The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP045257	Proteus mirabilis strain L90-1 chromosome, complete genome	4218783	1048545	1060506	4218783		Mycobacterium_phage(25.0%)	13	NA	NA
WP_096043046.1|1048545_1049745_-	glycine betaine/L-proline ABC transporter ATP-binding protein ProV	NA	G3M9Y6	Bacillus_virus	37.6	3.8e-28
WP_012367584.1|1050353_1051322_-	class 1b ribonucleoside-diphosphate reductase subunit beta	NA	R4TBI6	Mycobacterium_phage	71.0	5.9e-133
WP_004252248.1|1051347_1053474_-	class 1b ribonucleoside-diphosphate reductase subunit alpha	NA	V9VI16	Lactococcus_phage	51.3	1.5e-205
WP_004246072.1|1053502_1053907_-	class Ib ribonucleoside-diphosphate reductase assembly flavoprotein NrdI	NA	R4JF54	Bacillus_phage	38.5	3.7e-12
WP_004246071.1|1053918_1054143_-	glutaredoxin-like protein NrdH	NA	V5UN81	Mycobacterium_phage	47.9	1.4e-13
WP_004246069.1|1054424_1054898_+	methylated-DNA--[protein]-cysteine S-methyltransferase	NA	NA	NA	NA	NA
WP_004246068.1|1055095_1055305_+	transcription antiterminator/RNA stability regulator CspE	NA	A0A1W6JNX5	Morganella_phage	74.2	5.9e-22
WP_162492994.1|1055489_1055630_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246058.1|1056373_1056748_-	fluoride efflux transporter CrcB	NA	A0A2H4J148	uncultured_Caudovirales_phage	52.0	2.7e-25
WP_004246057.1|1056763_1057729_-	lipoyl synthase	NA	NA	NA	NA	NA
WP_004246056.1|1057830_1058475_-	lipoyl(octanoyl) transferase LipB	NA	NA	NA	NA	NA
WP_026090527.1|1058832_1059096_-	YbeD family protein	NA	NA	NA	NA	NA
WP_004246054.1|1059294_1060506_-	D-alanyl-D-alanine carboxypeptidase DacA	NA	B6DZZ7	Stx2-converting_phage	49.1	8.6e-105
>prophage 2
NZ_CP045257	Proteus mirabilis strain L90-1 chromosome, complete genome	4218783	1096417	1136387	4218783	tail,lysis,integrase	Proteus_phage(19.51%)	65	1094058:1094073	1104149:1104164
1094058:1094073	attL	TAAAAATGGAATTAAA	NA	NA	NA	NA
WP_049195171.1|1096417_1097419_-|integrase	tyrosine-type recombinase/integrase	integrase	Q9MCR4	Enterobacteria_phage	44.0	2.8e-69
WP_012367595.1|1097375_1097621_-	excisionase	NA	NA	NA	NA	NA
WP_004247455.1|1097617_1097956_-	DUF2591 domain-containing protein	NA	A0A1P8DTH6	Proteus_phage	45.0	5.6e-14
WP_012367596.1|1097948_1098125_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628830.1|1098282_1098543_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628829.1|1098594_1099047_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334496.1|1099331_1099514_-	hypothetical protein	NA	NA	NA	NA	NA
WP_153274246.1|1099553_1099715_-	hypothetical protein	NA	NA	NA	NA	NA
WP_036907946.1|1100220_1101027_-	recombination protein RecT	NA	A0A1P8DTF2	Proteus_phage	94.3	3.9e-138
WP_004246000.1|1101019_1101838_-	PD-(D/E)XK nuclease-like domain-containing protein	NA	A0A1P8DTH1	Proteus_phage	97.1	3.5e-158
WP_004245998.1|1101834_1102089_-	hypothetical protein	NA	A0A1P8DTG3	Proteus_phage	95.2	7.2e-38
WP_004245997.1|1102216_1102399_-	host cell division inhibitory peptide Kil	NA	A0A1P8DTH8	Proteus_phage	85.0	4.4e-21
WP_004245996.1|1102742_1103024_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245995.1|1102995_1103232_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049195172.1|1103246_1103564_-	hypothetical protein	NA	A0A1W6JNZ0	Morganella_phage	51.4	2.1e-18
WP_004245992.1|1104311_1104833_-	hypothetical protein	NA	I6R9C4	Salmonella_phage	78.5	5.6e-61
1104149:1104164	attR	TTTAATTCCATTTTTA	NA	NA	NA	NA
WP_004245991.1|1105070_1105412_-	DUF3024 domain-containing protein	NA	A0A1W6JP12	Morganella_phage	62.8	2.1e-37
WP_004245990.1|1105420_1106104_-	LexA family transcriptional regulator	NA	A0A1P8DTH0	Proteus_phage	98.2	1.5e-130
WP_004245989.1|1106186_1106396_+	helix-turn-helix transcriptional regulator	NA	A0A1P8DTF8	Proteus_phage	98.6	3.3e-33
WP_049195174.1|1106541_1106889_+	hypothetical protein	NA	A0A1W6JNY4	Morganella_phage	72.0	3.2e-36
WP_004251793.1|1106984_1107158_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049195176.1|1107154_1107922_+	helix-turn-helix domain-containing protein	NA	A5LH71	Enterobacteria_phage	52.8	1.0e-23
WP_046335275.1|1107921_1109307_+	AAA family ATPase	NA	Q716D2	Shigella_phage	47.7	1.0e-114
WP_049195179.1|1109332_1109782_+	hypothetical protein	NA	A0A2H4FNF5	Salmonella_phage	32.2	2.9e-13
WP_004245984.1|1109860_1110151_+	DUF1364 domain-containing protein	NA	A0A2H4JIC4	uncultured_Caudovirales_phage	68.1	7.2e-34
WP_004245983.1|1110147_1110504_+	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	71.6	3.2e-44
WP_004245982.1|1110503_1111136_+	antitermination protein	NA	I6PDF8	Cronobacter_phage	34.3	3.3e-23
WP_004247148.1|1111447_1111969_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004247488.1|1112127_1112550_+	hypothetical protein	NA	NA	NA	NA	NA
WP_026164644.1|1112603_1112873_+	hypothetical protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	3.5e-19
WP_017827434.1|1112872_1113343_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	62.5	4.4e-49
WP_004244729.1|1113324_1113483_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049195183.1|1113485_1113947_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	48.3	4.4e-25
WP_004247494.1|1114294_1114879_+	Bro-N domain-containing protein	NA	Q3LZN7	Bacteriophage	48.2	2.0e-22
WP_004245979.1|1114875_1115082_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245978.1|1115078_1115237_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004247495.1|1115270_1115873_+	hypothetical protein	NA	A0A077KBY7	Edwardsiella_phage	69.6	4.3e-65
WP_049195184.1|1115875_1117363_+	hypothetical protein	NA	A0A1W6JNY3	Morganella_phage	88.8	1.0e-264
WP_012367628.1|1117362_1118733_+	DUF4055 domain-containing protein	NA	A0A1B0VMH0	Pseudomonas_phage	48.8	9.0e-119
WP_012367629.1|1118729_1119851_+	hypothetical protein	NA	I6PD76	Cronobacter_phage	51.0	6.7e-104
WP_036907977.1|1119962_1120724_+	hypothetical protein	NA	A0A1B0VMG1	Pseudomonas_phage	59.3	1.5e-67
WP_004245970.1|1120737_1121691_+	Ig domain-containing protein	NA	A0A1B0VMF8	Pseudomonas_phage	71.6	1.4e-126
WP_107033975.1|1121693_1121978_+	Ig-like domain-containing protein	NA	NA	NA	NA	NA
WP_012367632.1|1122017_1122497_+	hypothetical protein	NA	G8C7P9	Escherichia_phage	47.7	3.8e-32
WP_004247502.1|1122499_1122850_+	hypothetical protein	NA	I6PD77	Cronobacter_phage	45.1	4.9e-21
WP_049195193.1|1122851_1123433_+	hypothetical protein	NA	G8C7Q1	Escherichia_phage	52.1	3.5e-48
WP_049195195.1|1123429_1123831_+	DUF4128 domain-containing protein	NA	NA	NA	NA	NA
WP_004247505.1|1123876_1124533_+|tail	phage tail protein	tail	G8C7Q3	Escherichia_phage	57.7	8.6e-59
WP_049195198.1|1124584_1124890_+	hypothetical protein	NA	I6PDG2	Cronobacter_phage	55.4	8.7e-22
WP_049195199.1|1124904_1125192_+	DUF1799 domain-containing protein	NA	A0A2H4J4F7	uncultured_Caudovirales_phage	49.3	6.9e-13
WP_049195202.1|1125748_1126237_+	type II toxin-antitoxin system death-on-curing family toxin	NA	NA	NA	NA	NA
WP_049195354.1|1126508_1127345_-	phage antirepressor N-terminal domain-containing protein	NA	I6S627	Salmonella_phage	59.6	1.3e-72
WP_049195353.1|1127509_1127899_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_049195351.1|1128051_1128453_+	hypothetical protein	NA	NA	NA	NA	NA
WP_064971710.1|1128565_1128838_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049195350.1|1128905_1129139_+	hypothetical protein	NA	NA	NA	NA	NA
WP_053089294.1|1129264_1130086_+	zinc ribbon domain-containing protein	NA	I6PDJ9	Cronobacter_phage	50.9	2.3e-21
WP_049195348.1|1130146_1133086_+|tail	phage tail tape measure protein	tail	A0A2P0WA05	Enterobacter_phage	34.0	1.3e-133
WP_004247512.1|1133108_1133321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049195346.1|1133360_1133651_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004245944.1|1133670_1133871_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049195345.1|1134014_1134356_+|tail	phage tail protein	tail	I6PBN7	Cronobacter_phage	50.0	9.0e-28
