	4.7e-49
WP_174715485.1|17547_17814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174715486.1|18035_18266_+	DNA-3-methyladenine glycosylase	NA	NA	NA	NA	NA
WP_174715487.1|18346_18784_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080551133.1|19365_19668_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174715488.1|19651_19936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174715489.1|20019_20175_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174715490.1|20298_20886_-	GNAT family N-acetyltransferase	NA	A0A0B5CYP1	Listeria_phage	28.4	2.8e-08
WP_088446812.1|21551_22943_-	uracil-xanthine permease	NA	H9YQ34	environmental_Halophage	50.8	6.3e-27
WP_174715491.1|23163_25062_+	molecular chaperone HtpG	NA	A0A1B1ISV4	uncultured_Mediterranean_phage	37.4	6.9e-117
WP_174715492.1|25245_26130_+	DUF2520 domain-containing protein	NA	NA	NA	NA	NA
WP_123786635.1|26332_27373_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_125283285.1|27429_28407_+	SMP-30/gluconolactonase/LRE family protein	NA	NA	NA	NA	NA
WP_174715493.1|28424_30539_-	acetate--CoA ligase family protein	NA	NA	NA	NA	NA
WP_062680063.1|30556_31552_-	acryloyl-CoA reductase	NA	NA	NA	NA	NA
WP_088146631.1|31570_32740_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_174715494.1|32743_33712_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_088146633.1|33729_34713_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_174715495.1|34772_35939_-	acyl-CoA dehydrogenase family protein	NA	NA	NA	NA	NA
WP_174715496.1|36131_36929_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_088146635.1|36918_37692_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174715497.1|37849_39049_+	MFS transporter	NA	NA	NA	NA	NA
WP_062680055.1|39154_40465_-	MFS transporter	NA	NA	NA	NA	NA
WP_062680054.1|40497_41646_-	galactonate dehydratase	NA	Q6A202	Oenococcus_phage	37.0	3.3e-58
WP_062680053.1|41642_42296_-	2-dehydro-3-deoxy-6-phosphogalactonate aldolase	NA	NA	NA	NA	NA
WP_174715498.1|42305_43313_-	2-dehydro-3-deoxygalactonokinase	NA	NA	NA	NA	NA
WP_174715499.1|43620_44439_+	IclR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174715500.1|44470_45421_-	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174715501.1|45514_46990_+	aldehyde dehydrogenase	NA	NA	NA	NA	NA
WP_174715502.1|46995_48018_+	NAD-dependent epimerase/dehydratase family protein	NA	A0A2H4UUK0	Bodo_saltans_virus	26.9	1.1e-25
WP_174715503.1|48153_49113_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_174715504.1|49122_49743_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_174715505.1|49760_50339_-	1,6-anhydro-N-acetylmuramyl-L-alanine amidase AmpD	NA	A0A1W6DX33	Sphingobium_phage	29.8	2.0e-06
WP_174715506.1|50437_50701_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062680048.1|50702_51545_-	cytochrome c biogenesis protein CcsA	NA	NA	NA	NA	NA
WP_088146642.1|51651_53058_+	signal recognition particle protein	NA	NA	NA	NA	NA
WP_062680046.1|53296_53743_-	peptidoglycan-binding protein LysM	NA	G3MBQ1	Bacillus_virus	47.9	8.8e-07
WP_088146643.1|53786_54104_-	hypothetical protein	NA	NA	NA	NA	NA
WP_056559414.1|54399_54600_-	sulfur carrier protein ThiS	NA	NA	NA	NA	NA
WP_062680044.1|54613_55552_-	prolyl aminopeptidase	NA	NA	NA	NA	NA
WP_174715507.1|55551_56385_-|tRNA	tRNA (guanosine(46)-N7)-methyltransferase TrmB	tRNA	NA	NA	NA	NA
>prophage 2
NZ_CP054569	Achromobacter denitrificans strain FDAARGOS_787 chromosome, complete genome	6816538	584138	659269	6816538	plate,integrase,tail,transposase,head,protease	Pseudomonas_phage(34.21%)	83	603985:604002	638366:638383
WP_174715674.1|584138_584921_-	hypothetical protein	NA	J9SNQ5	Pseudomonas_phage	57.4	3.5e-06
WP_174715675.1|585532_586144_-	regulatory protein GemA	NA	A4JWM5	Burkholderia_virus	48.9	6.8e-26
WP_174715676.1|586145_586844_-	DUF2786 domain-containing protein	NA	L7P7W8	Pseudomonas_phage	35.9	3.5e-26
WP_174715677.1|586885_587278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174715678.1|587454_587721_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174715679.1|587722_588535_-	DUF3164 family protein	NA	A0A0A1IVF8	Pseudomonas_phage	54.0	7.9e-54
