The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP050329	Pseudomonas aeruginosa strain DVT417 chromosome, complete genome	6298009	635897	688676	6298009	plate,tail,tRNA	uncultured_Caudovirales_phage(28.0%)	55	NA	NA
WP_174817742.1|635897_636923_+|tRNA	tRNA (adenosine(37)-N6)-threonylcarbamoyltransferase complex transferase subunit TsaD	tRNA	A0A0R6PI74	Moraxella_phage	57.8	3.1e-108
WP_003085061.1|637001_637571_-	glycerol-3-phosphate 1-O-acyltransferase PlsY	NA	NA	NA	NA	NA
WP_003099587.1|637654_638008_+	dihydroneopterin aldolase	NA	NA	NA	NA	NA
WP_003099585.1|637998_638541_+	2-amino-4-hydroxy-6- hydroxymethyldihydropteridine diphosphokinase	NA	NA	NA	NA	NA
WP_016252918.1|638513_639746_-	multifunctional CCA addition/repair protein	NA	A0A076G5T8	Escherichia_phage	43.1	2.6e-77
WP_016252919.1|639789_640296_-	DUF4136 domain-containing protein	NA	NA	NA	NA	NA
WP_003099581.1|640389_641943_-	SpoVR family protein	NA	NA	NA	NA	NA
WP_003099579.1|641939_643211_-	YeaH/YhbH family protein	NA	A0A140HLI1	Bacillus_phage	37.2	4.2e-09
WP_174817743.1|643311_645234_-	PrkA family serine protein kinase	NA	NA	NA	NA	NA
WP_003099577.1|645511_645844_-	thiosulfate sulfurtransferase GlpE	NA	NA	NA	NA	NA
WP_003113213.1|645887_646739_-	symmetrical bis(5'-nucleosyl)-tetraphosphatase	NA	A0A2H4J0P0	uncultured_Caudovirales_phage	33.3	1.1e-08
WP_003085085.1|646738_647119_-	Co2+/Mg2+ efflux protein ApaG	NA	NA	NA	NA	NA
WP_003099569.1|647155_647962_-	16S rRNA (adenine(1518)-N(6)/adenine(1519)-N(6))- dimethyltransferase RsmA	NA	NA	NA	NA	NA
WP_003117956.1|648077_649064_-	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_003109024.1|649060_650353_-	peptidyl-prolyl cis-trans isomerase	NA	NA	NA	NA	NA
WP_174817744.1|650333_653123_-	LPS-assembly protein LptD	NA	NA	NA	NA	NA
WP_003099554.1|653249_654266_+	phosphotransferase	NA	NA	NA	NA	NA
WP_003099549.1|654262_654937_+	nucleotidyltransferase family protein	NA	NA	NA	NA	NA
WP_003099547.1|654938_655697_+	DnaJ domain-containing protein	NA	NA	NA	NA	NA
WP_012613533.1|655697_656759_-	alpha/beta hydrolase family protein	NA	NA	NA	NA	NA
WP_009875783.1|656910_659304_+	PAS domain S-box protein	NA	NA	NA	NA	NA
WP_003085103.1|659349_659982_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003085106.1|660110_661145_+	polyamine ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003085109.1|661379_662489_+	polyamine ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	34.4	7.8e-28
WP_003099539.1|662544_663591_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003109044.1|663705_664953_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_034014732.1|665058_665889_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_003085122.1|666012_666687_+	ribulose-phosphate 3-epimerase	NA	NA	NA	NA	NA
WP_003099532.1|666686_667505_+	phosphoglycolate phosphatase	NA	NA	NA	NA	NA
WP_174817745.1|667577_669056_+	anthranilate synthase component I	NA	NA	NA	NA	NA
WP_003113203.1|669372_669687_-	transcription regulatory protein PrtN	NA	NA	NA	NA	NA
WP_003113202.1|669786_670557_-	helix-turn-helix transcriptional regulator	NA	A0A1B0Z078	Pseudomonas_phage	59.1	1.4e-71
WP_003085132.1|671014_671215_+	repressor PtrB	NA	W6ATC1	Enterobacter_phage	58.3	3.7e-05