WP_049195343.1|1134352_1135096_+|tail	phage minor tail protein L	tail	K7PJS0	Enterobacterial_phage	59.8	2.6e-88
WP_049195341.1|1135092_1135803_+	C40 family peptidase	NA	F1C573	Cronobacter_phage	66.4	1.8e-86
WP_036976694.1|1135799_1136387_+|tail	tail assembly protein	tail	F1C572	Cronobacter_phage	58.9	7.2e-57
>prophage 3
NZ_CP045257	Proteus mirabilis strain L90-1 chromosome, complete genome	4218783	1269124	1361448	4218783	lysis,holin,tRNA,tail,integrase,head,terminase,portal,transposase,capsid,protease	Morganella_phage(13.46%)	108	1284160:1284219	1323396:1323459
WP_004247587.1|1269124_1269826_-|lysis	CidB/LrgB family autolysis modulator	lysis	NA	NA	NA	NA
WP_004247588.1|1269819_1270287_-	CidA/LrgA family protein	NA	NA	NA	NA	NA
WP_017628455.1|1270422_1272450_-|tRNA	methionine--tRNA ligase	tRNA	A0A1V0S905	Catovirus	24.0	6.0e-26
WP_004247590.1|1272654_1273767_+	iron-sulfur cluster carrier protein ApbC	NA	NA	NA	NA	NA
WP_004247591.1|1273979_1274621_+	uridine kinase	NA	A0A1V0SAA3	Catovirus	38.7	2.0e-36
WP_004244515.1|1274697_1275279_+	dCTP deaminase	NA	I4AZP2	Saccharomonospora_phage	41.6	1.5e-30
WP_017628453.1|1275323_1277255_+	outer membrane assembly protein AsmA	NA	NA	NA	NA	NA
WP_004247593.1|1277683_1279045_+	anaerobic C4-dicarboxylate transporter DcuC	NA	NA	NA	NA	NA
WP_004247594.1|1279206_1280787_-	TerC family protein	NA	A0A0R6PEZ3	Moraxella_phage	46.3	3.8e-36
WP_053828334.1|1280958_1281375_-|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	2.6e-45
WP_053867585.1|1281397_1282606_+|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	6.2e-188
WP_004247595.1|1282779_1284186_+	NADP-dependent phosphogluconate dehydrogenase	NA	A0A1D7RI04	Synechococcus_phage	29.7	8.6e-32
1284160:1284219	attL	GTATTCCATACTGAGTGGATGGAGTAAGTTTTAAAAACAGTGAGTTATAAGTGTTAGGGG	NA	NA	NA	NA
WP_080047956.1|1284254_1284506_-	pyocin activator PrtN family protein	NA	A0A1W6JP35	Morganella_phage	59.5	1.6e-18
WP_156868406.1|1284511_1284829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156868405.1|1284815_1285214_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156868404.1|1285200_1285452_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124743716.1|1285675_1286284_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156868403.1|1286283_1286982_-	Rha family transcriptional regulator	NA	A0A286S260	Klebsiella_phage	57.4	1.2e-63
WP_156868402.1|1286993_1287470_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156868401.1|1287466_1287673_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156868400.1|1287659_1288013_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156868399.1|1288086_1288509_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156868398.1|1288755_1289040_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156868397.1|1289032_1289230_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836582.1|1289216_1289414_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836581.1|1289416_1289623_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836580.1|1289624_1290089_-	helix-turn-helix transcriptional regulator	NA	A0A059VK24	Pseudomonas_phage	35.0	2.3e-05
WP_080047921.1|1290266_1290677_-	hypothetical protein	NA	B9UDL3	Salmonella_phage	70.4	5.5e-48
WP_104836579.1|1290833_1291250_-	hypothetical protein	NA	NA	NA	NA	NA
WP_104836578.1|1291239_1291491_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156868396.1|1291513_1292383_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014656506.1|1292681_1293380_-	helix-turn-helix transcriptional regulator	NA	E7C9R0	Salmonella_phage	44.6	5.0e-49
WP_135024408.1|1293505_1293763_+	helix-turn-helix domain-containing protein	NA	G8C7U2	Escherichia_phage	62.2	1.6e-16
WP_083629123.1|1293755_1294004_+	hypothetical protein	NA	A0A286S2B5	Klebsiella_phage	56.0	4.0e-17
WP_156868395.1|1294264_1295830_+	DEAD/DEAH box helicase family protein	NA	A0A286N2P9	Klebsiella_phage	68.7	4.4e-218
WP_174694358.1|1295826_1296801_+	toprim domain-containing protein	NA	A0A286N2Q0	Klebsiella_phage	54.6	4.5e-104
WP_017827437.1|1296800_1297184_+	antitermination protein Q	NA	A0A088CD47	Shigella_phage	72.2	5.5e-50
WP_156868394.1|1297556_1298180_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156868393.1|1298199_1298616_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049219097.1|1298904_1299084_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049219095.1|1299063_1299327_-	DUF1883 domain-containing protein	NA	NA	NA	NA	NA
WP_036906009.1|1299696_1299993_+|holin	phage holin family protein	holin	E7C9S8	Salmonella_phage	45.4	1.0e-19
WP_049219093.1|1299989_1300394_+	structural protein	NA	A0A2I7RXE2	Vibrio_phage	51.3	2.6e-26
WP_049219091.1|1300390_1300843_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	56.5	4.0e-31
WP_167767287.1|1300842_1300983_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049219090.1|1301106_1301298_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049219089.1|1301399_1301807_+	hypothetical protein	NA	A0A1P8DTD7	Proteus_phage	85.9	1.7e-57
WP_049219087.1|1301872_1302223_+	HNH endonuclease	NA	A0A1P8DTD1	Proteus_phage	93.9	2.4e-60
WP_049218006.1|1302219_1302417_+	hypothetical protein	NA	A0A1P8DTB8	Proteus_phage	87.7	6.4e-26
WP_049218005.1|1302564_1303035_+|terminase	phage terminase small subunit P27 family	terminase	A0A1W6JP17	Morganella_phage	81.4	7.7e-70
WP_071425264.1|1303038_1304772_+|terminase	terminase large subunit	terminase	A0A1P8DTK0	Proteus_phage	98.2	0.0e+00
WP_174694359.1|1304768_1304930_+	hypothetical protein	NA	A0A1W6JP78	Morganella_phage	66.0	2.5e-12
WP_174694360.1|1304919_1306149_+|portal	phage portal protein	portal	A0A1W6JP33	Morganella_phage	87.3	4.1e-211
WP_017827274.1|1306138_1306744_+|head,protease	HK97 family phage prohead protease	head,protease	Q8SBH9	Shigella_phage	80.5	9.0e-87
WP_156868408.1|1306759_1307989_+|capsid	phage major capsid protein	capsid	A0A1W6JP20	Morganella_phage	82.0	3.8e-185
WP_026164628.1|1308074_1308377_+|head,tail	phage gp6-like head-tail connector protein	head,tail	A0A1W6JNZ5	Morganella_phage	70.0	6.8e-35
WP_080749322.1|1308383_1308710_+|head	phage head closure protein	head	Q7Y406	Yersinia_phage	44.5	2.6e-16
WP_156868392.1|1308696_1309086_+	hypothetical protein	NA	Q7Y405	Yersinia_phage	50.0	1.7e-30
WP_026164627.1|1309094_1309487_+	HK97 gp10 family phage protein	NA	Q7Y404	Yersinia_phage	57.9	1.2e-31
WP_017827268.1|1309509_1309986_+|tail	major tail shaft subunit	tail	Q7Y403	Yersinia_phage	75.5	6.9e-58
WP_017827267.1|1309985_1310336_+|tail	phage tail protein	tail	Q6UAW8	Klebsiella_phage	40.5	6.2e-16
WP_156868391.1|1310592_1313898_+|tail	phage tail tape measure protein	tail	Q6UAW7	Klebsiella_phage	41.4	1.0e-176
WP_036901058.1|1313898_1314498_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	55.4	4.0e-55
WP_156868390.1|1314494_1315076_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	1.1e-49
WP_156868389.1|1315117_1315762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049210594.1|1315827_1316226_+	hypothetical protein	NA	A0A2H4IYI8	uncultured_Caudovirales_phage	47.7	4.1e-32
WP_156868388.1|1316226_1319475_+	DUF1983 domain-containing protein	NA	A0A1W6JS43	Salmonella_phage	40.2	8.8e-189
WP_156868387.1|1319491_1320832_+	hypothetical protein	NA	A0A1P8DTJ0	Proteus_phage	55.1	2.3e-114
WP_174694357.1|1320828_1320987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049211399.1|1321009_1321315_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_156868386.1|1321705_1322080_-	hypothetical protein	NA	NA	NA	NA	NA
WP_080047906.1|1322157_1323240_-|integrase	site-specific integrase	integrase	A0A1W6JP34	Morganella_phage	62.5	4.8e-131
WP_004244520.1|1323541_1324039_-|tRNA	YbaK/prolyl-tRNA synthetase associated domain-containing protein	tRNA	NA	NA	NA	NA