WP_174715680.1|588543_588906_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174715681.1|588907_589189_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174715682.1|589178_589481_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174715683.1|589471_590662_-	AAA family ATPase	NA	Q6QIE1	Burkholderia_phage	47.4	7.2e-88
WP_174715684.1|590671_592477_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	Q6QIE0	Burkholderia_phage	49.0	7.6e-158
WP_174715685.1|592487_593369_-	DUF3102 domain-containing protein	NA	Q5ZR03	Pseudomonas_phage	37.5	2.3e-38
WP_174715686.1|593374_593605_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174715687.1|593601_593907_-	helix-turn-helix domain-containing protein	NA	Q5ZR02	Pseudomonas_phage	58.0	1.2e-23
WP_174715688.1|593903_594107_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174715689.1|594103_594355_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_174715690.1|594461_594917_+	helix-turn-helix transcriptional regulator	NA	A0A2H4JFL3	uncultured_Caudovirales_phage	37.5	2.7e-11
WP_174715691.1|594913_595597_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174715692.1|595714_596098_+	hypothetical protein	NA	Q6QIC8	Burkholderia_phage	58.3	3.2e-29
WP_174715693.1|596097_596727_+	transglycosylase SLT domain-containing protein	NA	Q6QIC7	Burkholderia_phage	62.8	1.7e-64
WP_174715694.1|596723_597158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174715695.1|597269_597662_+	hypothetical protein	NA	Q5ZQY8	Pseudomonas_phage	60.3	5.5e-37
WP_174715696.1|597651_597960_+	hypothetical protein	NA	Q5ZQY7	Pseudomonas_phage	85.3	1.2e-47
WP_174715697.1|597963_598542_+	DUF3486 family protein	NA	Q5ZQY6	Pseudomonas_phage	64.4	1.2e-53
WP_174715698.1|598538_598814_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174715699.1|600636_602238_+	DUF935 domain-containing protein	NA	L7P7P3	Pseudomonas_phage	47.2	4.4e-125
WP_174715700.1|602239_603514_+	hypothetical protein	NA	A0A2P1A4D1	Alteromonadaceae_phage	37.4	3.6e-53
WP_174715701.1|603706_604801_+|protease	phage protease	protease	A0A0M5N0Q6	Ralstonia_phage	42.5	2.7e-49
603985:604002	attL	CGCGCCAGCCGCTGGCTG	NA	NA	NA	NA
WP_174715702.1|604842_605253_+	hypothetical protein	NA	J9RWG0	Pseudomonas_phage	61.4	5.8e-37
WP_174715703.1|605291_606182_+|head	Mu-like prophage major head subunit gpT family protein	head	A0A0M4UKB9	Ralstonia_phage	55.1	1.3e-89
WP_174715704.1|606238_606496_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174715705.1|606640_607147_+	DUF1320 family protein	NA	B7SDP4	Haemophilus_phage	42.2	6.1e-12
WP_174715706.1|607146_607737_+	phage virion morphogenesis protein	NA	NA	NA	NA	NA
WP_174715707.1|607726_608350_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174715708.1|608365_608578_+	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
WP_174715709.1|608594_610067_+|tail	phage tail sheath subtilisin-like domain-containing protein	tail	A0A2I7S9H0	Vibrio_phage	41.9	1.3e-94
WP_174715710.1|610079_610433_+|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_174715711.1|610466_610766_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_174715712.1|610905_613071_+|tail	phage tail tape measure protein	tail	B5TAA4	Burkholderia_phage	32.0	1.5e-43
WP_174715713.1|613123_614332_+	DNA circularization N-terminal domain-containing protein	NA	A0A2P9JZK2	Alteromonadaceae_phage	31.8	1.0e-36
WP_174715714.1|614331_615453_+	hypothetical protein	NA	A0A2P9JZK3	Alteromonadaceae_phage	33.5	3.9e-43
WP_174715715.1|615449_615995_+|plate	phage baseplate assembly protein	plate	Q8SBG6	Shigella_phage	47.7	2.9e-20
WP_174715716.1|616053_616536_+	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	44.8	1.7e-19
WP_174715717.1|616537_617593_+|plate	baseplate J/gp47 family protein	plate	A0A0C4UQU9	Shigella_phage	34.3	1.9e-44
WP_174715718.1|617580_618183_+	DUF2313 domain-containing protein	NA	A0A192Y5V3	Salmonella_phage	36.7	4.1e-23
WP_174717471.1|618233_619097_+|tail	phage tail protein	tail	A0A0A8J8U5	Ralstonia_phage	37.9	2.4e-32
WP_174715719.1|619842_620145_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174715720.1|620137_620371_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174715721.1|620427_620799_+|tail	phage tail protein	tail	A0A0U4JEJ6	Pseudomonas_phage	35.1	5.6e-07
WP_174717472.1|620934_621726_+	DNA adenine methylase	NA	Q5ZQW7	Pseudomonas_phage	76.6	2.7e-123
