The following contents displays predicted prophage regions
first line of each prophage describes the prophage information and the following lines describe the proteins and homology proteins in uniprot database
bacteria_id bac_def genome_size prophage_start  prophage_end    key_proteins    best_hit_species    CDS_number  attl_region attr_region
>prophage 1
NZ_CP054580	Halomonas titanicae strain GPM3 chromosome, complete genome	5695972	598137	606190	5695972		Enterobacteria_phage(33.33%)	8	NA	NA
WP_174788097.1|598137_599046_+	ABC transporter ATP-binding protein	NA	A0A2H4PQG7	Staphylococcus_phage	23.8	6.2e-07
WP_174788098.1|599104_600352_+	GDP-mannose 4,6-dehydratase	NA	I7HTA3	Enterobacteria_phage	46.3	2.5e-91
WP_174788099.1|600475_601390_+	dTDP-4-dehydrorhamnose reductase	NA	NA	NA	NA	NA
WP_174788100.1|601472_602387_+	glucose-1-phosphate thymidylyltransferase RfbA	NA	I7I009	Enterobacteria_phage	65.5	1.7e-105
WP_174788101.1|602455_603001_+	dTDP-4-dehydrorhamnose 3,5-epimerase	NA	A0A291LA62	Escherichia_phage	55.2	8.1e-55
WP_174788102.1|603170_603653_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174788103.1|603649_604765_+	UDP-N-acetylglucosamine 2-epimerase (non-hydrolyzing)	NA	A0A1V0SAG5	Catovirus	28.5	1.6e-25
WP_174788104.1|604909_606190_+	UDP-N-acetyl-D-mannosamine dehydrogenase	NA	M1HYW7	Paramecium_bursaria_Chlorella_virus	25.2	8.1e-21
>prophage 2
NZ_CP054580	Halomonas titanicae strain GPM3 chromosome, complete genome	5695972	2075496	2141514	5695972	portal,tail,tRNA,capsid,terminase,head	Halomonas_phage(15.62%)	76	NA	NA
WP_022522890.1|2075496_2076774_-|tRNA	serine--tRNA ligase	tRNA	A0A1B1IVT2	uncultured_Mediterranean_phage	44.1	1.8e-92
WP_022522889.1|2077193_2078441_+	dicarboxylate/amino acid:cation symporter	NA	NA	NA	NA	NA
WP_022522888.1|2078939_2079686_-	SDR family oxidoreductase	NA	NA	NA	NA	NA
WP_022522887.1|2079731_2081030_-	TRAP transporter large permease	NA	NA	NA	NA	NA
WP_053857032.1|2081026_2081539_-	TRAP transporter small permease subunit	NA	NA	NA	NA	NA
WP_022522886.1|2081595_2082621_-	TRAP transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_022522885.1|2083117_2084287_+	exo-alpha-sialidase	NA	NA	NA	NA	NA
WP_022522884.1|2084283_2085237_+	4-hydroxythreonine-4-phosphate dehydrogenase PdxA	NA	NA	NA	NA	NA
WP_022522883.1|2085233_2086154_+	dihydrodipicolinate synthase family protein	NA	NA	NA	NA	NA
WP_022522882.1|2086150_2087275_+	iron-containing alcohol dehydrogenase	NA	NA	NA	NA	NA
WP_022522881.1|2087392_2088442_+	four-carbon acid sugar kinase family protein	NA	NA	NA	NA	NA
WP_022522880.1|2088454_2089198_+	FadR family transcriptional regulator	NA	NA	NA	NA	NA
WP_022522879.1|2089484_2090075_+	DUF4202 domain-containing protein	NA	NA	NA	NA	NA
WP_022522878.1|2090177_2093384_+	FAD-binding oxidoreductase	NA	NA	NA	NA	NA
WP_022522877.1|2093489_2094551_+	efflux RND transporter periplasmic adaptor subunit	NA	NA	NA	NA	NA
WP_022522876.1|2094568_2097712_+	efflux RND transporter permease subunit	NA	NA	NA	NA	NA
WP_022522875.1|2097723_2098527_-	indole-3-glycerol phosphate synthase TrpC	NA	A0A0P0IR83	Acinetobacter_phage	50.8	6.4e-64
WP_022522874.1|2098536_2099556_-	anthranilate phosphoribosyltransferase	NA	A0A0N7IRD9	Acinetobacter_phage	55.8	3.0e-95
WP_174788157.1|2099593_2100226_-	aminodeoxychorismate/anthranilate synthase component II	NA	A0A0P0IKJ1	Acinetobacter_phage	57.7	1.6e-65
WP_174788158.1|2100532_2100907_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174788474.1|2101078_2101735_-	SOS response-associated peptidase	NA	A0A2H4J5W2	uncultured_Caudovirales_phage	35.2	1.7e-30