1323396:1323459	attR	GTATTCCATACTGAGTGGATGGAGTAAGTTTTAAAAACAGTGAGTTATAAGTGTTAGGGGTGCT	NA	NA	NA	NA
WP_017628450.1|1324352_1325504_+	L-threonine dehydrogenase	NA	NA	NA	NA	NA
WP_012367689.1|1325646_1326264_-	bifunctional phosphoribosyl-AMP cyclohydrolase/phosphoribosyl-ATP diphosphatase HisIE	NA	A0A2H4UVM0	Bodo_saltans_virus	30.1	1.6e-14
WP_004244523.1|1326263_1327037_-	imidazole glycerol phosphate synthase subunit HisF	NA	NA	NA	NA	NA
WP_004244524.1|1327018_1327756_-	1-(5-phosphoribosyl)-5-[(5- phosphoribosylamino)methylideneamino]imidazole-4- carboxamide isomerase	NA	NA	NA	NA	NA
WP_004244525.1|1327762_1328353_-	imidazole glycerol phosphate synthase subunit HisH	NA	NA	NA	NA	NA
WP_004244526.1|1328352_1329420_-	bifunctional histidinol-phosphatase/imidazoleglycerol-phosphate dehydratase HisB	NA	NA	NA	NA	NA
WP_004252070.1|1329468_1330551_-	histidinol-phosphate transaminase	NA	NA	NA	NA	NA
WP_017628449.1|1330553_1331870_-	histidinol dehydrogenase	NA	NA	NA	NA	NA
WP_004244529.1|1331876_1332776_-	ATP phosphoribosyltransferase	NA	A0A0F7Q4B0	Cellulophaga_phage	84.2	2.5e-08
WP_017628448.1|1333281_1334103_+	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_004244532.1|1334099_1334720_-	glutathione S-transferase	NA	NA	NA	NA	NA
WP_004247605.1|1334877_1336080_+	serine hydrolase	NA	B6DZZ7	Stx2-converting_phage	50.1	4.0e-102
WP_017628447.1|1336169_1337840_-	formate--tetrahydrofolate ligase	NA	NA	NA	NA	NA
WP_004244536.1|1338187_1339552_-	L-serine ammonia-lyase	NA	NA	NA	NA	NA
WP_017628446.1|1339666_1340995_-	HAAAP family serine/threonine permease	NA	NA	NA	NA	NA
WP_004247606.1|1341923_1342535_-	undecaprenyl-diphosphate phosphatase	NA	NA	NA	NA	NA
WP_004252055.1|1342772_1343198_+	YjbQ family protein	NA	NA	NA	NA	NA
WP_004244541.1|1343464_1343728_-	GrxA family glutaredoxin	NA	A0A2I7SAE2	Vibrio_phage	70.5	6.5e-26
WP_004247610.1|1343898_1344201_+	YbjC family protein	NA	NA	NA	NA	NA
WP_012367695.1|1344371_1344875_+	YbjN domain-containing protein	NA	NA	NA	NA	NA
WP_012367696.1|1344903_1346037_+	23S rRNA (uracil(747)-C(5))-methyltransferase RlmC	NA	A0A1X9I6F4	Streptococcus_phage	25.5	3.5e-23
WP_004244548.1|1346179_1346848_-	arginine ABC transporter permease ArtM	NA	NA	NA	NA	NA
WP_004244549.1|1346847_1347552_-	arginine ABC transporter permease ArtQ	NA	NA	NA	NA	NA
WP_004244550.1|1347582_1348317_-	arginine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_012367698.1|1348331_1349060_-	arginine ABC transporter ATP-binding protein ArtP	NA	G9BWD6	Planktothrix_phage	36.7	8.4e-31
WP_026090488.1|1349175_1350630_-	DUF2867 domain-containing protein	NA	NA	NA	NA	NA
WP_004244553.1|1350681_1351584_-	lysine exporter LysO family protein	NA	NA	NA	NA	NA
WP_004244554.1|1351929_1353603_+	DUF2813 domain-containing protein	NA	NA	NA	NA	NA
WP_004244555.1|1353744_1354854_+	macrolide transporter subunit MacA	NA	NA	NA	NA	NA
WP_017628445.1|1354853_1356797_+	macrolide ABC transporter ATP-binding protein/permease MacB	NA	G9BWD6	Planktothrix_phage	41.3	6.5e-38
WP_004244557.1|1356959_1357169_-	cold shock domain-containing protein CspD	NA	A0A2H4N7Y6	Lake_Baikal_phage	58.2	1.4e-15
WP_004244558.1|1357458_1357773_+|protease	ATP-dependent Clp protease adapter ClpS	protease	A0A1B1IT64	uncultured_Mediterranean_phage	44.1	1.5e-13
WP_004244559.1|1357803_1360098_+|protease	ATP-dependent Clp protease ATP-binding subunit ClpA	protease	A0A223W0B1	Agrobacterium_phage	42.9	1.3e-170
WP_004244560.1|1360217_1360436_-	translation initiation factor IF-1	NA	NA	NA	NA	NA
WP_012367702.1|1360755_1361448_-|tRNA	leucyl/phenylalanyl-tRNA--protein transferase	tRNA	NA	NA	NA	NA
>prophage 4
NZ_CP045257	Proteus mirabilis strain L90-1 chromosome, complete genome	4218783	1403452	1456597	4218783	tRNA,integrase,plate,transposase	uncultured_Caudovirales_phage(50.0%)	40	1438747:1438763	1464329:1464345
WP_004244596.1|1403452_1404226_+|tRNA	tRNA uridine 5-oxyacetic acid(34) methyltransferase CmoM	tRNA	NA	NA	NA	NA
WP_004244597.1|1404235_1405558_+	chromosome partition protein MukF	NA	NA	NA	NA	NA
WP_004247634.1|1405538_1406270_+	chromosome partition protein MukE	NA	NA	NA	NA	NA
WP_012367715.1|1406266_1410724_+	chromosome partition protein MukB	NA	NA	NA	NA	NA
WP_004247636.1|1411006_1411660_-	type A chloramphenicol O-acetyltransferase	NA	G3CFL0	Escherichia_phage	80.4	8.2e-102
WP_004247637.1|1412065_1412779_+	acid phosphatase AphA	NA	NA	NA	NA	NA
WP_049194798.1|1413128_1414844_+	L,D-transpeptidase	NA	NA	NA	NA	NA
WP_004244605.1|1415175_1415724_+	YcbK family protein	NA	NA	NA	NA	NA
WP_004247640.1|1415773_1416424_+	MBL fold metallo-hydrolase	NA	NA	NA	NA	NA
WP_004244607.1|1416516_1416990_-	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_004244608.1|1417080_1418817_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_017628437.1|1418809_1420165_-	type VI secretion system ImpA family N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_017628436.1|1420202_1423751_-	type VI secretion system membrane subunit TssM	NA	NA	NA	NA	NA
WP_012367720.1|1423753_1425217_-	type VI secretion system protein TssA	NA	NA	NA	NA	NA
WP_004244612.1|1425222_1425873_-	type VI secretion system-associated protein TagO	NA	NA	NA	NA	NA
WP_004244614.1|1425874_1426663_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049194443.1|1426666_1429378_-	type VI secretion system ATPase TssH	NA	K4FB40	Cronobacter_phage	30.5	1.4e-83
WP_004244617.1|1429386_1430142_-	DotU family type IV/VI secretion system protein	NA	NA	NA	NA	NA
WP_026164596.1|1430134_1431493_-|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
WP_063073901.1|1431494_1432046_-	type VI secretion system lipoprotein TssJ	NA	NA	NA	NA	NA
WP_004247648.1|1432047_1433316_-	type VI secretion system-associated FHA domain protein TagH	NA	NA	NA	NA	NA
WP_049194444.1|1433320_1434358_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_049194445.1|1434321_1436097_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_004244624.1|1436104_1436536_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_063073902.1|1436541_1438020_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_004247653.1|1438040_1438541_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
1438747:1438763	attL	ACAAAATTAACTTAGGG	NA	NA	NA	NA
WP_004246976.1|1440438_1440957_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_053828341.1|1441040_1443233_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_004251951.1|1443244_1443664_+	DcrB-related protein	NA	NA	NA	NA	NA
WP_063693455.1|1443728_1448429_+	AHH domain-containing protein	NA	A0A2H4JFP5	uncultured_Caudovirales_phage	42.9	3.0e-28
WP_049195080.1|1448456_1449068_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894566.1|1449294_1449762_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049194460.1|1450567_1451023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046335381.1|1451829_1452093_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049195253.1|1452092_1452560_+	hypothetical protein	NA	NA	NA	NA	NA
WP_152964539.1|1452721_1452862_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049195076.1|1453821_1454232_+	hypothetical protein	NA	NA	NA	NA	NA
WP_081000326.1|1455102_1455612_+	RHS repeat-associated core domain-containing protein	NA	A0A2H4JHK7	uncultured_Caudovirales_phage	55.0	1.7e-14
WP_046335376.1|1455608_1456013_+	hypothetical protein	NA	NA	NA	NA	NA
WP_155722981.1|1456078_1456597_-|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
1464329:1464345	attR	CCCTAAGTTAATTTTGT	NA	NA	NA	NA
>prophage 5
NZ_CP045257	Proteus mirabilis strain L90-1 chromosome, complete genome	4218783	1596611	1631099	4218783	lysis,tRNA,tail,integrase,head,terminase,portal,capsid,protease	Morganella_phage(20.0%)	48	1590719:1590735	1637652:1637668
1590719:1590735	attL	TATTTATCAAATGATAA	NA	NA	NA	NA
WP_004247117.1|1596611_1597715_-|tRNA	tRNA 2-thiouridine(34) synthase MnmA	tRNA	NA	NA	NA	NA
WP_004247118.1|1597820_1598273_-	NUDIX hydrolase	NA	NA	NA	NA	NA