WP_174715722.1|621685_622708_-|integrase	tyrosine-type recombinase/integrase	integrase	W6MYA3	Pseudomonas_phage	37.4	1.1e-33
WP_174715465.1|622795_622933_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062684480.1|623087_623597_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_088145732.1|623575_624589_+	FecR family protein	NA	NA	NA	NA	NA
WP_174715723.1|624709_627328_+	TonB-dependent hemoglobin/transferrin/lactoferrin family receptor	NA	NA	NA	NA	NA
WP_062684477.1|627391_628438_+	hemin-degrading factor	NA	NA	NA	NA	NA
WP_088145734.1|628448_629282_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_125284689.1|629325_630273_+	iron ABC transporter permease	NA	NA	NA	NA	NA
WP_062684474.1|630269_631058_+	heme ABC transporter ATP-binding protein	NA	F2Y2R6	Organic_Lake_phycodnavirus	25.4	5.0e-05
WP_062684473.1|631127_631610_+	YajQ family cyclic di-GMP-binding protein	NA	NA	NA	NA	NA
WP_075873460.1|631720_632626_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062684472.1|632639_634085_-	DNA-3-methyladenine glycosylase 2 family protein	NA	NA	NA	NA	NA
WP_082775894.1|634227_634776_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_062684471.1|634859_635945_+	tartrate dehydrogenase	NA	NA	NA	NA	NA
WP_062684470.1|636034_637015_+	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_062684469.1|637018_637624_-	phosphatase PAP2 family protein	NA	NA	NA	NA	NA
WP_088148831.1|637715_638144_-	arsenate reductase (glutaredoxin)	NA	A0A2H4J8T1	uncultured_Caudovirales_phage	64.3	1.5e-48
WP_174715724.1|639764_641966_-	TonB-dependent receptor	NA	NA	NA	NA	NA
638366:638383	attR	CAGCCAGCGGCTGGCGCG	NA	NA	NA	NA
WP_174715725.1|642127_642541_-	DUF2946 family protein	NA	NA	NA	NA	NA
WP_062684464.1|642577_643276_-	urea ABC transporter ATP-binding subunit UrtE	NA	F2Y2R6	Organic_Lake_phycodnavirus	29.5	2.8e-15
WP_062684463.1|643277_644117_-	urea ABC transporter ATP-binding protein UrtD	NA	A0A2R8FG22	Brazilian_cedratvirus	25.0	8.0e-09
WP_062684462.1|644113_645241_-	urea ABC transporter permease subunit UrtC	NA	NA	NA	NA	NA
WP_174715726.1|645237_646869_-	urea ABC transporter permease subunit UrtB	NA	NA	NA	NA	NA
WP_062684460.1|646881_648135_-	urea ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_174715727.1|648495_650328_+	allophanate hydrolase	NA	NA	NA	NA	NA
WP_174715728.1|650356_653995_+	urea carboxylase	NA	NA	NA	NA	NA
WP_062685560.1|653991_654723_+	GntR family transcriptional regulator	NA	NA	NA	NA	NA
WP_123786863.1|654733_655549_-	anti-sigma factor	NA	NA	NA	NA	NA
WP_062685562.1|655550_656063_-	RNA polymerase sigma factor	NA	A0A076YQ50	Rhizobium_phage	25.6	2.5e-05
WP_125284279.1|656094_656463_-	hypothetical protein	NA	NA	NA	NA	NA
WP_125284278.1|656553_657006_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_062685565.1|657092_657569_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_123786589.1|658288_659269_-|transposase	IS110 family transposase	transposase	A0A1S7J231	Thermus_phage	30.7	2.7e-24
>prophage 3
NZ_CP054569	Achromobacter denitrificans strain FDAARGOS_787 chromosome, complete genome	6816538	1854078	1897241	6816538	terminase,plate,integrase,capsid,tail	Burkholderia_phage(34.38%)	64	1853919:1853938	1896395:1896414
1853919:1853938	attL	GAGTCCCCTCCTTCGCACCA	NA	NA	NA	NA
WP_174716072.1|1854078_1855062_+|integrase	site-specific integrase	integrase	A0A1B1P9F9	Acinetobacter_phage	38.9	5.2e-60
WP_174716073.1|1855035_1855278_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716074.1|1855278_1855452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716075.1|1855448_1855805_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716076.1|1856629_1856884_-	hypothetical protein	NA	C9DGD3	Deftia_phage	46.5	2.1e-13
WP_174716077.1|1856883_1857441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716078.1|1857553_1858057_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716079.1|1858138_1858663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716080.1|1858700_1859741_-	hypothetical protein	NA	A0A2H4JAZ0	uncultured_Caudovirales_phage	48.0	4.2e-68
WP_174716081.1|1859755_1860655_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	V5YTC9	Pseudomonas_phage	35.5	1.3e-41