WP_174788159.1|2101864_2102095_+	DUF1654 domain-containing protein	NA	NA	NA	NA	NA
WP_174788475.1|2102097_2102541_+	translesion error-prone DNA polymerase V autoproteolytic subunit	NA	F1C5A6	Cronobacter_phage	43.8	1.3e-21
WP_174788160.1|2102537_2103812_+	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	40.2	7.0e-81
WP_174788161.1|2104096_2104336_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174788162.1|2104528_2104948_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788163.1|2104944_2105415_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788164.1|2105424_2107632_-	hypothetical protein	NA	A0A1L5C092	Aquamicrobium_phage	63.5	4.2e-09
WP_022522864.1|2107634_2108456_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788165.1|2108452_2109808_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788166.1|2109804_2115975_-	EF-hand domain-containing protein	NA	A0A2I7QT20	Vibrio_phage	29.9	1.6e-18
WP_022522861.1|2116049_2116358_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022522860.1|2116360_2117230_-	exonuclease-like protein	NA	A0A0R6PHP9	Moraxella_phage	40.5	6.0e-52
WP_082116875.1|2117305_2117863_-	DUF1799 domain-containing protein	NA	D6PGB0	uncultured_phage	38.3	3.4e-08
WP_174788167.1|2117814_2118156_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022522857.1|2118235_2119201_-	hypothetical protein	NA	D6PGA5	uncultured_phage	31.4	4.4e-27
WP_053857031.1|2119193_2119379_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788168.1|2119439_2120168_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022522855.1|2120164_2120617_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022522854.1|2120603_2120939_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_022522853.1|2120942_2121503_-|head,tail	phage head-tail connector protein	head,tail	K7PKT4	Enterobacteria_phage	51.8	1.0e-07
WP_022522852.1|2121595_2121829_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788169.1|2121922_2123218_-|capsid	phage major capsid protein	capsid	Q6UAX6	Klebsiella_phage	60.4	1.6e-136
WP_174788170.1|2123290_2124229_-	S49 family peptidase	NA	Q7Y411	Yersinia_phage	48.1	1.1e-75
WP_174788171.1|2124216_2125494_-|portal	phage portal protein	portal	Q6UAX8	Klebsiella_phage	63.8	1.4e-153
WP_088700352.1|2125493_2125691_-	hypothetical protein	NA	Q8W630	Enterobacteria_phage	48.1	8.6e-07
WP_174788172.1|2125684_2127400_-|terminase	terminase large subunit	terminase	U5P0Q5	Shigella_phage	54.4	5.5e-174
WP_088700354.1|2127406_2127877_-|terminase	phage terminase small subunit P27 family	terminase	A4JWZ6	Burkholderia_virus	49.7	1.2e-35
WP_053857030.1|2127989_2128355_-	HNH endonuclease	NA	A0A1V0E8A5	Vibrio_phage	51.3	1.7e-24
WP_053857029.1|2128451_2128637_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022522844.1|2128593_2129010_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022522843.1|2129006_2129219_-	hypothetical protein	NA	A0A1J0GV02	Halomonas_phage	45.5	2.4e-07
WP_022522842.1|2129215_2129542_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022522841.1|2129538_2130045_-	N-acetylmuramoyl-L-alanine amidase	NA	A0A0S2MVL1	Pseudomonas_phage	53.8	1.0e-35
WP_053857028.1|2130587_2130779_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174788173.1|2130795_2131728_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022522839.1|2131747_2132362_-	hypothetical protein	NA	A0A1J0GV17	Halomonas_phage	41.2	5.6e-28
WP_053857027.1|2132484_2132667_+	type II toxin-antitoxin system HicA family toxin	NA	A0A2H4JDU5	uncultured_Caudovirales_phage	58.3	7.0e-11