WP_004247119.1|1598265_1598895_-	23S rRNA pseudouridine(2457) synthase RluE	NA	NA	NA	NA	NA
WP_004247120.1|1599033_1600287_+	NADP-dependent isocitrate dehydrogenase	NA	Q77Z09	Phage_21	92.6	1.6e-21
WP_004251675.1|1600407_1601535_-|integrase	phage integrase Arm DNA-binding domain-containing protein	integrase	O21925	Phage_21	60.6	3.7e-126
WP_004251672.1|1601515_1601758_-	excisionase	NA	NA	NA	NA	NA
WP_004247124.1|1601819_1602350_-	hypothetical protein	NA	A0A1W6JP41	Morganella_phage	58.6	5.7e-53
WP_004247125.1|1602406_1603234_-	YfdQ family protein	NA	A0A2R2Z323	Escherichia_phage	56.6	5.5e-79
WP_004247126.1|1603299_1603674_-	hypothetical protein	NA	Q8HAA1	Salmonella_phage	71.4	3.2e-42
WP_004247128.1|1604322_1604805_-	hypothetical protein	NA	A0A2D1GNH0	Pseudomonas_phage	51.4	3.7e-11
WP_004247129.1|1604908_1605148_+	helix-turn-helix domain-containing protein	NA	D0UIL8	Aggregatibacter_phage	54.8	3.0e-14
WP_004247130.1|1605232_1605691_+	hypothetical protein	NA	K7PJS5	Enterobacterial_phage	50.8	3.9e-26
WP_096058090.1|1605780_1605990_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063108983.1|1605979_1606159_+	DUF4222 domain-containing protein	NA	A0A1W6JP38	Morganella_phage	53.4	6.8e-11
WP_004247133.1|1606171_1607263_+	hypothetical protein	NA	H2DE83	Erwinia_phage	55.3	8.2e-30
WP_004247134.1|1607434_1608142_+	phage regulatory protein/antirepressor Ant	NA	G0ZND1	Cronobacter_phage	51.7	5.6e-56
WP_004247135.1|1608141_1609167_+	DUF968 domain-containing protein	NA	A0A1W6JP62	Morganella_phage	47.6	2.8e-88
WP_004247136.1|1609194_1609593_+	antitermination protein	NA	Q8W638	Enterobacteria_phage	55.0	1.0e-30
WP_004247137.1|1609935_1610148_+	cold-shock protein	NA	A0A1W6JNX5	Morganella_phage	75.7	7.6e-25
WP_004247148.1|1610549_1611071_+	DUF1440 domain-containing protein	NA	NA	NA	NA	NA
WP_004251632.1|1611394_1611730_-	carboxymuconolactone decarboxylase family protein	NA	NA	NA	NA	NA
WP_017827436.1|1611833_1612760_+	cupin domain-containing protein	NA	NA	NA	NA	NA
WP_036905792.1|1613176_1613605_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894738.1|1613757_1614009_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905789.1|1614452_1614722_+	bacteriophage protein	NA	A0A2H4FNF0	Salmonella_phage	53.5	4.6e-19
WP_036900946.1|1614721_1615192_+	lysozyme	NA	A0A1W6JNW4	Morganella_phage	60.5	5.8e-49
WP_162837602.1|1615173_1615332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036905787.1|1615334_1615796_+|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	47.6	3.7e-24
WP_001967215.1|1616692_1617031_+	HNH endonuclease	NA	F1C587	Cronobacter_phage	67.9	1.6e-40
WP_036905782.1|1617033_1617246_+	hypothetical protein	NA	A0A1W6JP16	Morganella_phage	44.8	1.1e-07
WP_036905779.1|1617369_1617837_+|terminase	phage terminase small subunit P27 family	terminase	Q9B019	Phage_GMSE-1	59.7	5.5e-44
WP_036969710.1|1617790_1619524_+|terminase	terminase large subunit	terminase	A0A0U2C138	Paracoccus_phage	46.5	6.9e-148
WP_012367784.1|1619523_1620792_+|portal	phage portal protein	portal	Q77W97	Enterobacteria_phage	80.2	5.1e-201
WP_004251596.1|1620809_1621478_+|head,protease	HK97 family phage prohead protease	head,protease	K7PM91	Enterobacterial_phage	65.3	1.1e-82
WP_004251594.1|1621481_1622648_+|capsid	phage major capsid protein	capsid	F1C582	Cronobacter_phage	79.8	5.6e-170
WP_004251590.1|1622686_1622986_+|head,tail	phage head-tail connector protein	head,tail	K7PKV5	Enterobacterial_phage	64.3	2.8e-33
WP_004251588.1|1622985_1623315_+|head	phage head closure protein	head	NA	NA	NA	NA
WP_004251585.1|1623304_1623778_+	HK97 gp10 family phage protein	NA	A0A0R6PHU8	Moraxella_phage	31.5	1.9e-12
WP_004251583.1|1623783_1624125_+	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_004251580.1|1624134_1624800_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251577.1|1624864_1625281_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036894769.1|1625277_1625556_+	DUF4035 domain-containing protein	NA	NA	NA	NA	NA
WP_004242485.1|1625580_1625772_-	YqaE/Pmp3 family membrane protein	NA	NA	NA	NA	NA
WP_036905771.1|1625898_1629174_+|tail	phage tail tape measure protein	tail	B7SE05	Pseudomonas_virus	45.6	6.4e-54
WP_004251569.1|1629174_1629771_+	hypothetical protein	NA	S4TSP7	Salmonella_phage	52.8	4.6e-51
WP_004251564.1|1629770_1630352_+	hypothetical protein	NA	Q7Y3Z7	Yersinia_phage	50.0	2.4e-52
WP_004251562.1|1630363_1630669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004251558.1|1630700_1631099_+	hypothetical protein	NA	A0A059VK01	Pseudomonas_phage	47.7	9.2e-32
1637652:1637668	attR	TATTTATCAAATGATAA	NA	NA	NA	NA
>prophage 6
NZ_CP045257	Proteus mirabilis strain L90-1 chromosome, complete genome	4218783	2220724	2264613	4218783	tail,integrase,terminase,holin	Salmonella_phage(22.22%)	57	2243981:2243995	2264833:2264847
WP_004243319.1|2220724_2221777_-	nucleotidyltransferase domain-containing protein	NA	A0A067XQU1	Caulobacter_phage	23.1	1.6e-06
WP_017628042.1|2221760_2222540_-	nucleotidyltransferase domain-containing protein	NA	A0A2D1GQQ2	Pseudomonas_phage	39.3	1.4e-31
WP_115370907.1|2222917_2223412_-	hypothetical protein	NA	NA	NA	NA	NA
WP_115370906.1|2223411_2223756_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	85.3	7.0e-44
WP_004243326.1|2223758_2224031_-|holin	phage holin family protein	holin	T1SA10	Salmonella_phage	38.9	1.9e-12
WP_115370905.1|2224027_2224399_-	hypothetical protein	NA	G9L6E6	Escherichia_phage	38.2	2.5e-15
WP_156868326.1|2224473_2226720_-	hypothetical protein	NA	G9L6E4	Escherichia_phage	54.7	1.5e-62
WP_109023870.1|2226893_2227145_+	hypothetical protein	NA	NA	NA	NA	NA
WP_135024034.1|2227340_2227481_+	ash family protein	NA	NA	NA	NA	NA
WP_156868325.1|2227503_2228226_+	ORF6N domain-containing protein	NA	A0A0P0ZC44	Stx2-converting_phage	54.0	3.1e-33
WP_020945799.1|2228256_2228796_-	hypothetical protein	NA	NA	NA	NA	NA
WP_051175910.1|2228797_2229085_-	hypothetical protein	NA	A0A2R9YJP3	Escherichia_phage	36.2	6.7e-08
WP_156868324.1|2229081_2232459_-	hypothetical protein	NA	A0A2I7RY58	Vibrio_phage	35.9	6.2e-185
WP_156868323.1|2232458_2235542_-	hypothetical protein	NA	T1SBJ1	Salmonella_phage	50.6	2.3e-162
WP_004243338.1|2235544_2236093_-	hypothetical protein	NA	A0A0F6TJ56	Escherichia_coli_O157_typing_phage	60.2	3.4e-45
WP_115370899.1|2236092_2236581_-	hypothetical protein	NA	A0A0F6R7N6	Escherichia_coli_O157_typing_phage	60.5	7.1e-50
WP_156868322.1|2236564_2239027_-	hypothetical protein	NA	A0A0F6TJD3	Escherichia_coli_O157_typing_phage	70.0	0.0e+00
WP_156868321.1|2239026_2239632_-	hypothetical protein	NA	A0A0F6TJN5	Escherichia_coli_O157_typing_phage	61.2	1.0e-66
WP_020945806.1|2239631_2239943_-	hypothetical protein	NA	Q858G5	Salmonella_phage	38.5	8.8e-14
WP_156868320.1|2240006_2240348_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060555916.1|2240356_2240788_-	hypothetical protein	NA	A0A193GYT9	Enterobacter_phage	54.8	1.4e-30
WP_004243350.1|2240846_2241827_-	hypothetical protein	NA	G9L6C5	Escherichia_phage	59.4	6.5e-111
WP_046334336.1|2241842_2242520_-	peptidase	NA	T1SAP9	Salmonella_phage	64.3	4.0e-43
WP_156868319.1|2242549_2242864_-	hypothetical protein	NA	Q2A090	Sodalis_phage	45.5	2.0e-13
WP_156868318.1|2242860_2244525_-|tail	phage tail protein	tail	A0A193GYI4	Enterobacter_phage	65.9	6.3e-199
2243981:2243995	attL	AACTGGCGAACGGTC	NA	NA	NA	NA
WP_004243356.1|2244534_2244747_-	hypothetical protein	NA	NA	NA	NA	NA
WP_116672587.1|2244954_2245290_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046334334.1|2245332_2246817_-	hypothetical protein	NA	G9L6B8	Escherichia_phage	77.8	9.5e-231
WP_080047821.1|2246816_2247380_-|terminase	terminase small subunit	terminase	G9L6B7	Escherichia_phage	50.3	2.5e-43
WP_156868317.1|2247429_2248092_-	hypothetical protein	NA	NA	NA	NA	NA
WP_156868316.1|2248117_2248459_-	hypothetical protein	NA	H9C172	Pectobacterium_phage	65.1	1.2e-35