WP_174716082.1|1860651_1861014_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716083.1|1861015_1861201_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716084.1|1861202_1861529_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716085.1|1861682_1862051_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716086.1|1862053_1862452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716087.1|1862491_1863406_-	pentapeptide repeat-containing protein	NA	A0A2P9HXG2	Yersinia_phage	59.2	6.7e-09
WP_174716088.1|1863913_1864507_-	Rha family transcriptional regulator	NA	A0A1B0VMK9	Pseudomonas_phage	44.8	3.4e-14
WP_174716089.1|1864503_1864677_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716090.1|1864781_1865561_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_174716091.1|1865641_1866070_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_174716092.1|1866143_1866371_+	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_174715466.1|1866424_1866598_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716093.1|1866711_1866975_+	DNA-binding protein	NA	NA	NA	NA	NA
WP_174716094.1|1866977_1867385_+	recombination protein NinB	NA	A0A0H5AUD0	Pseudomonas_phage	59.6	1.8e-27
WP_174716095.1|1867384_1868023_+	hypothetical protein	NA	A0A2I7R856	Vibrio_phage	35.1	1.5e-28
WP_174716096.1|1868845_1869616_+	hypothetical protein	NA	Q5QF86	Pseudomonas_virus	37.7	1.3e-21
WP_174716097.1|1869612_1870089_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716098.1|1871094_1871475_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174717502.1|1871474_1871681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716099.1|1871677_1872127_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716100.1|1872657_1873239_+|terminase	terminase small subunit	terminase	U5PZD3	Bacillus_phage	40.1	2.9e-26
WP_174717503.1|1873303_1874641_+|terminase	phage terminase large subunit	terminase	J7I460	Acinetobacter_phage	59.1	6.9e-148
WP_174716101.1|1874637_1876173_+	DUF1073 domain-containing protein	NA	A0A0F6WD88	Pseudomonas_phage	47.4	1.7e-102
WP_174717504.1|1876084_1876945_+|capsid	minor capsid protein	capsid	Q6IWU3	Burkholderia_phage	38.2	1.1e-45
WP_174716102.1|1876925_1878182_+	DUF2213 domain-containing protein	NA	Q6IWU4	Burkholderia_phage	40.1	8.5e-39
WP_174716103.1|1878178_1878658_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716104.1|1878678_1879761_+	DUF2184 domain-containing protein	NA	Q6IWU6	Burkholderia_phage	34.4	1.2e-54
WP_174716105.1|1879820_1880171_+	hypothetical protein	NA	Q6IWU7	Burkholderia_phage	35.2	1.6e-08
WP_174716106.1|1880172_1880601_+	DUF4054 domain-containing protein	NA	A0A088C3T8	Shewanella_sp._phage	36.2	4.0e-17
WP_174716107.1|1880597_1881074_+	hypothetical protein	NA	Q6IWU9	Burkholderia_phage	41.4	7.4e-20
WP_174716108.1|1881070_1881439_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716109.1|1881435_1881963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716110.1|1881973_1883482_+	DUF3383 domain-containing protein	NA	I7B2P4	Escherichia_phage	37.0	2.8e-73
WP_174716111.1|1883612_1884122_+	Rha family transcriptional regulator	NA	A0A249XSL1	Mycobacterium_phage	37.2	1.4e-11
WP_174716112.1|1884158_1884608_+	hypothetical protein	NA	A0A2H4P6T4	Pseudomonas_phage	45.6	1.3e-29
WP_174716113.1|1884617_1885061_+	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	43.6	7.4e-22
WP_174716114.1|1885218_1885866_+	hypothetical protein	NA	A0A221SAP1	Ralstonia_phage	39.7	3.1e-21
WP_174716115.1|1885929_1887543_+|tail	phage tail protein	tail	NA	NA	NA	NA
WP_174716116.1|1887542_1888085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716117.1|1888081_1888390_+	hypothetical protein	NA	Q6IWP9	Burkholderia_phage	34.3	3.2e-08
WP_174716118.1|1888382_1889207_+	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.7	5.9e-41
WP_174716119.1|1889191_1889827_+	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	43.5	3.8e-27
WP_174716120.1|1889823_1890168_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716121.1|1890160_1891351_+|plate	baseplate J/gp47 family protein	plate	Q6IWQ3	Burkholderia_phage	39.3	9.4e-64
WP_174716122.1|1891347_1891998_+	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	44.2	3.8e-43