WP_022522837.1|2132733_2133153_+	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJC0	Moraxella_phage	38.1	2.0e-21
WP_082116925.1|2133155_2133653_-	VRR-NUC domain-containing protein	NA	A0A2D1GNH3	Pseudomonas_phage	43.2	8.6e-19
WP_053857026.1|2133661_2133976_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022522833.1|2134236_2134593_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022522832.1|2134579_2134867_-	hypothetical protein	NA	NA	NA	NA	NA
WP_053857224.1|2134866_2135235_-	HNH endonuclease	NA	Q3HQV7	Burkholderia_phage	48.3	8.3e-27
WP_022522830.1|2135273_2135594_-	winged helix-turn-helix transcriptional regulator	NA	A0A1J0GUU5	Halomonas_phage	43.8	1.1e-11
WP_022522828.1|2136230_2137187_-	helix-turn-helix domain-containing protein	NA	A0A1W6JP36	Morganella_phage	28.3	4.2e-06
WP_053857024.1|2137183_2137441_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022522826.1|2137523_2137766_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022522825.1|2137861_2138554_+	phage regulatory protein	NA	A0A2H4J176	uncultured_Caudovirales_phage	43.0	1.7e-41
WP_022522824.1|2138694_2139081_+	response regulator transcription factor	NA	NA	NA	NA	NA
WP_022522823.1|2139077_2139356_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022522822.1|2139352_2139649_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022522821.1|2139645_2139927_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022522820.1|2139936_2140188_+	hypothetical protein	NA	A0A1J0GUW1	Halomonas_phage	64.6	2.7e-13
WP_022522819.1|2140283_2140580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022522817.1|2140581_2141514_+	recombination-associated protein RdgC	NA	A0A1J0GUV6	Halomonas_phage	70.2	3.0e-113
>prophage 3
NZ_CP054580	Halomonas titanicae strain GPM3 chromosome, complete genome	5695972	2527666	2541419	5695972	tail,head	Pseudomonas_phage(28.57%)	13	NA	NA
WP_174788199.1|2527666_2532469_-	host specificity protein J	NA	A0A2I6PHT2	Pseudomonas_phage	42.9	1.4e-190
WP_174788200.1|2532533_2533118_-|tail	tail assembly protein	tail	Q6JIL3	Burkholderia_virus	34.0	3.6e-16
WP_174788201.1|2533238_2533964_-	C40 family peptidase	NA	W6E9P7	Rhizobium_phage	36.5	2.9e-39
WP_174788202.1|2533965_2534664_-|tail	phage minor tail protein L	tail	A0A2I6PHT9	Pseudomonas_phage	37.8	2.9e-41
WP_174788203.1|2534660_2535008_-|tail	phage tail protein	tail	NA	NA	NA	NA
WP_174788204.1|2535116_2538320_-|tail	phage tail tape measure protein	tail	F4YXU1	Roseobacter_phage	37.6	1.8e-48
WP_174788205.1|2538534_2538813_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788206.1|2538836_2539208_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788207.1|2539347_2539803_-	hypothetical protein	NA	A0A1V0E8B3	Vibrio_phage	31.8	6.0e-11
WP_174788208.1|2539934_2540309_-	DUF3168 domain-containing protein	NA	NA	NA	NA	NA
WP_174788209.1|2540319_2540769_-	HK97 gp10 family phage protein	NA	A0A1J0GUY2	Halomonas_phage	38.6	1.0e-15
WP_174788210.1|2540761_2541115_-|head	phage head closure protein	head	NA	NA	NA	NA
WP_174788211.1|2541107_2541419_-|head,tail	phage gp6-like head-tail connector protein	head,tail	NA	NA	NA	NA
>prophage 4
NZ_CP054580	Halomonas titanicae strain GPM3 chromosome, complete genome	5695972	2657393	2739827	5695972	tail,transposase,protease,integrase,head	Pseudomonas_phage(27.78%)	83	2659714:2659759	2741346:2741391
WP_174788252.1|2657393_2658555_+|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.9	9.2e-56
WP_174788253.1|2658789_2659071_-	XRE family transcriptional regulator	NA	A0A2D1GR59	Pseudomonas_phage	48.3	2.3e-13