WP_003118907.1|671262_671622_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003118908.1|671984_672434_+	hypothetical protein	NA	B5TK61	Pseudomonas_phage	53.3	5.0e-26
WP_003113200.1|672455_672971_+	hypothetical protein	NA	A0A2H4J881	uncultured_Caudovirales_phage	42.9	4.1e-32
WP_003121844.1|672967_673525_+|plate	phage baseplate assembly protein V	plate	A0A2H4JG06	uncultured_Caudovirales_phage	70.3	6.0e-45
WP_003085143.1|673677_674004_+	GPW/gp25 family protein	NA	A0A2H4JA09	uncultured_Caudovirales_phage	60.2	3.2e-30
WP_003161928.1|674000_674888_+	bacteriophage protein	NA	S4TNY7	Salmonella_phage	59.8	4.1e-88
WP_003118911.1|674880_675414_+|tail	phage tail protein I	tail	Q9ZXK7	Pseudomonas_virus	64.6	3.9e-62
WP_174817746.1|675415_677521_+|tail	phage tail protein	tail	Q9ZXK6	Pseudomonas_virus	52.6	1.5e-221
WP_016852415.1|677528_677969_+	hypothetical protein	NA	NA	NA	NA	NA
WP_003121848.1|678011_679172_+|tail	phage tail sheath family protein	tail	Q38068	Phage_PS17	83.4	1.2e-188
WP_003085175.1|679184_679688_+|tail	phage major tail tube protein	tail	Q7M2A5	Pseudomonas_phage	73.5	8.0e-65
WP_003085178.1|679702_680047_+|tail	phage tail assembly protein	tail	NA	NA	NA	NA
WP_023083951.1|680216_682454_+|tail	phage tail length determinator protein	tail	NA	NA	NA	NA
WP_003085182.1|682463_683336_+|tail	phage tail protein	tail	A0A2H4J875	uncultured_Caudovirales_phage	51.7	3.9e-75
WP_003101635.1|683310_683517_+|tail	tail protein X	tail	A0A2H4J9Z9	uncultured_Caudovirales_phage	64.2	2.3e-18
WP_174817747.1|683574_684564_+	phage late control D family protein	NA	A0A2H4JBF6	uncultured_Caudovirales_phage	56.1	2.6e-107
WP_003113192.1|684596_685226_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	78.0	1.6e-86
WP_003121852.1|685222_685585_+	hypothetical protein	NA	H2BDA0	Pseudomonas_phage	47.9	4.2e-15
WP_003118919.1|685581_685839_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	64.6	8.3e-18
WP_003117978.1|686186_686792_+	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	66.3	2.1e-75
WP_003085203.1|686793_687843_+	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	57.8	1.8e-111
WP_003085205.1|687839_688676_+	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	56.9	2.1e-70
>prophage 2
NZ_CP050329	Pseudomonas aeruginosa strain DVT417 chromosome, complete genome	6298009	1440282	1449311	6298009		Bacillus_phage(33.33%)	8	NA	NA
WP_003098558.1|1440282_1440918_+	protein-L-isoaspartate(D-aspartate) O-methyltransferase	NA	A0A1B1IU40	uncultured_Mediterranean_phage	52.3	1.0e-40
WP_003143263.1|1440963_1441857_+	peptidoglycan DD-metalloendopeptidase family protein	NA	A0A0S2SXL7	Bacillus_phage	34.3	3.0e-06
WP_003113871.1|1441961_1442966_+	RNA polymerase sigma factor RpoS	NA	G8CLC7	Synechococcus_phage	37.3	7.0e-36
WP_003119354.1|1443392_1443716_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_174817771.1|1443782_1446350_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.1	3.2e-24
WP_003098486.1|1446475_1447483_-	TolB family protein	NA	NA	NA	NA	NA
WP_003092262.1|1447630_1448137_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	76.0	8.1e-57
WP_003092260.1|1448270_1449311_+	recombinase RecA	NA	A0A0S2MVG1	Bacillus_phage	59.5	1.5e-113
>prophage 3