WP_156868315.1|2248518_2248869_-	DUF2591 family protein	NA	NA	NA	NA	NA
WP_156868314.1|2248865_2249072_-	DUF551 domain-containing protein	NA	NA	NA	NA	NA
WP_156868313.1|2249058_2249280_-	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_166465207.1|2249290_2249464_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060555927.1|2249590_2249986_-	RusA family crossover junction endodeoxyribonuclease	NA	G8C7V6	Escherichia_phage	60.9	5.2e-35
WP_046334325.1|2249982_2250396_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243368.1|2250642_2251368_-	ATP-binding protein	NA	A0A1W6JP39	Morganella_phage	78.8	6.7e-105
WP_156868312.1|2251367_2252210_-	hypothetical protein	NA	A0A0D4DBT2	Acinetobacter_phage	59.7	5.0e-51
WP_004243371.1|2252220_2252406_-	hypothetical protein	NA	A0A0F6TJB7	Escherichia_coli_O157_typing_phage	50.8	6.0e-10
WP_072064163.1|2252545_2252824_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243373.1|2252901_2253510_+	hypothetical protein	NA	A0A0F6R8L7	Escherichia_coli_O157_typing_phage	35.4	1.5e-28
WP_004243375.1|2253758_2253920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_156868311.1|2253906_2255628_+	PD-(D/E)XK nuclease-like domain-containing protein	NA	H6WRX1	Salmonella_phage	50.0	5.3e-108
WP_156868310.1|2255673_2256714_+	recombinase RecT	NA	H6WRX0	Salmonella_phage	50.7	2.5e-100
WP_156868309.1|2256757_2257015_+	AlpA family phage regulatory protein	NA	NA	NA	NA	NA
WP_087802219.1|2257076_2257259_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087802218.1|2257297_2257831_+	hypothetical protein	NA	J9Q748	Salmonella_phage	46.9	2.8e-39
WP_087802217.1|2257830_2258085_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087802216.1|2258077_2258578_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087802215.1|2258561_2259035_+	class I SAM-dependent methyltransferase	NA	A0A1W6JP48	Morganella_phage	78.7	2.0e-70
WP_087802214.1|2259031_2259673_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	61.1	6.6e-72
WP_036936127.1|2259675_2259873_+	hypothetical protein	NA	A0A1P8DTH3	Proteus_phage	65.1	7.5e-19
WP_156868308.1|2259872_2260061_+	hypothetical protein	NA	NA	NA	NA	NA
WP_087726475.1|2260068_2261265_-|integrase	tyrosine-type recombinase/integrase	integrase	T1S9J3	Salmonella_phage	61.9	1.6e-140
WP_004250844.1|2261484_2263062_-	glutamine-hydrolyzing GMP synthase	NA	NA	NA	NA	NA
WP_004243391.1|2263146_2264613_-	IMP dehydrogenase	NA	A0A1V0SHK8	Klosneuvirus	38.7	4.7e-89
2264833:2264847	attR	GACCGTTCGCCAGTT	NA	NA	NA	NA
>prophage 7
NZ_CP045257	Proteus mirabilis strain L90-1 chromosome, complete genome	4218783	2439104	2457907	4218783	lysis,plate,holin	Escherichia_phage(21.43%)	21	NA	NA
WP_012368081.1|2439104_2441543_+	molybdopterin-dependent oxidoreductase	NA	A0A077SK27	Escherichia_phage	54.5	5.0e-261
WP_004243609.1|2441554_2442172_+	dimethylsulfoxide reductase subunit B	NA	A0A077SL61	Escherichia_phage	67.8	1.3e-88
WP_004243611.1|2442175_2442952_+	dimethyl sulfoxide reductase anchor subunit	NA	A0A077SK59	Escherichia_phage	39.8	5.1e-42
WP_004243612.1|2443067_2443610_-	DUF924 domain-containing protein	NA	A0A1V0SIY0	Klosneuvirus	34.7	1.9e-19
WP_017628013.1|2444178_2444358_+	GhoT/OrtT family toxin	NA	NA	NA	NA	NA
WP_017628011.1|2445672_2446329_-	DUF2612 domain-containing protein	NA	Q6IWQ4	Burkholderia_phage	39.4	6.6e-35
WP_017628010.1|2446325_2447513_-|plate	baseplate J/gp47 family protein	plate	A0A2H5BG53	Pseudoalteromonas_phage	37.7	1.9e-72
WP_004243617.1|2447505_2447850_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004243621.1|2447846_2448539_-	hypothetical protein	NA	A0A2H4P6V3	Pseudomonas_phage	35.7	1.2e-29
WP_004243622.1|2448541_2449354_-	hypothetical protein	NA	Q6IWQ0	Burkholderia_phage	39.2	9.0e-42
WP_004243623.1|2449322_2449643_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004250719.1|2449655_2450144_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628009.1|2450146_2452450_-	hypothetical protein	NA	A0A2H5BG44	Pseudoalteromonas_phage	23.1	1.6e-14
WP_004243627.1|2452532_2452991_-	hypothetical protein	NA	Q6IWV4	Burkholderia_phage	48.5	1.9e-25
WP_012368088.1|2453050_2453503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628008.1|2453513_2455001_-	DUF3383 domain-containing protein	NA	A0A088C3U1	Shewanella_sp._phage	35.7	1.4e-77
WP_004248364.1|2455009_2455522_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628007.1|2455558_2456008_-|lysis	lysis protein	lysis	NA	NA	NA	NA
WP_017628006.1|2456004_2456409_-	hypothetical protein	NA	A0A0E3JJ20	Enterobacteria_phage	46.6	1.0e-25
WP_004248367.1|2456411_2456711_-|holin	phage holin, lambda family	holin	A0A1P8DTE4	Proteus_phage	51.0	1.9e-21
WP_004243640.1|2457091_2457907_-	antitermination protein	NA	M9NZB0	Enterobacteria_phage	43.4	2.1e-54
>prophage 8
NZ_CP045257	Proteus mirabilis strain L90-1 chromosome, complete genome	4218783	2934465	3002031	4218783	lysis,holin,integrase,terminase,capsid	Salmonella_phage(17.65%)	96	2950280:2950326	3000890:3000936
WP_052715531.1|2934465_2937696_-	hypothetical protein	NA	A0A1W6JNU2	Morganella_phage	42.0	1.8e-101
WP_036918873.1|2937712_2938054_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072271821.1|2938053_2938227_-	3-hydroxybutyryl-CoA dehydrogenase	NA	NA	NA	NA	NA
WP_036918875.1|2938398_2938911_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096043103.1|2939895_2942616_-	DUF927 domain-containing protein	NA	A0A1W6JPG0	Morganella_phage	66.1	0.0e+00
WP_046334700.1|2942612_2942957_-	hypothetical protein	NA	A0A1W6JPD8	Morganella_phage	71.1	1.4e-44
WP_052715532.1|2942971_2943568_-	hypothetical protein	NA	A0A286S1S7	Klebsiella_phage	38.2	6.4e-29
WP_036900272.1|2943567_2943762_-	hypothetical protein	NA	NA	NA	NA	NA
WP_165469419.1|2943761_2943935_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334701.1|2943931_2944543_-	ORF6N domain-containing protein	NA	A0A1B5FPC0	Escherichia_phage	46.3	3.3e-20
WP_036907509.1|2944539_2944749_-	hypothetical protein	NA	A0A1W6JPF1	Morganella_phage	52.2	4.7e-11
WP_036918882.1|2944745_2944925_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046334702.1|2944921_2945179_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072052191.1|2945181_2945355_-	DUF4222 domain-containing protein	NA	NA	NA	NA	NA
WP_080942627.1|2945347_2946289_-	ash family protein	NA	A0A1W6JPK3	Morganella_phage	50.0	3.3e-64
WP_046334703.1|2946285_2947119_-	antA/AntB antirepressor family protein	NA	A0A088CBR4	Shigella_phage	46.1	1.4e-21
WP_036918890.1|2947131_2947527_-	hypothetical protein	NA	A0A1W6JPH9	Morganella_phage	56.9	2.1e-28
WP_036918892.1|2947526_2947724_-	AlpA family transcriptional regulator	NA	A0A2H4J8C8	uncultured_Caudovirales_phage	46.3	2.3e-07
WP_046334704.1|2948904_2950116_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	55.7	3.8e-129
2950280:2950326	attL	AATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
WP_124724720.1|2950500_2950731_+	DNA polymerase III subunit theta	NA	A0A1P8DTI0	Proteus_phage	96.1	4.8e-33
WP_156868294.1|2950752_2951703_-	acyltransferase family protein	NA	NA	NA	NA	NA
WP_174694361.1|2951711_2953610_-	hypothetical protein	NA	F1C5A8	Cronobacter_phage	69.3	2.3e-48
WP_156868293.1|2953668_2956137_-	MoaD/ThiS family protein	NA	F1C5A7	Cronobacter_phage	51.8	5.6e-252
WP_156868292.1|2956123_2956516_-	C40 family peptidase	NA	F1C5F2	Cronobacter_phage	59.5	2.7e-44
WP_004247776.1|2956512_2956983_-	DUF1833 family protein	NA	F1C5F1	Cronobacter_phage	51.3	2.6e-41
WP_156868291.1|2956982_2957459_-	hypothetical protein	NA	F1C5F0	Cronobacter_phage	71.6	4.3e-60
WP_156868290.1|2957462_2960804_-	tape measure protein	NA	A0A1W6JNU2	Morganella_phage	45.6	3.6e-193
WP_124743686.1|2960868_2961177_-	hypothetical protein	NA	NA	NA	NA	NA
WP_124743685.1|2961240_2961510_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121909508.1|2961548_2962241_-	hypothetical protein	NA	NA	NA	NA	NA