WP_174788254.1|2659067_2659415_-	type II toxin-antitoxin system RelE/ParE family toxin	NA	NA	NA	NA	NA
2659714:2659759	attL	TGGTGGGCCCAGTAGGACTTGAACCTACGACCAAGGGATTATGAGT	NA	NA	NA	NA
WP_174788255.1|2661602_2662580_+	oxidoreductase	NA	NA	NA	NA	NA
WP_174788256.1|2662608_2663826_+	Gfo/Idh/MocA family oxidoreductase	NA	NA	NA	NA	NA
WP_174788257.1|2663859_2664345_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174788258.1|2665213_2666062_-	carboxylating nicotinate-nucleotide diphosphorylase	NA	NA	NA	NA	NA
WP_174788259.1|2667115_2669029_-	TRAP transporter fused permease subunit	NA	NA	NA	NA	NA
WP_174788260.1|2669064_2670063_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_174788478.1|2670166_2671159_-	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_174788261.1|2671238_2672552_-	Rieske 2Fe-2S domain-containing protein	NA	NA	NA	NA	NA
WP_174788262.1|2672790_2673279_+	sigma 54-interacting transcriptional regulator	NA	NA	NA	NA	NA
WP_174788263.1|2674090_2674339_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174788264.1|2674342_2675134_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174788265.1|2676345_2676567_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174788266.1|2676635_2676839_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174788267.1|2677609_2678791_-	MFS transporter	NA	NA	NA	NA	NA
WP_174788268.1|2679128_2681060_-	TRAP transporter fused permease subunit	NA	NA	NA	NA	NA
WP_174788269.1|2681064_2682021_-	TAXI family TRAP transporter solute-binding subunit	NA	NA	NA	NA	NA
WP_174788479.1|2682102_2682837_-	class II aldolase/adducin family protein	NA	NA	NA	NA	NA
WP_174788270.1|2682970_2683885_+	LysR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174788271.1|2683881_2685624_-	thiamine pyrophosphate-binding protein	NA	NA	NA	NA	NA
WP_174788272.1|2685632_2687090_-	aldehyde dehydrogenase family protein	NA	NA	NA	NA	NA
WP_174788273.1|2687436_2689386_+	FAD-dependent monooxygenase	NA	NA	NA	NA	NA
WP_174788480.1|2689553_2690024_+	MarR family transcriptional regulator	NA	NA	NA	NA	NA
WP_174788252.1|2690345_2691508_-|transposase	IS3 family transposase	transposase	A0A0P0I4A4	Acinetobacter_phage	41.9	9.2e-56
WP_174788481.1|2691753_2692116_-|transposase	transposase	transposase	A0A1B1P773	Bacillus_phage	48.4	1.4e-18
WP_174788274.1|2692130_2692664_-|transposase	transposase	transposase	NA	NA	NA	NA
WP_174788275.1|2694022_2694223_+	SPW repeat protein	NA	NA	NA	NA	NA
WP_174788276.1|2694444_2694942_-	DNA repair protein RadC	NA	NA	NA	NA	NA
WP_174788277.1|2695036_2695648_-	YqaJ viral recombinase family protein	NA	A0A1B0VMB3	Pseudomonas_phage	68.8	1.6e-75
WP_174788278.1|2695685_2696441_-	ERF family protein	NA	Q9MC70	Pseudomonas_phage	57.5	6.6e-63
WP_174788279.1|2696464_2696635_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788280.1|2696756_2697725_-	DUF932 domain-containing protein	NA	A0A0H4INH5	Stenotrophomonas_phage	43.0	2.5e-62
WP_174788281.1|2697835_2698102_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788282.1|2698753_2699449_+	inovirus-type Gp2 protein	NA	NA	NA	NA	NA
WP_174788283.1|2700459_2701917_+	DUF3987 domain-containing protein	NA	NA	NA	NA	NA
WP_174788284.1|2702030_2702744_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788285.1|2703133_2704141_+|integrase	site-specific integrase	integrase	A0A0S2SYQ7	Pseudomonas_phage	29.2	4.6e-19
WP_089691650.1|2704340_2705045_-	c repressor	NA	A0A0A7DJB4	Pseudomonas_phage	54.7	1.5e-69
WP_174788286.1|2705197_2705551_+	helix-turn-helix domain-containing protein	NA	NA	NA	NA	NA