NZ_CP050329	Pseudomonas aeruginosa strain DVT417 chromosome, complete genome	6298009	2545138	2605209	6298009	integrase,terminase,tail,tRNA	Pseudomonas_phage(64.52%)	78	2547643:2547659	2566585:2566601
WP_003097631.1|2545138_2546419_+|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	45.4	8.2e-98
WP_023109951.1|2546420_2547818_+	uroporphyrinogen-III C-methyltransferase	NA	NA	NA	NA	NA
2547643:2547659	attL	CGCTGATCCAGCAGGGG	NA	NA	NA	NA
WP_003097628.1|2547822_2548797_-	glutathione S-transferase family protein	NA	NA	NA	NA	NA
WP_003097625.1|2548884_2549868_-	glycosyl transferase family protein	NA	A0A2H4JBY5	uncultured_Caudovirales_phage	74.0	3.5e-141
WP_003119979.1|2549864_2550200_-	TusE/DsrC/DsvC family sulfur relay protein	NA	A0A2H4J8B6	uncultured_Caudovirales_phage	69.4	1.5e-38
WP_003090391.1|2550196_2550502_-	sulfurtransferase complex subunit TusB	NA	NA	NA	NA	NA
WP_003090389.1|2550501_2550861_-	sulfurtransferase complex subunit TusC	NA	A0A2H4J8C0	uncultured_Caudovirales_phage	61.7	1.4e-34
WP_003090387.1|2550857_2551253_-	sulfurtransferase complex subunit TusD	NA	A0A2H4JA39	uncultured_Caudovirales_phage	72.1	2.7e-47
WP_003090386.1|2551363_2552032_-	Bax inhibitor-1/YccA family protein	NA	A0A2H4JFM9	uncultured_Caudovirales_phage	82.1	1.5e-90
WP_022579945.1|2552367_2553435_-|integrase	tyrosine-type recombinase/integrase	integrase	A0A2H4JDJ8	uncultured_Caudovirales_phage	68.7	6.3e-136
WP_003116724.1|2553436_2553673_-	DUF4224 domain-containing protein	NA	A0A2H4JF29	uncultured_Caudovirales_phage	53.2	3.8e-17
WP_046638871.1|2555039_2556806_-	DEAD/DEAH box helicase	NA	A0A0U1UNQ7	Pseudomonas_phage	99.3	0.0e+00
WP_046638872.1|2556802_2557183_-	hypothetical protein	NA	A0A0U1UNQ6	Pseudomonas_phage	97.6	1.5e-63
WP_046638873.1|2557179_2557500_-	DUF4406 domain-containing protein	NA	H2BD42	Pseudomonas_phage	100.0	4.3e-56
WP_079452798.1|2557827_2558634_+	putative phage abortive infection protein	NA	NA	NA	NA	NA
WP_124171382.1|2558925_2559252_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046638874.1|2559419_2561165_-	AAA family ATPase	NA	H2BD46	Pseudomonas_phage	93.8	3.1e-297
WP_003116739.1|2562110_2562311_-	hypothetical protein	NA	H2BD48	Pseudomonas_phage	100.0	4.3e-30
WP_014602814.1|2562317_2563217_-	recombination protein RecT	NA	Q858E1	Salmonella_phage	73.6	3.2e-104
WP_046638876.1|2563229_2564138_-	YqaJ viral recombinase family protein	NA	Q858E0	Salmonella_phage	71.6	1.1e-123
WP_023113718.1|2564204_2564489_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023113719.1|2564475_2564616_-	hypothetical protein	NA	J7I432	Pseudomonas_phage	70.0	4.0e-06
WP_029528657.1|2564612_2564852_-	hypothetical protein	NA	NA	NA	NA	NA
WP_014602817.1|2564844_2565027_-	hypothetical protein	NA	Q9MC67	Pseudomonas_phage	100.0	1.7e-25
WP_174817828.1|2565023_2565173_-	hypothetical protein	NA	A0A2K8I9C2	Pseudomonas_phage	64.8	6.5e-15
WP_023104434.1|2565156_2565309_-	hypothetical protein	NA	J7HXJ0	Pseudomonas_phage	100.0	2.6e-11
WP_016263325.1|2565798_2566167_-	carbon storage regulator CsrA	NA	J7I430	Pseudomonas_phage	99.2	3.2e-63
WP_126545536.1|2568025_2568268_+	hypothetical protein	NA	NA	NA	NA	NA
2566585:2566601	attR	CCCCTGCTGGATCAGCG	NA	NA	NA	NA
WP_046638877.1|2568739_2569072_+	DUF1654 domain-containing protein	NA	H2BD60	Pseudomonas_phage	90.7	7.2e-46