WP_174716123.1|1891998_1892772_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716124.1|1892798_1893194_+	hypothetical protein	NA	G8DDH4	Micromonas_pusilla_virus	42.4	2.3e-06
WP_174716125.1|1893287_1894448_+	hypothetical protein	NA	A0A2I7RBK1	Vibrio_phage	33.2	8.1e-44
WP_174716126.1|1894508_1894817_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716127.1|1894818_1895097_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716128.1|1895093_1895570_+	hypothetical protein	NA	I6NSS1	Burkholderia_phage	63.1	1.3e-48
WP_174716129.1|1895566_1895923_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716130.1|1896064_1896283_-	hypothetical protein	NA	NA	NA	NA	NA
WP_157672750.1|1896605_1897241_-	hypothetical protein	NA	A0A2I6UFG0	Klebsiella_phage	32.6	6.2e-06
1896395:1896414	attR	GAGTCCCCTCCTTCGCACCA	NA	NA	NA	NA
>prophage 4
NZ_CP054569	Achromobacter denitrificans strain FDAARGOS_787 chromosome, complete genome	6816538	1924925	1931533	6816538	transposase,protease	Lake_Baikal_phage(16.67%)	8	NA	NA
WP_006220190.1|1924925_1925129_+	cold-shock protein	NA	A0A2H4N7Y6	Lake_Baikal_phage	63.6	7.3e-17
WP_062682780.1|1925305_1925869_+	DUF924 family protein	NA	A0A1V0SIY0	Klosneuvirus	38.2	8.5e-15
WP_042794090.1|1926186_1926393_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	59.7	8.1e-16
WP_123785818.1|1926558_1927779_+|transposase	ISL3 family transposase	transposase	A4PE56	Ralstonia_virus	82.6	2.3e-198
WP_062682781.1|1927838_1928384_-	TIGR00645 family protein	NA	K4K6D8	Caulobacter_phage	32.7	1.7e-20
WP_062682782.1|1928641_1929397_+|protease	M48 family metalloprotease	protease	NA	NA	NA	NA
WP_062682783.1|1929564_1930875_+	trigger factor	NA	NA	NA	NA	NA
WP_062682784.1|1930879_1931533_+	ATP-dependent Clp endopeptidase proteolytic subunit ClpP	NA	A0A223W000	Agrobacterium_phage	57.2	2.6e-55
>prophage 5
NZ_CP054569	Achromobacter denitrificans strain FDAARGOS_787 chromosome, complete genome	6816538	2485246	2493648	6816538	tRNA	Moraxella_phage(28.57%)	9	NA	NA
WP_062682610.1|2485246_2485831_+	YigZ family protein	NA	A0A1X9I5T8	Streptococcus_phage	37.0	3.3e-22
WP_062682555.1|2486007_2486382_-	thioredoxin family protein	NA	V9SJ74	Achromobacter_phage	28.9	5.5e-10
WP_062682556.1|2486524_2487529_-	LLM class flavin-dependent oxidoreductase	NA	NA	NA	NA	NA
WP_062682557.1|2487756_2489049_-	NCS2 family permease	NA	A0A0R6PHV4	Moraxella_phage	35.6	9.3e-65
WP_062682558.1|2489171_2490203_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	51.4	2.1e-91
WP_062682559.1|2490393_2491032_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_062682560.1|2491211_2491970_+	5'/3'-nucleotidase SurE	NA	A0A1B1ITZ2	uncultured_Mediterranean_phage	50.8	4.9e-66
WP_062682561.1|2491954_2492779_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	45.8	4.3e-31
WP_062682562.1|2492796_2493648_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A292GJG6	Xanthomonas_phage	40.2	4.9e-14
>prophage 6
NZ_CP054569	Achromobacter denitrificans strain FDAARGOS_787 chromosome, complete genome	6816538	3800932	3898776	6816538	plate,terminase,integrase,capsid,holin,tail,tRNA,portal,head,protease	Vibrio_phage(13.79%)	106	3813468:3813485	3875760:3875776
WP_088146759.1|3800932_3801943_-|tRNA	tRNA dihydrouridine(20/20a) synthase DusA	tRNA	NA	NA	NA	NA
WP_088146758.1|3802120_3803089_+	homoserine kinase	NA	NA	NA	NA	NA
WP_174717560.1|3803594_3804128_-	DUF192 domain-containing protein	NA	NA	NA	NA	NA
WP_174716683.1|3804193_3805066_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_062682032.1|3805077_3805923_-	type II secretion system F family protein	NA	NA	NA	NA	NA
WP_174716684.1|3805919_3807608_-	Flp pilus assembly complex ATPase component TadA	NA	NA	NA	NA	NA
WP_174716685.1|3807612_3808998_-	pilus assembly protein N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_174716686.1|3808994_3809852_-	Flp pilus assembly protein CpaB	NA	NA	NA	NA	NA
WP_174717561.1|3809848_3810367_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716687.1|3810612_3811227_-	pilus assembly protein	NA	NA	NA	NA	NA
WP_174716688.1|3811223_3812642_-	hypothetical protein	NA	NA	NA	NA	NA
WP_062682027.1|3812638_3812905_-	hypothetical protein	NA	NA	NA	NA	NA
WP_075873302.1|3813298_3814696_-	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