WP_174788287.1|2705553_2705991_+	hypothetical protein	NA	A0A0A1IVF5	Pseudomonas_phage	66.2	2.8e-50
WP_089691665.1|2705987_2708045_+|integrase,transposase	DDE-type integrase/transposase/recombinase	integrase,transposase	A0A2H4JEQ4	uncultured_Caudovirales_phage	50.4	7.3e-181
WP_089691668.1|2708086_2708806_+	AAA family ATPase	NA	A0A2H4J809	uncultured_Caudovirales_phage	68.5	3.3e-88
WP_089691671.1|2708808_2709453_+	hypothetical protein	NA	A0A1B1P6Z8	Rhodovulum_phage	37.2	1.2e-25
WP_089691674.1|2709449_2709836_+	hypothetical protein	NA	A0A0A1IWY8	Pseudomonas_phage	50.9	1.3e-27
WP_089691677.1|2709832_2710474_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089691680.1|2710470_2710920_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089691682.1|2710922_2711555_+	DUF3164 family protein	NA	Q5ZR10	Pseudomonas_phage	63.5	6.7e-69
WP_089691685.1|2711556_2711826_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089691688.1|2711908_2712607_+	DUF2786 domain-containing protein	NA	A0A2P9JZH4	Alteromonadaceae_phage	67.8	3.9e-78
WP_089691691.1|2712603_2713050_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089691695.1|2713258_2713681_+	regulatory protein GemA	NA	H1ZZD1	Pseudomonas_virus	56.0	6.3e-31
WP_089691698.1|2713667_2714096_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089691701.1|2714126_2714459_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089691704.1|2714462_2714816_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089691786.1|2715030_2715321_+	hypothetical protein	NA	A0A2P1A4C6	Alteromonadaceae_phage	62.8	1.5e-23
WP_170834154.1|2715322_2715481_+	hypothetical protein	NA	NA	NA	NA	NA
WP_089691789.1|2715528_2716143_+	transglycosylase SLT domain-containing protein	NA	A0A2P9JZI1	Alteromonadaceae_phage	66.5	4.0e-74
WP_089691706.1|2716127_2716481_+	hypothetical protein	NA	A0A2P9JZI2	Alteromonadaceae_phage	40.2	2.6e-09
WP_089691710.1|2716477_2716786_+	hypothetical protein	NA	A0A2P9JZI3	Alteromonadaceae_phage	42.0	7.2e-08
WP_089691714.1|2716795_2717140_+	DUF2730 family protein	NA	NA	NA	NA	NA
WP_089691717.1|2717139_2717445_+	hypothetical protein	NA	A0A2P9JZI6	Alteromonadaceae_phage	78.6	7.0e-40
WP_089691720.1|2717447_2717999_+	DUF3486 family protein	NA	A0A2P9JZI7	Alteromonadaceae_phage	58.9	4.5e-53
WP_089691723.1|2717995_2719495_+	hypothetical protein	NA	A4JWJ4	Burkholderia_virus	50.8	3.6e-129
WP_089691728.1|2719488_2721096_+	DUF935 domain-containing protein	NA	J9SVY0	Pseudomonas_phage	42.7	1.8e-110
WP_089691730.1|2721070_2722252_+	hypothetical protein	NA	A0A1B0T6H8	Thiobacimonas_phage	46.7	8.5e-57
WP_174788288.1|2722369_2722810_+	phage virion morphogenesis protein	NA	A0A2H4J9E5	uncultured_Caudovirales_phage	31.0	1.5e-11
WP_174788289.1|2722988_2724317_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174788290.1|2724426_2725464_+|protease	protease (I) and scaffold (Z) protein	protease	A0A0M5N0Q6	Ralstonia_phage	38.5	6.1e-43
WP_174788291.1|2725498_2725936_+	hypothetical protein	NA	A0A1B0T6E4	Thiobacimonas_phage	54.4	1.9e-30
WP_174788292.1|2725950_2726853_+|head	Mu-like prophage major head subunit gpT family protein	head	M4SRT6	Rhodobacter_phage	42.8	1.3e-68
WP_174788293.1|2726918_2727416_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174788294.1|2727419_2727830_+	DUF1320 domain-containing protein	NA	A0A2D1GNP0	Pseudomonas_phage	35.7	1.6e-10
WP_174788295.1|2727840_2728137_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174788296.1|2728136_2728580_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174788297.1|2728576_2729533_+	hypothetical protein	NA	G8EY04	Synechococcus_phage	36.4	5.1e-44