WP_124131500.1|2569121_2569475_-	hypothetical protein	NA	NA	NA	NA	NA
WP_052174268.1|2569657_2570230_-	S24 family peptidase	NA	H2BD63	Pseudomonas_phage	90.0	1.4e-84
WP_003451709.1|2570607_2570826_+	helix-turn-helix domain-containing protein	NA	A0A2D1GND2	Pseudomonas_phage	64.7	2.9e-19
WP_023096627.1|2570857_2571430_+	hypothetical protein	NA	H2BD67	Pseudomonas_phage	99.5	1.2e-101
WP_079452800.1|2571432_2572446_+	hypothetical protein	NA	A0A2H4JCW9	uncultured_Caudovirales_phage	38.2	4.9e-13
WP_031757376.1|2572573_2572987_+	hypothetical protein	NA	NA	NA	NA	NA
WP_019396730.1|2572979_2573423_+	RusA family crossover junction endodeoxyribonuclease	NA	J7I4J7	Pseudomonas_phage	99.3	2.1e-77
WP_024928585.1|2573451_2574321_+	hypothetical protein	NA	J7HXH6	Pseudomonas_phage	85.8	3.0e-144
WP_033994418.1|2575190_2575370_-	type II toxin-antitoxin system HicA family toxin	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	56.7	1.9e-08
WP_046638879.1|2575454_2575763_+	hypothetical protein	NA	A0A125RNL3	Pseudomonas_phage	55.0	1.0e-17
WP_046638880.1|2575765_2576056_+	hypothetical protein	NA	A0A125RNL4	Pseudomonas_phage	57.3	6.5e-19
WP_058184512.1|2576119_2576569_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046638882.1|2576616_2577213_+|terminase	terminase small subunit	terminase	H2BD75	Pseudomonas_phage	63.3	1.1e-49
WP_046638883.1|2577199_2578495_+|terminase	terminase	terminase	A0A1B1P9C9	Acinetobacter_phage	59.5	6.3e-146
WP_046638884.1|2578497_2579853_+	DUF4055 domain-containing protein	NA	A0A0H5AWC7	Pseudomonas_phage	45.8	2.8e-96
WP_046638885.1|2579849_2580929_+	hypothetical protein	NA	A0A0S2SY77	Pseudomonas_phage	97.8	4.4e-201
WP_046638905.1|2581052_2581796_+	hypothetical protein	NA	A0A0H5AWD1	Pseudomonas_phage	75.0	6.5e-87
WP_046638886.1|2581805_2582777_+	hypothetical protein	NA	A0A0M3LQL5	Mannheimia_phage	65.0	1.1e-110
WP_046638887.1|2582818_2583304_+	hypothetical protein	NA	NA	NA	NA	NA
WP_016263346.1|2583287_2583752_+	hypothetical protein	NA	H9EB35	Vibrio_phage	36.6	5.2e-10
WP_019396738.1|2583751_2584141_+	hypothetical protein	NA	A0A2H4JAS3	uncultured_Caudovirales_phage	55.8	1.3e-33
WP_003451670.1|2584144_2584819_+	hypothetical protein	NA	A0A0S2SY81	Pseudomonas_phage	96.4	4.6e-116
WP_003451667.1|2584815_2585226_+	DUF4128 domain-containing protein	NA	A0A1B0VMI0	Pseudomonas_phage	43.4	2.5e-24
WP_012075337.1|2585293_2585947_+|tail	phage tail protein	tail	A0A2H4IZV5	uncultured_Caudovirales_phage	52.8	7.7e-60
WP_022579905.1|2585956_2586337_+|tail	phage tail assembly chaperone	tail	A0A1B0VMH4	Pseudomonas_phage	45.7	9.8e-23
WP_046638888.1|2586399_2586663_+	DUF1799 domain-containing protein	NA	A0A2R3UAE2	Siphoviridae_environmental_samples	46.0	2.1e-16
WP_046638889.1|2586659_2589851_+|tail	phage tail tape measure protein	tail	A0A2H4J9A1	uncultured_Caudovirales_phage	41.3	1.5e-156
WP_003160550.1|2589856_2590195_+|tail	phage tail protein	tail	A0A0S2SYI2	Pseudomonas_phage	97.3	5.8e-59
WP_003160549.1|2590191_2590941_+|tail	phage minor tail protein L	tail	A0A0S2SY57	Pseudomonas_phage	90.8	1.0e-132
WP_046638890.1|2590943_2591738_+	C40 family peptidase	NA	A0A0S2SY75	Pseudomonas_phage	98.8	2.0e-147