WP_121909506.1|2962269_2962515_-	Arc family DNA-binding protein	NA	A0A0M5M1J2	Salmonella_phage	52.0	1.2e-13
WP_121909504.1|2962611_2962764_+	Arc family DNA-binding protein	NA	NA	NA	NA	NA
WP_049199086.1|2963760_2964168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049199087.1|2964158_2964941_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096043090.1|2965191_2965881_-	hypothetical protein	NA	A0A1W6JNX2	Morganella_phage	72.4	1.1e-91
WP_096043089.1|2965930_2966686_-	Ig-like domain-containing protein	NA	A0A1W6JNT1	Morganella_phage	78.9	2.8e-106
WP_096043088.1|2966750_2967119_-	hypothetical protein	NA	F1C5E4	Cronobacter_phage	30.3	1.1e-10
WP_096043087.1|2967115_2967487_-	hypothetical protein	NA	G0ZNE3	Cronobacter_phage	65.0	1.1e-39
WP_094960237.1|2967488_2967830_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096043086.1|2967829_2968228_-	hypothetical protein	NA	I6S619	Salmonella_phage	78.6	2.3e-54
WP_004247764.1|2968285_2968459_-	hypothetical protein	NA	I6R9A3	Salmonella_phage	51.8	1.4e-08
WP_096043085.1|2968468_2969563_-	hypothetical protein	NA	G0ZND9	Cronobacter_phage	68.6	1.7e-144
WP_166465080.1|2969575_2970019_-	hypothetical protein	NA	I6S1Q2	Salmonella_phage	68.0	1.9e-46
WP_063073748.1|2970024_2971299_-	hypothetical protein	NA	G0ZND7	Cronobacter_phage	63.9	4.7e-154
WP_096043083.1|2971302_2972232_-|capsid	minor capsid protein	capsid	A0A1V0E5Q2	Salmonella_phage	55.0	1.7e-89
WP_063073746.1|2972182_2973538_-	DUF1073 domain-containing protein	NA	H6WRT0	Salmonella_phage	64.4	2.7e-163
WP_063073745.1|2973537_2974782_-|terminase	PBSX family phage terminase large subunit	terminase	A0A1V0E5Q3	Salmonella_phage	74.2	3.2e-187
WP_063073744.1|2974762_2975203_-	hypothetical protein	NA	Q716H4	Shigella_phage	65.5	1.7e-42
WP_063073743.1|2975350_2975536_-	hypothetical protein	NA	A0A1W6JNV6	Morganella_phage	73.8	3.4e-21
WP_096043082.1|2975538_2975751_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073741.1|2975848_2976535_-	Rha family transcriptional regulator	NA	A0A192Y918	Salmonella_phage	76.8	1.3e-97
WP_096043081.1|2976975_2977428_-|lysis	lysis protein	lysis	A0A1P8DTG0	Proteus_phage	81.2	2.8e-53
WP_036976899.1|2977429_2977762_-	M15 family metallopeptidase	NA	F1BUL3	Cronobacter_phage	70.3	4.4e-35
WP_004918415.1|2977748_2978042_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_004916901.1|2978038_2978428_-	membrane protein	NA	S4TRS4	Salmonella_phage	35.0	4.2e-13
WP_096043080.1|2978563_2979331_-	KilA-N domain-containing protein	NA	G9BW66	Planktothrix_phage	35.0	1.3e-18
WP_036969493.1|2979872_2980376_-	DUF1133 family protein	NA	A0A1P8DTF1	Proteus_phage	88.0	4.0e-80
WP_063073738.1|2980372_2980564_-	hypothetical protein	NA	A0A1P8DTD3	Proteus_phage	95.2	6.6e-28
WP_063073737.1|2980553_2980919_-	RusA family crossover junction endodeoxyribonuclease	NA	E5AGG1	Erwinia_phage	64.1	1.3e-37
WP_063073736.1|2980915_2981206_-	DUF1364 domain-containing protein	NA	K7P6U2	Enterobacteria_phage	78.9	1.6e-38
WP_156868289.1|2981198_2981351_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073735.1|2981443_2981893_-	hypothetical protein	NA	A0A1P8DTF9	Proteus_phage	95.3	4.5e-75
WP_063073734.1|2982014_2982239_-	DUF3310 domain-containing protein	NA	A0A0A6Z5B6	Enterobacter_phage	75.4	1.4e-24
WP_096043079.1|2982235_2982595_-	hypothetical protein	NA	NA	NA	NA	NA
WP_096043078.1|2982591_2983035_-	recombination protein NinB	NA	A0A1P8DTD8	Proteus_phage	90.4	7.9e-32
WP_063073731.1|2983383_2983677_-	hypothetical protein	NA	A6N3G8	Burkholderia_virus	56.9	1.5e-18
WP_081213868.1|2983690_2984026_-	hypothetical protein	NA	A0A1C9LVV9	Vibrio_phage	39.9	3.2e-25
WP_060556819.1|2984045_2984957_-	recombination-associated protein RdgC	NA	S4TWL4	Salmonella_phage	60.9	2.2e-97
WP_060556820.1|2984967_2985654_-	DNA replication protein	NA	A0A1P8DTF3	Proteus_phage	87.7	4.7e-108
WP_096043076.1|2985650_2986589_-	replication protein	NA	A0A1P8DTG2	Proteus_phage	52.6	1.8e-81
WP_096043075.1|2986585_2987269_-	phage antirepressor KilAC domain-containing protein	NA	A0A1P8DTE1	Proteus_phage	94.7	2.0e-114
WP_063073726.1|2987290_2987623_-	transcriptional regulator	NA	A0A1P8DTF0	Proteus_phage	99.1	3.5e-53
WP_063693416.1|2987825_2988053_-	helix-turn-helix domain-containing protein	NA	K7PHA1	Enterobacteria_phage	68.0	4.9e-22
WP_063693278.1|2988161_2988860_+	helix-turn-helix transcriptional regulator	NA	G8C7L8	Escherichia_phage	48.6	5.4e-43
WP_063073724.1|2989189_2990014_+	NYN domain-containing protein	NA	A4JWQ6	Burkholderia_virus	41.0	9.5e-39
WP_166465078.1|2990340_2990913_+	HNH endonuclease	NA	C4ML07	Xanthomonas_virus	37.5	8.1e-21
WP_147383756.1|2990928_2991417_-	hypothetical protein	NA	NA	NA	NA	NA
WP_063073722.1|2991609_2991798_+	hypothetical protein	NA	A0A068C8G2	Acinetobacter_phage	50.9	3.7e-07
WP_063073721.1|2991869_2992103_+	hypothetical protein	NA	A0A1B0V7L5	Salmonella_phage	54.5	8.9e-11
WP_156868288.1|2992230_2993127_+	cell envelope biogenesis protein TolA	NA	A0A2I7QK72	Vibrio_phage	45.8	3.2e-16
WP_166465079.1|2993182_2993338_+	hypothetical protein	NA	NA	NA	NA	NA
WP_063073719.1|2993345_2993600_+	hypothetical protein	NA	NA	NA	NA	NA
WP_049199148.1|2993596_2993818_+	hypothetical protein	NA	NA	NA	NA	NA
WP_096043073.1|2993814_2994741_+	recombinase RecT	NA	F1C5B8	Cronobacter_phage	66.6	1.2e-109
WP_049206325.1|2994780_2995401_+	hypothetical protein	NA	A0A068CBG2	Acinetobacter_phage	45.9	1.2e-25
WP_096043072.1|2995393_2996095_+	YqaJ viral recombinase family protein	NA	A0A2R2Z325	Escherichia_phage	58.1	8.0e-71
WP_156868287.1|2996084_2996633_+	single-stranded DNA-binding protein	NA	A0A0A0P1Q9	Enterobacteria_phage	78.7	3.4e-53
WP_049212213.1|2996648_2996987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_036932464.1|2997020_2997347_+	hypothetical protein	NA	NA	NA	NA	NA
WP_060558090.1|2997382_2997670_+	hypothetical protein	NA	A0A1B0UY37	Roseobacter_phage	41.9	5.3e-13
WP_156868286.1|2997669_2998023_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174694362.1|2998180_2998354_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174694363.1|2998346_2998688_+	DUF2591 domain-containing protein	NA	E9NID9	Enterobacter_phage	38.8	4.4e-14
WP_156868285.1|2998674_2999277_+	DNA methyltransferase	NA	G8C7S6	Escherichia_phage	57.1	2.1e-59
WP_156868284.1|2999712_3000870_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A0M4R586	Salmonella_phage	75.4	8.0e-177
WP_017627899.1|3001158_3002031_+	bifunctional methylenetetrahydrofolate dehydrogenase/methenyltetrahydrofolate cyclohydrolase FolD	NA	A0A249XZQ2	Enterococcus_phage	36.8	9.7e-34
3000890:3000936	attR	AATGGTACGCCCTACAGGATTCGAACCTGTGACCTACGGCTTAGAAG	NA	NA	NA	NA
>prophage 9
NZ_CP045257	Proteus mirabilis strain L90-1 chromosome, complete genome	4218783	3273160	3282004	4218783		Caulobacter_phage(50.0%)	9	NA	NA
WP_004245601.1|3273160_3274729_-	methyl-accepting chemotaxis protein	NA	A0A2H4J162	uncultured_Caudovirales_phage	33.7	7.2e-11
WP_012368337.1|3275129_3275810_+	HAD-IB family hydrolase	NA	NA	NA	NA	NA
WP_004245603.1|3275906_3276482_-	TerD family protein	NA	K4JRX3	Caulobacter_phage	40.3	1.2e-27
WP_004249446.1|3276558_3277137_-	tellurium resistance membrane protein TerD	NA	K4JRX3	Caulobacter_phage	41.5	2.4e-33
WP_004245605.1|3277204_3278230_-	TerC/Alx family metal homeostasis membrane protein	NA	K7QKE8	Escherichia_phage	47.9	1.3e-74
WP_004245607.1|3278264_3278720_-	tellurite resistance TerB family protein	NA	NA	NA	NA	NA
WP_017628547.1|3278744_3279881_-	TerD family protein	NA	NA	NA	NA	NA
WP_004250201.1|3279881_3280466_-	tellurium resistance-associated protein TerZ	NA	K4JRX3	Caulobacter_phage	30.2	4.2e-17
WP_017628546.1|3280858_3282004_+	phosphoribosyltransferase domain-containing protein	NA	A0A172Q0Y1	Acinetobacter_phage	27.2	4.5e-31
>prophage 10