3813468:3813485	attL	ATGGTGACACCCAGGCCG	NA	NA	NA	NA
WP_174716689.1|3814752_3815604_-	MaoC family dehydratase N-terminal domain-containing protein	NA	NA	NA	NA	NA
3813468:3813485	attL	ATGGTGACACCCAGGCCG	NA	NA	NA	NA
WP_174716690.1|3815656_3816586_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_088146752.1|3816619_3817648_-	tripartite tricarboxylate transporter substrate binding protein	NA	NA	NA	NA	NA
WP_062682023.1|3817688_3817901_-	acetyl-CoA carboxylase biotin carboxyl carrier protein subunit	NA	NA	NA	NA	NA
WP_174716691.1|3817897_3819265_-	ATP-grasp domain-containing protein	NA	NA	NA	NA	NA
WP_174716692.1|3819275_3820820_-	methylmalonyl-CoA carboxyltransferase	NA	NA	NA	NA	NA
WP_062682020.1|3820853_3821522_-	3-oxoacid CoA-transferase subunit B	NA	NA	NA	NA	NA
WP_062682019.1|3821511_3822198_-	3-oxoacid CoA-transferase subunit A	NA	NA	NA	NA	NA
WP_088445878.1|3822230_3823403_-	thiolase	NA	NA	NA	NA	NA
WP_174716693.1|3823399_3823795_-	OB-fold domain-containing protein	NA	NA	NA	NA	NA
WP_123785800.1|3824023_3824956_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_062682015.1|3825031_3825625_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123788033.1|3825767_3826070_-	monooxygenase	NA	NA	NA	NA	NA
WP_174716694.1|3826266_3826881_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123785802.1|3827220_3827922_+	hypothetical protein	NA	A0A1B1IY38	Phage_MedPE-SWcel-C56	37.9	2.1e-18
WP_174717562.1|3828573_3828813_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716695.1|3829078_3829654_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716696.1|3830181_3831195_-	hypothetical protein	NA	A0A0M4S6X1	Salmonella_phage	45.9	2.8e-77
WP_174716697.1|3831752_3832004_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716698.1|3832127_3832739_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716699.1|3833784_3834525_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716700.1|3834671_3835073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716701.1|3835069_3835603_-	hypothetical protein	NA	X5KCC3	Pseudomonas_phage	45.8	1.6e-31
WP_174716702.1|3835599_3835869_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_174716703.1|3835879_3836233_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716704.1|3836311_3837334_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JE37	uncultured_Caudovirales_phage	30.5	2.4e-23
WP_123786964.1|3837338_3837701_-|tail	phage tail protein	tail	A0A0U4JEJ6	Pseudomonas_phage	35.8	6.7e-05
WP_174716705.1|3837934_3838237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716706.1|3838497_3839388_-|tail	phage tail protein	tail	A0A0A8J8U5	Ralstonia_phage	34.6	3.1e-27
WP_054480987.1|3839394_3839985_-	DUF2313 domain-containing protein	NA	A0A2P9JZK7	Alteromonadaceae_phage	38.1	6.0e-27
WP_174716707.1|3839994_3841158_-|plate	baseplate J/gp47 family protein	plate	B5TAA9	Burkholderia_phage	26.2	4.6e-15
WP_123786961.1|3841159_3841612_-	phage GP46 family protein	NA	A0A0C4UR04	Shigella_phage	38.9	3.2e-20
WP_054480993.1|3841608_3842223_-|plate	phage baseplate assembly protein V	plate	A0A2P9JZK4	Alteromonadaceae_phage	35.7	3.8e-08
WP_123786959.1|3842224_3843343_-	Mu P family protein	NA	A0A2I7S9G1	Vibrio_phage	28.7	5.2e-32
WP_174716708.1|3843339_3844764_-	DNA circularization N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_174716709.1|3844760_3846806_-	transglycosylase SLT domain-containing protein	NA	A0A0M4REK7	Salmonella_phage	42.9	1.1e-19
WP_123786955.1|3846944_3847274_-|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_123786954.1|3847275_3847644_-|tail	phage tail tube protein	tail	NA	NA	NA	NA
WP_174716710.1|3847705_3849235_-|tail	phage tail sheath subtilisin-like domain-containing protein	tail	B5TK67	Pseudomonas_phage	46.8	5.9e-103
3848616:3848633	attR	ATGGTGACACCCAGGCCG	NA	NA	NA	NA
WP_174716711.1|3849235_3849445_-	DUF2635 domain-containing protein	NA	NA	NA	NA	NA
3848616:3848633	attR	ATGGTGACACCCAGGCCG	NA	NA	NA	NA
WP_054481010.1|3849454_3850006_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054481013.1|3850002_3850323_-	hypothetical protein	NA	NA	NA	NA	NA
WP_123786951.1|3850324_3850585_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054481018.1|3850581_3851643_-|capsid	major capsid protein	capsid	V5Q8G6	Xylella_phage	35.3	1.8e-53