WP_046638891.1|2592159_2592408_+	hypothetical protein	NA	A0A0S2SYE8	Pseudomonas_phage	96.3	1.0e-36
WP_174817829.1|2592534_2592918_-	helix-turn-helix transcriptional regulator	NA	A0A2H4JA00	uncultured_Caudovirales_phage	55.9	6.1e-33
WP_046638906.1|2593354_2594236_+	phage antirepressor N-terminal domain-containing protein	NA	G9L6D8	Escherichia_phage	42.9	5.6e-37
WP_126545538.1|2594348_2594741_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023096645.1|2594790_2595402_+|tail	tail assembly protein	tail	A0A0S2SYS2	Pseudomonas_phage	83.3	2.0e-86
WP_023096646.1|2595728_2596229_+	KilA-N domain-containing protein	NA	A0A0H5ARR4	Pseudomonas_phage	58.8	1.2e-57
WP_046638892.1|2596287_2599950_+|tail	phage tail protein	tail	A0A0S2SYC5	Pseudomonas_phage	86.1	0.0e+00
WP_016252936.1|2599946_2600231_+	hypothetical protein	NA	NA	NA	NA	NA
WP_079452802.1|2600227_2600893_+	hypothetical protein	NA	A0A0S2SYG5	Pseudomonas_phage	44.0	1.7e-54
WP_046638893.1|2600911_2601682_+	hypothetical protein	NA	A0A0S2SY45	Pseudomonas_phage	84.1	1.2e-88
WP_046638894.1|2601681_2601984_+	hypothetical protein	NA	A0A0S2SY61	Pseudomonas_phage	88.0	3.0e-43
WP_033866006.1|2601980_2602220_+	hypothetical protein	NA	A0A0S2SY98	Pseudomonas_phage	96.2	4.1e-35
WP_046638895.1|2602280_2602910_+	glycoside hydrolase family 19 protein	NA	A0A125RNP1	Pseudomonas_phage	95.2	5.4e-111
WP_046638896.1|2602906_2603275_+	hypothetical protein	NA	H2BDD6	Pseudomonas_virus	90.2	8.5e-48
WP_046638897.1|2603271_2603535_+	hypothetical protein	NA	A0A125RNP3	Pseudomonas_phage	93.7	3.8e-34
WP_003160542.1|2603570_2603834_+	hypothetical protein	NA	Q9MC87	Pseudomonas_phage	94.3	9.0e-44
WP_021263881.1|2603938_2604427_+	hypothetical protein	NA	NA	NA	NA	NA
WP_004354886.1|2604423_2604669_+	hypothetical protein	NA	NA	NA	NA	NA
WP_046638898.1|2604693_2605209_-	hypothetical protein	NA	A0A2K8HVM8	Pseudomonas_phage	90.6	4.3e-90
>prophage 4
NZ_CP050329	Pseudomonas aeruginosa strain DVT417 chromosome, complete genome	6298009	2907685	2947027	6298009	plate,tail	Ralstonia_phage(50.0%)	32	NA	NA
WP_012614137.1|2907685_2908963_-|tail	pyoverdine-tailoring periplasmic protein PvdN	tail	NA	NA	NA	NA
WP_012614138.1|2908974_2910333_-|tail	pyoverdine-tailoring dipeptidase-like protein PvdM	tail	NA	NA	NA	NA
WP_031629095.1|2910547_2912185_+	pyoverdine maturation tyrosinase PvdP	NA	NA	NA	NA	NA
WP_003120134.1|2912233_2913658_-	pyoverdine export/recycling transporter outer membrane subunit OmpQ	NA	NA	NA	NA	NA
WP_003114507.1|2915653_2916829_-	pyoverdine export/recycling transporter periplasmic adaptor subunit PvdR	NA	NA	NA	NA	NA
WP_034011465.1|2916929_2917925_-	FecR family protein	NA	NA	NA	NA	NA
WP_003103620.1|2918088_2918568_+	sigma-70 family RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_174817842.1|2918700_2920032_+	lysine N(6)-hydroxylase/L-ornithine N(5)-oxygenase family protein	NA	NA	NA	NA	NA
WP_174817843.1|2920154_2922443_+	acylase	NA	NA	NA	NA	NA
WP_003089535.1|2922623_2922947_+	transcriptional repressor	NA	NA	NA	NA	NA
WP_003114511.1|2922988_2923909_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_046638646.1|2924005_2925157_+	alpha-hydroxy-acid oxidizing protein	NA	NA	NA	NA	NA