NZ_CP045257	Proteus mirabilis strain L90-1 chromosome, complete genome	4218783	3371548	3409926	4218783	integrase,protease,transposase,holin	Salmonella_phage(25.0%)	35	3363075:3363089	3411974:3411988
3363075:3363089	attL	GTCATGGCTTTTGAT	NA	NA	NA	NA
WP_109880364.1|3371548_3373579_-|protease	protease Lon-related BREX system protein BrxL	protease	NA	NA	NA	NA
WP_060554886.1|3373801_3376471_-	BREX-1 system phosphatase PglZ type A	NA	NA	NA	NA	NA
WP_060554887.1|3376470_3380088_-	BREX-1 system adenine-specific DNA-methyltransferase PglX	NA	NA	NA	NA	NA
WP_060554888.1|3380244_3383922_-	BREX system P-loop protein BrxC	NA	NA	NA	NA	NA
WP_004249341.1|3383940_3384525_-	DUF1788 domain-containing protein	NA	NA	NA	NA	NA
WP_049194747.1|3384521_3385121_-	DUF1819 family protein	NA	NA	NA	NA	NA
WP_156868342.1|3385130_3386057_-	WYL domain-containing protein	NA	NA	NA	NA	NA
WP_001339197.1|3386359_3387568_+|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_072156948.1|3387908_3388103_+|protease	omptin family outer membrane protease	protease	NA	NA	NA	NA
WP_001520030.1|3388207_3388927_-	hypothetical protein	NA	NA	NA	NA	NA
WP_049218683.1|3389027_3389321_-	YqjK-like family protein	NA	NA	NA	NA	NA
WP_049218680.1|3389998_3391198_-	lipoprotein-releasing ABC transporter permease subunit LolC	NA	NA	NA	NA	NA
WP_049218678.1|3391499_3391901_+	PPC domain-containing protein	NA	NA	NA	NA	NA
WP_060555124.1|3392317_3392719_-|holin	phage holin family protein	holin	NA	NA	NA	NA
WP_060555123.1|3392800_3393154_-	hypothetical protein	NA	NA	NA	NA	NA
WP_060555122.1|3393225_3393474_-	DUF883 family protein	NA	NA	NA	NA	NA
WP_060555121.1|3393923_3394271_+	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
WP_060555120.1|3394270_3394570_+	XRE family transcriptional regulator	NA	NA	NA	NA	NA
WP_060555126.1|3394690_3394879_+	DUF5397 family protein	NA	NA	NA	NA	NA
WP_060555119.1|3394882_3395161_+	virulence factor	NA	NA	NA	NA	NA
WP_060555118.1|3395633_3397124_+	YadA-like family protein	NA	S4TRP0	Salmonella_phage	33.3	4.6e-07
WP_060555117.1|3397535_3397742_-	hypothetical protein	NA	NA	NA	NA	NA
WP_114141483.1|3397738_3398323_-	AAA family ATPase	NA	A0A222ZPP5	Mycobacterium_phage	30.1	9.5e-09
WP_060555115.1|3398829_3399348_-	ClbS/DfsB family four-helix bundle protein	NA	NA	NA	NA	NA
WP_109880811.1|3399774_3400425_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001520048.1|3400466_3400775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001339175.1|3401752_3402961_+|transposase	IS4-like element ISVsa5 family transposase	transposase	A0A0F7LAS3	uncultured_marine_virus	99.8	2.3e-235
WP_004249335.1|3403244_3404153_-	DNA polymerase III subunit epsilon	NA	A0A2H4P6W5	Pseudomonas_phage	27.5	2.8e-07
WP_156868445.1|3404641_3404794_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004249334.1|3404792_3405242_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	A0A218MND2	uncultured_virus	57.1	4.1e-36
WP_036973679.1|3405249_3406518_+	translesion error-prone DNA polymerase V subunit UmuC	NA	I6RSM4	Salmonella_phage	60.2	1.2e-141
WP_008305549.1|3406528_3406972_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000497807.1|3407436_3408411_+	ParM/StbA family protein	NA	NA	NA	NA	NA
WP_004249313.1|3408413_3408683_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004249312.1|3408684_3409926_+|integrase	integrase family protein	integrase	A0A291AWU1	Escherichia_phage	39.1	3.8e-76
3411974:3411988	attR	ATCAAAAGCCATGAC	NA	NA	NA	NA
>prophage 11
NZ_CP045257	Proteus mirabilis strain L90-1 chromosome, complete genome	4218783	3969800	4013452	4218783	transposase	Enterobacteria_phage(18.18%)	38	NA	NA
WP_063693206.1|3969800_3971009_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.3	3.4e-186
WP_053828396.1|3971031_3971448_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	60.6	1.1e-43
WP_004249011.1|3972268_3972787_+	Hcp family type VI secretion system effector	NA	NA	NA	NA	NA
WP_017628614.1|3972859_3975031_+	type VI secretion system tip protein VgrG	NA	NA	NA	NA	NA
WP_017628613.1|3976300_3979345_+	hypothetical protein	NA	NA	NA	NA	NA
WP_017628612.1|3979344_3980283_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004249835.1|3980275_3980545_+	PAAR domain-containing protein	NA	NA	NA	NA	NA
WP_017628611.1|3980736_3981660_+	hypothetical protein	NA	NA	NA	NA	NA
WP_012368584.1|3981749_3982427_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004249837.1|3982519_3984127_-	hypothetical protein	NA	NA	NA	NA	NA
WP_017628610.1|3984140_3986636_-	CS1-pili formation C-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_004246670.1|3986658_3987342_-	hypothetical protein	NA	NA	NA	NA	NA
WP_004246669.1|3987431_3988055_-	common pilus major fimbrillin subunit EcpA	NA	NA	NA	NA	NA
WP_004246668.1|3988194_3988515_-	helix-turn-helix transcriptional regulator	NA	NA	NA	NA	NA
WP_017628609.1|3989562_3990597_-	virulence RhuM family protein	NA	Q9JMN3	Wolbachia_phage	41.3	7.4e-65
WP_001274561.1|3991139_3991985_-	DUF4942 domain-containing protein	NA	NA	NA	NA	NA
WP_060589331.1|3992069_3992357_-	DUF957 domain-containing protein	NA	NA	NA	NA	NA
WP_000761716.1|3992286_3992775_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001094437.1|3992771_3993149_-	toxin	NA	NA	NA	NA	NA
WP_001390338.1|3993195_3993573_-	type IV toxin-antitoxin system YeeU family antitoxin	NA	NA	NA	NA	NA
WP_000692345.1|3993735_3993957_-	DUF987 domain-containing protein	NA	A0A142F0X9	Klebsiella_phage	45.8	1.9e-10
WP_001535682.1|3994019_3994496_-	RadC family protein	NA	NA	NA	NA	NA
WP_000855064.1|3994511_3994985_-	antirestriction protein	NA	A9J566	Pseudomonas_phage	29.6	3.3e-12
WP_001535681.1|3995326_3996145_-	DUF945 domain-containing protein	NA	A0A2C9CX26	Yersinia_phage	39.7	3.6e-46
WP_001323397.1|3996299_3996458_-	DUF905 family protein	NA	NA	NA	NA	NA
WP_000820574.1|3996528_3999375_-	autotransporter adhesin Ag43	NA	NA	NA	NA	NA
WP_001069760.1|3999747_4000620_-	GTPase family protein	NA	NA	NA	NA	NA
WP_000241617.1|4000718_4001591_-	hypothetical protein	NA	NA	NA	NA	NA
WP_164076301.1|4003005_4004218_+|transposase	IS3 family transposase	transposase	Q6H9S3	Enterobacteria_phage	99.3	1.9e-168
WP_001387788.1|4005491_4006094_-	hypothetical protein	NA	NA	NA	NA	NA
WP_072153745.1|4006188_4006467_-	AlpA family transcriptional regulator	NA	NA	NA	NA	NA
WP_000148641.1|4008057_4008627_+	inovirus Gp2 family protein	NA	NA	NA	NA	NA
WP_000271020.1|4008792_4009176_+	hypothetical protein	NA	NA	NA	NA	NA
WP_032181455.1|4009172_4009598_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080195.1|4010077_4011691_-|transposase	IS66-like element ISEc23 family transposase	transposase	A0A0P0ZEB3	Stx2-converting_phage	63.6	3.0e-182
WP_000624711.1|4011721_4012072_-	IS66 family insertion sequence element accessory protein TnpB	NA	A0A0P0ZBY2	Stx2-converting_phage	65.5	4.0e-39
WP_000981822.1|4012068_4012473_-|transposase	transposase	transposase	Q6H9S5	Enterobacteria_phage	84.3	1.4e-30
WP_096043063.1|4012435_4013452_+|transposase	IS5-like element IS5 family transposase	transposase	Q38213	Escherichia_phage	99.1	7.0e-185
>prophage 12
NZ_CP045257	Proteus mirabilis strain L90-1 chromosome, complete genome	4218783	4018596	4058425	4218783	integrase,transposase	Escherichia_phage(30.77%)	37	4015610:4015623	4062223:4062236
4015610:4015623	attL	ATTATCGCTTTACC	NA	NA	NA	NA
WP_001067855.1|4018596_4019301_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000027057.1|4019885_4020746_+	class A broad-spectrum beta-lactamase TEM-1	NA	Q1MVP3	Enterobacteria_phage	100.0	4.6e-161
WP_001067855.1|4021343_4022048_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000018329.1|4022237_4023053_-	aminoglycoside O-phosphotransferase APH(3')-Ia	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	100.0	6.1e-163
WP_001067855.1|4023203_4023908_+|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_000240536.1|4024663_4025515_+	replication protein	NA	NA	NA	NA	NA