WP_174716712.1|3851728_3852409_-|head	head decoration protein	head	NA	NA	NA	NA
WP_054481022.1|3852442_3853015_-	hypothetical protein	NA	NA	NA	NA	NA
WP_054481025.1|3853036_3853924_-	S49 family peptidase	NA	S4TQW3	Salmonella_phage	39.4	6.0e-47
WP_054481027.1|3853924_3855487_-|portal	phage portal protein	portal	A0A291AUL8	Sinorhizobium_phage	33.7	3.5e-82
WP_123786948.1|3855555_3855804_-|head,tail	phage head-tail adapter protein	head,tail	NA	NA	NA	NA
WP_082401378.1|3855815_3857984_-|terminase	phage terminase large subunit family protein	terminase	A0A067ZJA1	Vibrio_phage	34.9	1.1e-91
WP_174716713.1|3857925_3858531_-	hypothetical protein	NA	A0A2H4JCL4	uncultured_Caudovirales_phage	33.2	1.5e-12
WP_174716714.1|3858847_3859537_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716715.1|3859596_3860391_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716716.1|3860664_3861600_+	hypothetical protein	NA	A0A1B5FPB0	Escherichia_phage	32.5	9.2e-14
WP_174716717.1|3861727_3862315_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716718.1|3862311_3862692_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716719.1|3862702_3863101_-	hypothetical protein	NA	R9TNL4	Vibrio_phage	51.0	1.3e-22
WP_174716720.1|3863100_3864828_-	toprim domain-containing protein	NA	A0A1B1IP14	uncultured_Mediterranean_phage	34.4	1.2e-72
WP_174716721.1|3864824_3865895_-	hypothetical protein	NA	U6C6J3	Ralstonia_phage	73.6	7.5e-28
WP_174716722.1|3865901_3866222_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716723.1|3866599_3866803_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716724.1|3866886_3867120_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716725.1|3867100_3867403_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174716726.1|3867439_3867670_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_174717563.1|3867921_3868440_+	S24 family peptidase	NA	A0A0M3LSL8	Mannheimia_phage	44.2	6.0e-23
WP_174716727.1|3868436_3869375_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716728.1|3869641_3870013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716729.1|3870860_3871205_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716730.1|3871201_3871450_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716731.1|3871446_3871695_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716732.1|3871687_3871963_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716733.1|3871959_3872343_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174716734.1|3872545_3873631_+|integrase	site-specific integrase	integrase	Q9ZXG4	Shigella_phage	36.9	1.5e-60
WP_062682012.1|3873735_3876003_-	RNA polymerase sigma factor RpoD	NA	A0A2I7SAT0	Vibrio_phage	30.1	4.2e-36
WP_174716735.1|3876680_3878744_-	DNA primase	NA	A0A0K1LMQ9	Caulobacter_phage	42.6	2.7e-66
WP_006218592.1|3878763_3878976_-	30S ribosomal protein S21	NA	NA	NA	NA	NA
WP_062682010.1|3879283_3879826_-	phosphoribosyltransferase	NA	NA	NA	NA	NA
WP_062682009.1|3879909_3881205_-	adenylosuccinate synthase	NA	A0A0B5J049	Pandoravirus	31.6	4.5e-59
WP_088146742.1|3881281_3882439_-	ATP phosphoribosyltransferase regulatory subunit	NA	NA	NA	NA	NA
WP_062682007.1|3882703_3883606_-|protease	protease modulator HflC	protease	NA	NA	NA	NA
WP_062682006.1|3883624_3884923_-|protease	FtsH protease activity modulator HflK	protease	NA	NA	NA	NA
WP_043541532.1|3884888_3885995_-	GTPase HflX	NA	NA	NA	NA	NA
WP_006218585.1|3886079_3886316_-	RNA chaperone Hfq	NA	NA	NA	NA	NA
WP_062682005.1|3886472_3887546_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_174716736.1|3887549_3888908_-	ribosome biogenesis GTPase Der	NA	NA	NA	NA	NA
WP_088445882.1|3888930_3890088_-	outer membrane protein assembly factor BamB	NA	NA	NA	NA	NA
WP_062682002.1|3890093_3890732_-	tetratricopeptide repeat protein	NA	NA	NA	NA	NA
WP_087881390.1|3890735_3892022_-|tRNA	histidine--tRNA ligase	tRNA	NA	NA	NA	NA
WP_062682000.1|3892072_3893359_-	flavodoxin-dependent (E)-4-hydroxy-3-methylbut-2-enyl-diphosphate synthase	NA	NA	NA	NA	NA
WP_062681999.1|3893372_3893867_-	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_062681998.1|3893863_3895018_-	23S rRNA (adenine(2503)-C(2))-methyltransferase RlmN	NA	NA	NA	NA	NA