WP_174788298.1|2729594_2729918_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174788482.1|2729914_2730283_+	DUF1799 domain-containing protein	NA	D6PGB0	uncultured_phage	36.0	2.3e-05
WP_174788299.1|2730300_2735958_+	EF-hand domain-containing protein	NA	A0A2I7RB22	Vibrio_phage	32.3	1.2e-39
WP_174788300.1|2735954_2737391_+	hypothetical protein	NA	F8TV92	EBPR_siphovirus	28.2	3.5e-36
WP_174788301.1|2737392_2738268_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174788302.1|2738267_2739827_+|tail	tail fiber protein	tail	E3T4R8	Cafeteria_roenbergensis_virus	30.6	3.7e-07
2741346:2741391	attR	TGGTGGGCCCAGTAGGACTTGAACCTACGACCAAGGGATTATGAGT	NA	NA	NA	NA
>prophage 5
NZ_CP054580	Halomonas titanicae strain GPM3 chromosome, complete genome	5695972	4633740	4705063	5695972	portal,tail,transposase,plate,protease,capsid,terminase,integrase,head	uncultured_Caudovirales_phage(22.5%)	89	4625866:4625883	4687734:4687751
4625866:4625883	attL	GTGCTGGTCACCGATATT	NA	NA	NA	NA
WP_022519777.1|4633740_4634685_+|transposase	IS5 family transposase	transposase	Q38213	Escherichia_phage	54.8	1.8e-94
WP_053857146.1|4635351_4636206_-	phosphate/phosphite/phosphonate ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_022520790.1|4636468_4638139_+	5'-nucleotidase C-terminal domain-containing protein	NA	A0A1M7XTW9	Cedratvirus	27.0	2.4e-25
WP_022520789.1|4638163_4638532_-	DUF1428 domain-containing protein	NA	NA	NA	NA	NA
WP_022520788.1|4638553_4638916_-	YciI family protein	NA	NA	NA	NA	NA
WP_022520787.1|4638912_4639758_-	VOC family protein	NA	NA	NA	NA	NA
WP_022520786.1|4639840_4641070_-	RNA polymerase sigma factor	NA	NA	NA	NA	NA
WP_022520785.1|4641160_4642216_-	sn-glycerol-3-phosphate import ATP-binding protein UgpC	NA	G9BWD6	Planktothrix_phage	32.7	2.5e-20
WP_022520784.1|4642217_4643060_-	sn-glycerol-3-phosphate ABC transporter permease UgpE	NA	NA	NA	NA	NA
WP_022520783.1|4643078_4643963_-	sn-glycerol-3-phosphate ABC transporter permease UgpA	NA	NA	NA	NA	NA
WP_022520782.1|4644053_4645379_-	sn-glycerol-3-phosphate ABC transporter substrate-binding protein UgpB	NA	NA	NA	NA	NA
WP_022520781.1|4645595_4646759_+	acetylornithine deacetylase	NA	NA	NA	NA	NA
WP_022520780.1|4646840_4647152_-	hypothetical protein	NA	NA	NA	NA	NA
WP_022520779.1|4647336_4647810_+	SEC-C domain-containing protein	NA	NA	NA	NA	NA
WP_022520778.1|4647802_4648102_+	GIY-YIG nuclease family protein	NA	NA	NA	NA	NA
WP_022520777.1|4648137_4649172_+	histone deacetylase family protein	NA	A0A2K9L4C2	Tupanvirus	35.6	1.8e-39
WP_022520776.1|4649274_4649610_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022520774.1|4649840_4651697_+	ABC transporter ATP-binding protein	NA	G3M9Y6	Bacillus_virus	33.5	3.6e-17
WP_089690947.1|4651747_4653277_+	ABC transporter substrate-binding protein	NA	NA	NA	NA	NA
WP_009287871.1|4653371_4654295_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_009287872.1|4654297_4655152_+	ABC transporter permease	NA	NA	NA	NA	NA
WP_022520771.1|4655148_4656936_+	hypothetical protein	NA	NA	NA	NA	NA
WP_022520770.1|4656988_4658680_+	VRR-NUC domain-containing protein	NA	NA	NA	NA	NA
WP_022520769.1|4658676_4660965_+	ATP-dependent DNA helicase	NA	NA	NA	NA	NA
WP_009287879.1|4660986_4661769_+	sulfite exporter TauE/SafE family protein	NA	NA	NA	NA	NA
WP_082116912.1|4661779_4662964_-	MFS transporter	NA	NA	NA	NA	NA
WP_022520767.1|4663082_4663262_-	hypothetical protein	NA	NA	NA	NA	NA
WP_138800243.1|4663258_4663324_-	type II toxin-antitoxin system HigB family toxin	NA	NA	NA	NA	NA