WP_001043265.1|4025822_4026638_+	sulfonamide-resistant dihydropteroate synthase Sul2	NA	NA	NA	NA	NA
WP_096043062.1|4026698_4027502_+	aminoglycoside O-phosphotransferase APH(3'')-Ib	NA	A0A193DTG4	Autographa_californica_nuclear_polyhedrosis_virus	28.7	1.6e-14
WP_000480968.1|4027501_4028338_+	aminoglycoside O-phosphotransferase APH(6)-Id	NA	NA	NA	NA	NA
WP_028697649.1|4028444_4028921_+	TnpR	NA	NA	NA	NA	NA
WP_001339197.1|4028982_4030191_-|transposase	IS4-like element ISVsa5 family transposase	transposase	Q9E8P4	Bluetongue_virus	100.0	3.0e-235
WP_000557454.1|4031405_4032266_+	aminoglycoside N-acetyltransferase AAC(3)-IId	NA	NA	NA	NA	NA
WP_000587837.1|4032278_4032821_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_000951934.1|4033302_4033494_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000248278.1|4033517_4033745_+	hypothetical protein	NA	NA	NA	NA	NA
WP_000080860.1|4033795_4034932_+	DUF3883 domain-containing protein	NA	NA	NA	NA	NA
WP_000179844.1|4037476_4039156_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001381192.1|4039158_4040151_+	TniB family NTP-binding protein	NA	NA	NA	NA	NA
WP_000376623.1|4040119_4040620_-	GNAT family N-acetyltransferase	NA	NA	NA	NA	NA
WP_000259031.1|4040747_4041587_-	sulfonamide-resistant dihydropteroate synthase Sul1	NA	NA	NA	NA	NA
WP_000679427.1|4041580_4041928_-	quaternary ammonium compound efflux SMR transporter QacE delta 1	NA	NA	NA	NA	NA
WP_000503573.1|4042133_4042922_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA5	NA	NA	NA	NA	NA
WP_001389366.1|4043052_4043526_-	trimethoprim-resistant dihydrofolate reductase DfrA17	NA	A0A1B2IBQ4	Erwinia_phage	33.1	7.6e-17
WP_000845048.1|4043683_4044697_+|integrase	class 1 integron integrase IntI1	integrase	A0A1P8DJJ6	Virus_Rctr41k	45.5	1.0e-71
WP_000454193.1|4044899_4045250_+	DUF3330 domain-containing protein	NA	NA	NA	NA	NA
WP_001067855.1|4045680_4046385_-|transposase	IS6-like element IS26 family transposase	transposase	A0A077SL39	Escherichia_phage	100.0	1.8e-139
WP_001300294.1|4047774_4048443_-	EAL domain-containing protein	NA	NA	NA	NA	NA
WP_000993386.1|4048478_4048715_-	broad-spectrum mercury transporter MerE	NA	NA	NA	NA	NA
WP_001277456.1|4048711_4049074_-	mercury resistance co-regulator MerD	NA	NA	NA	NA	NA
WP_000105636.1|4049091_4050786_-	mercury(II) reductase	NA	A0A2K5B2C5	Erysipelothrix_phage	27.6	8.8e-39
WP_001340589.1|4050837_4051260_-	organomercurial transporter MerC	NA	NA	NA	NA	NA
WP_000732292.1|4051295_4051571_-	mercury resistance system periplasmic binding protein MerP	NA	NA	NA	NA	NA
WP_001294663.1|4051584_4051935_-	mercuric transport protein MerT	NA	NA	NA	NA	NA
WP_000429836.1|4052006_4052441_+	Hg(II)-responsive transcriptional regulator	NA	NA	NA	NA	NA
WP_169774393.1|4054409_4055213_+|transposase	IS5 family transposase	transposase	A0A0M5M147	Mycobacterium_phage	38.6	4.4e-33
WP_119563495.1|4055442_4056396_+	glycosyltransferase family 4 protein	NA	NA	NA	NA	NA
WP_001218908.1|4057240_4058425_-|integrase	tyrosine-type recombinase/integrase	integrase	Q7M297	Enterobacteria_phage	69.9	3.4e-162
4062223:4062236	attR	GGTAAAGCGATAAT	NA	NA	NA	NA
>prophage 13
NZ_CP045257	Proteus mirabilis strain L90-1 chromosome, complete genome	4218783	4089472	4146296	4218783	tRNA,integrase,transposase	Helicobacter_phage(15.38%)	47	4112788:4112802	4150622:4150636
WP_004246627.1|4089472_4090501_+|tRNA	tryptophan--tRNA ligase	tRNA	NA	NA	NA	NA
WP_036895833.1|4091770_4092187_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.0	7.6e-45
WP_012368600.1|4092274_4092949_-	6-N-hydroxylaminopurine resistance protein	NA	NA	NA	NA	NA
WP_004249861.1|4093066_4093690_-	superoxide dismutase [Mn]	NA	Q56AR7	Bacillus_thuringiensis_phage	58.5	6.4e-64
WP_004249862.1|4094057_4096016_+	acetate--CoA ligase	NA	A0A2H4PQU7	Staphylococcus_phage	39.1	3.7e-89
WP_004246621.1|4096180_4096492_+	DUF485 domain-containing protein	NA	NA	NA	NA	NA
WP_004246620.1|4096488_4098144_+	cation acetate symporter	NA	NA	NA	NA	NA
WP_017628600.1|4098466_4100098_+	phosphoethanolamine transferase	NA	NA	NA	NA	NA
WP_063693479.1|4100137_4101346_-|transposase	IS200/IS605 family element transposase accessory protein TnpB	transposase	A0A1B0VCD8	Salmonella_phage	80.8	6.2e-188
WP_017628598.1|4101417_4101786_+|transposase	IS200/IS605 family transposase	transposase	A0A1S5RHE3	Helicobacter_phage	62.8	4.2e-39
WP_012368603.1|4101872_4102565_-	lactate utilization protein C	NA	NA	NA	NA	NA
WP_017628597.1|4102568_4103987_-	iron-sulfur cluster-binding protein	NA	NA	NA	NA	NA
WP_017628596.1|4103977_4104715_-	(Fe-S)-binding protein	NA	NA	NA	NA	NA
WP_004249867.1|4110614_4111301_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_012368605.1|4111381_4112779_+	multidrug transporter subunit MdtD	NA	NA	NA	NA	NA
4112788:4112802	attL	GATATAAAAATAAAA	NA	NA	NA	NA
WP_004246607.1|4112860_4113787_-	ribokinase	NA	NA	NA	NA	NA
WP_017628746.1|4114067_4115567_+	ATPase RavA	NA	A0A0N9PBE1	Sulfolobus_monocaudavirus	38.0	3.0e-22
WP_004246605.1|4115574_4117032_+	ATPase RavA stimulator ViaA	NA	NA	NA	NA	NA
WP_004246604.1|4117032_4118025_-	aspartate--ammonia ligase	NA	A0A1C9C5F0	Heterosigma_akashiwo_virus	37.5	1.3e-50
WP_004246603.1|4118185_4118647_+	transcriptional regulator AsnC	NA	NA	NA	NA	NA
WP_004249871.1|4118746_4119187_+	FMN-binding protein MioC	NA	NA	NA	NA	NA
WP_017628745.1|4119566_4121465_+|tRNA	tRNA uridine-5-carboxymethylaminomethyl(34) synthesis enzyme MnmG	tRNA	NA	NA	NA	NA
WP_004246599.1|4121461_4122088_+	16S rRNA (guanine(527)-N(7))-methyltransferase RsmG	NA	NA	NA	NA	NA
WP_004246598.1|4122703_4123081_+	F0F1 ATP synthase subunit I	NA	NA	NA	NA	NA
WP_004246597.1|4123112_4123937_+	F0F1 ATP synthase subunit A	NA	NA	NA	NA	NA
WP_004246596.1|4123982_4124222_+	F0F1 ATP synthase subunit C	NA	NA	NA	NA	NA
WP_004246595.1|4124283_4124754_+	F0F1 ATP synthase subunit B	NA	NA	NA	NA	NA
WP_004246594.1|4124766_4125300_+	F0F1 ATP synthase subunit delta	NA	NA	NA	NA	NA
WP_004246592.1|4125314_4126856_+	F0F1 ATP synthase subunit alpha	NA	NA	NA	NA	NA
WP_004246591.1|4126913_4127777_+	F0F1 ATP synthase subunit gamma	NA	NA	NA	NA	NA
WP_004246589.1|4127811_4129194_+	F0F1 ATP synthase subunit beta	NA	NA	NA	NA	NA
WP_004246588.1|4129215_4129632_+	F0F1 ATP synthase subunit epsilon	NA	NA	NA	NA	NA
WP_004246587.1|4129782_4131156_+	bifunctional UDP-N-acetylglucosamine diphosphorylase/glucosamine-1-phosphate N-acetyltransferase GlmU	NA	A0A0N7G7P8	Chrysochromulina_ericina_virus	32.3	9.6e-28
WP_004246586.1|4131313_4133140_+	glutamine--fructose-6-phosphate transaminase (isomerizing)	NA	M1I9J5	Paramecium_bursaria_Chlorella_virus	44.6	1.2e-131
WP_001029679.1|4133299_4134121_+	TnsA endonuclease N-terminal domain-containing protein	NA	NA	NA	NA	NA
WP_000267723.1|4134107_4136216_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	NA	NA	NA	NA
WP_001276994.1|4136212_4137880_+	AAA family ATPase	NA	NA	NA	NA	NA
WP_001243518.1|4137882_4139409_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_000251879.1|4139409_4141026_+|transposase	transposase	transposase	NA	NA	NA	NA
WP_001271300.1|4141256_4141634_-	hypothetical protein	NA	NA	NA	NA	NA
WP_000119696.1|4142043_4142415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001444089.1|4142475_4142973_-	hypothetical protein	NA	NA	NA	NA	NA
WP_001206315.1|4143048_4143837_-	ANT(3'')-Ia family aminoglycoside nucleotidyltransferase AadA1	NA	NA	NA	NA	NA
WP_000704156.1|4143894_4144419_-	streptothricin N-acetyltransferase Sat2	NA	E4ZFP7	Streptococcus_phage	38.9	4.2e-16
WP_000777554.1|4144513_4144987_-	trimethoprim-resistant dihydrofolate reductase DfrA1	NA	A0A140HLG8	Bacillus_phage	34.4	1.6e-19
WP_000071896.1|4145318_4145855_+|integrase	class 2 integron integrase IntI2	integrase	A0A1P8DJJ6	Virus_Rctr41k	34.4	6.9e-14
WP_000497519.1|4145969_4146296_+|integrase	tyrosine-type recombinase/integrase	integrase	A0A1P8DJJ6	Virus_Rctr41k	52.0	2.1e-18
4150622:4150636	attR	GATATAAAAATAAAA	NA	NA	NA	NA