WP_062681997.1|3895062_3895488_-	nucleoside-diphosphate kinase	NA	A0A167REB2	Powai_lake_megavirus	42.9	1.1e-22
WP_062681996.1|3895881_3898776_+|tRNA	valine--tRNA ligase	tRNA	A0A1V0SK04	Klosneuvirus	37.4	2.1e-141
>prophage 7
NZ_CP054569	Achromobacter denitrificans strain FDAARGOS_787 chromosome, complete genome	6816538	6762283	6786540	6816538	terminase,integrase,capsid,portal,head,protease	Burkholderia_virus(37.5%)	39	6759672:6759686	6778805:6778819
6759672:6759686	attL	TGAGATTTATTGTCC	NA	NA	NA	NA
WP_174717601.1|6762283_6763030_-|integrase	integrase	integrase	NA	NA	NA	NA
WP_152553768.1|6763314_6763524_-	DUF4224 domain-containing protein	NA	NA	NA	NA	NA
WP_174717412.1|6763963_6765046_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174717413.1|6765042_6765423_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174717414.1|6765419_6765803_-	hypothetical protein	NA	A0A240F4V4	Ochrobactrum_phage	48.3	1.5e-26
WP_174717415.1|6765799_6766042_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174717602.1|6766038_6766392_-	hypothetical protein	NA	K7PKY8	Enterobacterial_phage	41.5	2.4e-15
WP_174717416.1|6766457_6766664_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174717417.1|6766660_6767455_-	hypothetical protein	NA	A4JX52	Burkholderia_virus	48.9	5.0e-61
WP_174717418.1|6767471_6768368_-	recombination-associated protein RdgC	NA	B5AX95	Iodobacteriophage	34.0	1.3e-38
WP_174717419.1|6768382_6768748_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174717420.1|6768744_6769023_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174717421.1|6769019_6769253_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174717422.1|6769621_6769861_+	cold-shock protein	NA	Q9AZD3	Lactococcus_phage	64.5	6.8e-14
WP_174717423.1|6769919_6770153_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174717424.1|6770511_6770766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174717425.1|6770776_6770992_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174717426.1|6771006_6771717_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174717427.1|6772165_6772681_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174717428.1|6772712_6773417_-	LexA family transcriptional regulator	NA	A0A1I9KG86	Aeromonas_phage	38.6	3.4e-37
WP_174717429.1|6773906_6774113_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174717430.1|6774328_6774772_+	phage regulatory CII family protein	NA	Q8W6P5	Burkholderia_virus	48.6	1.2e-27
WP_174717431.1|6774924_6775074_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174717432.1|6775066_6775366_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174717433.1|6775362_6775845_+	DUF1364 family protein	NA	Q8W6N7	Burkholderia_virus	48.9	2.3e-16
WP_174717434.1|6775841_6776822_+	helix-turn-helix domain-containing protein	NA	Q6JIG0	Burkholderia_virus	43.1	1.1e-36
WP_174717603.1|6777021_6777435_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174717435.1|6777434_6778088_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174717436.1|6778295_6779093_+	hypothetical protein	NA	NA	NA	NA	NA
6778805:6778819	attR	GGACAATAAATCTCA	NA	NA	NA	NA
WP_174717437.1|6779177_6779369_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174717438.1|6779558_6779948_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_102774659.1|6779970_6780153_-	type II toxin-antitoxin system HicA family toxin	NA	A0A0D4DC32	Acinetobacter_phage	71.2	5.9e-18
WP_174717439.1|6780313_6780628_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174717440.1|6780627_6781008_+	HNH endonuclease	NA	C7BGG5	Burkholderia_phage	52.8	7.0e-29
WP_174717441.1|6781216_6781699_+|terminase	phage terminase small subunit P27 family	terminase	A4JWZ6	Burkholderia_virus	63.3	2.3e-53
WP_174717442.1|6781702_6783421_+|terminase	terminase large subunit	terminase	A4JWZ7	Burkholderia_virus	80.7	3.9e-276
WP_174717443.1|6783420_6784647_+|portal	phage portal protein	portal	A0A2D1GNU4	Pseudomonas_phage	48.5	1.8e-94
WP_174715472.1|6784648_6785284_+|head,protease	HK97 family phage prohead protease	head,protease	Q8W628	Enterobacteria_phage	48.8	7.3e-47
WP_174715473.1|6785349_6786540_+|capsid	phage major capsid protein	capsid	A0A2D1GNH4	Pseudomonas_phage	53.8	1.2e-119