WP_022520766.1|4663379_4663535_-	DUF4113 domain-containing protein	NA	NA	NA	NA	NA
WP_022520765.1|4663868_4664288_-	type II toxin-antitoxin system HicB family antitoxin	NA	A0A0R6PJ17	Moraxella_phage	53.3	6.1e-34
WP_082116825.1|4664326_4664509_-	type II toxin-antitoxin system HicA family toxin	NA	D6R431	Bacillus_phage	63.8	2.7e-15
WP_022520764.1|4664838_4665195_-	type II toxin-antitoxin system HicB family antitoxin	NA	NA	NA	NA	NA
WP_174788353.1|4665763_4667110_+|integrase	site-specific integrase	integrase	Q9T1Z2	Lactococcus_phage	30.9	3.4e-09
WP_174788354.1|4667104_4667413_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788355.1|4667409_4667730_-	hypothetical protein	NA	A0A1J0GUZ1	Halomonas_phage	48.8	5.7e-16
WP_174788356.1|4667868_4668090_-	TraR/DksA family transcriptional regulator	NA	B5TA71	Burkholderia_phage	62.2	8.2e-06
WP_174788357.1|4668104_4670423_-	replication endonuclease	NA	A4JWW0	Burkholderia_virus	37.1	2.0e-65
WP_174788358.1|4670419_4670665_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788359.1|4670661_4671072_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788360.1|4671082_4671460_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788361.1|4671440_4671836_-	ogr/Delta-like zinc finger family protein	NA	NA	NA	NA	NA
WP_041158940.1|4671828_4672020_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788362.1|4672057_4672261_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788363.1|4672296_4672503_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788364.1|4672644_4672887_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174788365.1|4673031_4673697_+	LexA family transcriptional regulator	NA	A0A1C6ZDG7	Pseudomonas_phage	29.0	2.2e-17
WP_174788366.1|4673762_4674332_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174788367.1|4674361_4674616_+	DUF4177 domain-containing protein	NA	A0A0A7NPW2	Enterobacteria_phage	64.6	9.4e-22
WP_174788368.1|4674605_4674812_+	membrane protein insertion efficiency factor YidD	NA	NA	NA	NA	NA
WP_174788369.1|4675013_4675769_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174788370.1|4675765_4677085_-	Y-family DNA polymerase	NA	I6RSM4	Salmonella_phage	41.6	1.7e-82
WP_174788371.1|4677201_4677552_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174788372.1|4677867_4678323_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174788373.1|4678322_4678715_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174788374.1|4678863_4679763_-|protease	ATP-dependent Clp protease proteolytic subunit	protease	NA	NA	NA	NA
WP_174788375.1|4679828_4680035_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788376.1|4680502_4681468_-	phage late control D family protein	NA	A0A2H4JAV0	uncultured_Caudovirales_phage	49.5	1.8e-76
WP_174788377.1|4681467_4681917_-|tail	phage tail protein	tail	A0A2H4JG54	uncultured_Caudovirales_phage	51.0	3.8e-34
WP_174788378.1|4681939_4685560_-|tail	phage tail tape measure protein	tail	Q9ZXK0	Pseudomonas_virus	30.2	2.7e-85
WP_159176383.1|4685571_4685709_-|tail	GpE family phage tail protein	tail	NA	NA	NA	NA
WP_174788379.1|4685750_4686119_-|tail	phage tail assembly protein	tail	A4PE51	Ralstonia_virus	57.6	1.3e-19
WP_174788380.1|4686181_4686688_-|tail	phage major tail tube protein	tail	Q9ZXK3	Pseudomonas_virus	47.9	4.8e-41
WP_174788381.1|4686722_4687895_-|tail	phage tail sheath protein	tail	A0A2H4JCP8	uncultured_Caudovirales_phage	66.2	2.4e-152
4687734:4687751	attR	AATATCGGTGACCAGCAC	NA	NA	NA	NA
WP_174788382.1|4688709_4689321_+	hypothetical protein	NA	NA	NA	NA	NA