WP_003089526.1|2925223_2925466_-	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_003104944.1|2925760_2925997_+	hypothetical protein	NA	NA	NA	NA	NA
WP_023091315.1|2926263_2926734_+	(2Fe-2S)-binding protein	NA	NA	NA	NA	NA
WP_023091316.1|2926730_2929046_+	xanthine dehydrogenase family protein molybdopterin-binding subunit	NA	NA	NA	NA	NA
WP_016253419.1|2929462_2930668_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_003110901.1|2930868_2931510_-	response regulator transcription factor	NA	NA	NA	NA	NA
WP_003089513.1|2931786_2932182_+	DUF4280 domain-containing protein	NA	NA	NA	NA	NA
WP_003114514.1|2932204_2932741_-	toxin-antitoxin system YwqK family antitoxin	NA	NA	NA	NA	NA
WP_016253420.1|2932751_2934755_-	type VI secretion system tip protein VgrG	NA	A0A077K8Q4	Ralstonia_phage	29.8	1.2e-42
WP_003116945.1|2934761_2935547_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174817844.1|2935616_2936492_-	hypothetical protein	NA	NA	NA	NA	NA
WP_019371762.1|2936582_2939132_-	type VI secretion system ATPase TssH	NA	H6X3M6	Enterobacteria_phage	29.4	4.2e-77
WP_003114517.1|2939133_2940150_-|plate	type VI secretion system baseplate subunit TssG	plate	NA	NA	NA	NA
WP_012614149.1|2940113_2941907_-|plate	type VI secretion system baseplate subunit TssF	plate	NA	NA	NA	NA
WP_003122696.1|2941890_2942316_-|plate	type VI secretion system baseplate subunit TssE	plate	NA	NA	NA	NA
WP_003089495.1|2942328_2942826_-	type VI secretion system tube protein Hcp	NA	NA	NA	NA	NA
WP_003089494.1|2942899_2944384_-	type VI secretion system contractile sheath large subunit	NA	NA	NA	NA	NA
WP_174817845.1|2944406_2944952_-	type VI secretion system contractile sheath small subunit	NA	NA	NA	NA	NA
WP_003450945.1|2945159_2945636_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174817846.1|2945695_2947027_+|plate	type VI secretion system baseplate subunit TssK	plate	NA	NA	NA	NA
>prophage 5
NZ_CP050329	Pseudomonas aeruginosa strain DVT417 chromosome, complete genome	6298009	4748275	4756519	6298009	integrase,coat	Pseudomonas_phage(88.89%)	11	4746473:4746502	4757718:4757747
4746473:4746502	attL	AGGGTTCGATTCCCTTCGCCCGCTCCAGAT	NA	NA	NA	NA
WP_023116721.1|4748275_4749286_-|integrase	tyrosine-type recombinase/integrase	integrase	Q56VN7	Pseudomonas_phage	51.4	1.3e-90
WP_023116722.1|4749285_4750578_-	hypothetical protein	NA	Q56VN8	Pseudomonas_phage	93.5	7.0e-246
WP_046638578.1|4750807_4752082_-	hypothetical protein	NA	Q56VN9	Pseudomonas_phage	87.5	1.8e-198
WP_046638579.1|4752085_4752442_-	DUF2523 domain-containing protein	NA	Q56VP0	Pseudomonas_phage	99.2	8.8e-58
WP_046638580.1|4752446_4753727_-	hypothetical protein	NA	Q56VP1	Pseudomonas_phage	56.8	5.2e-52
WP_003125072.1|4753876_4754125_-|coat	phage coat protein B	coat	Q56VP2	Pseudomonas_phage	92.7	2.0e-32
WP_003115979.1|4754137_4754389_-	hypothetical protein	NA	NA	NA	NA	NA
WP_003140508.1|4754510_4754945_-	hypothetical protein	NA	Q56VP5	Pseudomonas_phage	100.0	3.8e-63
WP_046638583.1|4755460_4755748_-	DUF5447 family protein	NA	Q56VP7	Pseudomonas_phage	94.7	5.2e-53
WP_033993118.1|4755778_4755994_-	hypothetical protein	NA	NA	NA	NA	NA
WP_046638584.1|4756096_4756519_+	Arc family DNA-binding protein	NA	G9L6D6	Escherichia_phage	39.6	6.8e-09
4757718:4757747	attR	AGGGTTCGATTCCCTTCGCCCGCTCCAGAT	NA	NA	NA	NA