WP_174788383.1|4689389_4689869_-	hypothetical protein	NA	B0ZSG6	Halomonas_phage	66.4	2.5e-39
WP_174788384.1|4689880_4690765_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788385.1|4690761_4691136_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788386.1|4691132_4691387_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788387.1|4691379_4691739_-	hypothetical protein	NA	B0ZSG2	Halomonas_phage	55.3	2.1e-27
WP_174788388.1|4691735_4692263_-|tail	phage tail protein	tail	A0A219YAZ4	Aeromonas_phage	33.1	4.7e-15
WP_174788389.1|4692259_4693210_-|tail	phage tail protein I	tail	V9IQK7	Stenotrophomonas_phage	40.2	1.3e-26
WP_174788390.1|4693206_4694106_-|plate	baseplate J/gp47 family protein	plate	S4TNY7	Salmonella_phage	53.3	1.6e-71
WP_174788391.1|4694102_4694441_-	GPW/gp25 family protein	NA	A0A2H4JE52	uncultured_Caudovirales_phage	52.7	1.2e-24
WP_174788392.1|4694443_4694719_-	PAAR domain-containing protein	NA	K4ICQ1	Acidithiobacillus_phage	46.3	2.7e-14
WP_174788393.1|4694728_4695073_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788394.1|4695099_4695576_-|plate	phage baseplate assembly protein V	plate	A4PE41	Ralstonia_virus	38.5	4.2e-23
WP_174788395.1|4695651_4696110_-	phage virion morphogenesis protein	NA	A0A2H4J927	uncultured_Caudovirales_phage	52.3	1.2e-35
WP_174788396.1|4696106_4696601_-|tail	phage tail protein	tail	A0A2H4J906	uncultured_Caudovirales_phage	39.7	1.7e-19
WP_174788397.1|4696712_4697135_-	hypothetical protein	NA	NA	NA	NA	NA
WP_174788398.1|4697131_4697617_-	lysozyme	NA	A0A0U4JP67	Pseudomonas_phage	59.9	2.7e-41
WP_174788399.1|4697606_4697813_-	hypothetical protein	NA	A0A2H4J9Q9	uncultured_Caudovirales_phage	50.7	6.7e-10
WP_174788400.1|4697819_4698035_-|tail	tail protein X	tail	F1BUQ5	Erwinia_phage	43.3	4.5e-09
WP_174788401.1|4698031_4698493_-|head	head completion/stabilization protein	head	A0A2H4JCS4	uncultured_Caudovirales_phage	43.2	6.5e-21
WP_174788402.1|4698607_4699288_-|terminase	terminase	terminase	E5FFI5	Burkholderia_phage	46.2	5.6e-45
WP_174788403.1|4699297_4700314_-|capsid	phage major capsid protein, P2 family	capsid	Q9ZXM3	Pseudomonas_virus	59.6	1.0e-111
WP_174788404.1|4700368_4701190_-|capsid	GPO family capsid scaffolding protein	capsid	A0A2H4J928	uncultured_Caudovirales_phage	48.7	3.1e-58
WP_174788488.1|4701335_4703126_+|terminase	terminase	terminase	A0A077K8Q7	Ralstonia_phage	57.5	1.5e-206
WP_174788405.1|4703115_4704177_+|portal	phage portal protein	portal	E5FFI9	Burkholderia_phage	56.5	9.5e-108
WP_174788489.1|4704304_4705063_+	DNA adenine methylase	NA	A2I2Y7	Vibrio_virus	61.2	5.8e-91
>prophage 6
NZ_CP054580	Halomonas titanicae strain GPM3 chromosome, complete genome	5695972	5218981	5230885	5695972	tRNA	Pseudomonas_phage(33.33%)	8	NA	NA
WP_022519969.1|5218981_5220271_+	phosphopyruvate hydratase	NA	A0A1X9I5Z8	Streptococcus_phage	59.1	8.8e-132
WP_170834172.1|5221104_5222445_+	group II intron reverse transcriptase/maturase	NA	A0A0U4J920	Pseudomonas_phage	29.4	1.0e-26
WP_007111508.1|5222686_5223010_-	ferredoxin family protein	NA	NA	NA	NA	NA
WP_022519968.1|5223169_5225731_-	DNA mismatch repair protein MutS	NA	A0A1V0SGG8	Hokovirus	22.4	9.2e-32
WP_035538996.1|5225814_5226354_+	CinA family protein	NA	B5TK85	Pseudomonas_phage	58.8	3.8e-36
WP_009286780.1|5226483_5227557_+	recombinase RecA	NA	A0A2D1GPX2	Mycobacterium_phage	61.6	1.7e-112
WP_022519966.1|5227596_5228061_+	regulatory protein RecX	NA	NA	NA	NA	NA
WP_022519965.1|5228275_5230885_+|tRNA	alanine--tRNA ligase	tRNA	A0A1V0SK38	Klosneuvirus	36.8	4.7e-76
